Starting /dee2/code/volunteer_pipeline.sh SRR7169855 current disk space = 3052387508224 free memory = 1272541440 SRR7169855 SRAfilesize 40e6018aaedb447b67f0f09e08382c12 SRR7169855.sra SRR7169855.sra file validated SRR7169855 is paired end SRR7169855 is conventional basespace SRR7169855 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169855_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.3875 25.0 18.0 30.0 18.0 32.0 2 31.419 33.0 31.0 33.0 29.0 33.0 3 32.3265 33.0 33.0 33.0 31.0 33.0 4 32.79275 33.0 33.0 33.0 31.0 34.0 5 33.35075 34.0 33.0 34.0 33.0 34.0 6 37.27625 38.0 37.0 38.0 36.0 38.0 7 35.9245 38.0 37.0 38.0 31.0 38.0 8 37.22075 38.0 38.0 38.0 36.0 38.0 9 37.577 38.0 38.0 38.0 37.0 38.0 10-14 37.66835 38.0 38.0 38.0 38.0 38.0 15-19 37.65255 38.0 38.0 38.0 38.0 38.0 20-24 37.6289 38.0 38.0 38.0 38.0 38.0 25-29 37.5792 38.0 38.0 38.0 38.0 38.0 30-34 37.559099999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.5007 38.0 38.0 38.0 37.8 38.0 40-44 37.3663 38.0 38.0 38.0 37.0 38.0 45-49 37.4707 38.0 38.0 38.0 37.2 38.0 50-54 37.24300000000001 38.0 38.0 38.0 36.6 38.0 55-59 36.9366 38.0 38.0 38.0 35.6 38.0 60-64 37.064150000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.53685 38.0 37.6 38.0 33.4 38.0 70-74 36.98780000000001 38.0 38.0 38.0 35.6 38.0 75-79 37.0495 38.0 38.0 38.0 36.0 38.0 80-84 36.932550000000006 38.0 38.0 38.0 35.8 38.0 85-89 36.75465 38.0 38.0 38.0 35.0 38.0 90-94 35.4215 38.0 36.2 38.0 28.0 38.0 95-99 36.1802 38.0 37.0 38.0 32.6 38.0 100-104 35.45735 38.0 36.4 38.0 29.6 38.0 105-109 35.795100000000005 38.0 36.6 38.0 31.2 38.0 110-114 35.04715 38.0 35.4 38.0 27.2 38.0 115-119 34.85875 38.0 35.0 38.0 26.0 38.0 120-124 34.1185 37.6 33.2 38.0 25.0 38.0 125-129 34.438250000000004 38.0 35.0 38.0 24.0 38.0 130-134 34.9228 38.0 35.0 38.0 27.2 38.0 135-139 34.6491 38.0 34.6 38.0 26.4 38.0 140-144 33.5235 37.6 33.0 38.0 22.2 38.0 145-149 32.91459999999999 37.4 33.4 38.0 18.6 38.0 150-151 29.794875 36.0 27.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 3.0 15 1.0 16 1.0 17 1.0 18 3.0 19 3.0 20 4.0 21 3.0 22 5.0 23 9.0 24 4.0 25 8.0 26 14.0 27 19.0 28 19.0 29 37.0 30 40.0 31 54.0 32 77.0 33 126.0 34 259.0 35 469.0 36 1322.0 37 1517.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.2 11.05 9.375 36.375 2 22.061030515257627 13.75687843921961 33.84192096048024 30.340170085042523 3 17.9 18.05 27.700000000000003 36.35 4 22.475 26.075 24.175 27.275 5 23.275000000000002 30.475 24.65 21.6 6 19.650000000000002 34.9 24.95 20.5 7 14.2 26.6 41.8 17.4 8 17.474999999999998 26.3 31.1 25.124999999999996 9 16.925 24.725 35.625 22.725 10-14 19.77 30.255 27.525 22.45 15-19 19.355 28.715000000000003 28.275 23.655 20-24 19.885 28.854999999999997 27.905 23.355 25-29 19.85 29.205 27.405 23.54 30-34 19.85 29.044999999999998 27.725 23.380000000000003 35-39 20.07 28.865000000000002 27.415 23.65 40-44 19.925 28.744999999999997 27.884999999999998 23.445 45-49 20.215 28.634999999999998 27.355 23.794999999999998 50-54 20.169999999999998 28.79 27.66 23.380000000000003 55-59 20.31 28.84 27.224999999999998 23.625 60-64 20.0 29.03 27.075 23.895 65-69 20.515 28.610000000000003 27.235 23.64 70-74 20.585 28.050000000000004 27.765 23.599999999999998 75-79 20.044999999999998 28.84 27.700000000000003 23.415 80-84 19.955000000000002 28.439999999999998 28.125 23.48 85-89 19.73 28.37 28.15 23.75 90-94 20.21 28.51 28.000000000000004 23.28 95-99 20.549999999999997 28.225 27.37 23.855 100-104 20.3 28.205000000000002 27.96 23.535 105-109 20.575 28.985 27.175 23.265 110-114 20.424999999999997 28.799999999999997 27.765 23.01 115-119 20.885727167977556 28.916386954561396 27.167977556234657 23.02990832122639 120-124 20.67067067067067 28.773773773773776 26.87187187187187 23.683683683683686 125-129 20.125 28.439999999999998 27.37 24.065 130-134 20.61 28.794999999999998 26.685 23.91 135-139 20.86 28.185 27.04 23.915 140-144 20.507304382629577 28.301981188713228 27.13127876726036 24.05943566139684 145-149 20.745 28.27 27.134999999999998 23.849999999999998 150-151 21.05 27.712500000000002 27.6625 23.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.5 23 1.5 24 2.0 25 3.5 26 6.0 27 5.0 28 6.5 29 9.0 30 12.5 31 22.0 32 36.0 33 47.5 34 56.0 35 68.5 36 81.5 37 102.0 38 129.5 39 155.5 40 182.5 41 221.0 42 257.5 43 268.0 44 271.5 45 284.0 46 294.5 47 265.5 48 223.0 49 207.5 50 180.0 51 148.0 52 112.0 53 82.5 54 66.0 55 45.0 56 36.5 57 30.5 58 20.0 59 14.5 60 12.5 61 7.5 62 5.0 63 4.5 64 2.5 65 1.5 66 1.0 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.19499999999999998 120-124 0.1 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.06 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44640161046804 98.8 2 0.4781077000503271 0.95 3 0.050327126321087066 0.15 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9125000000000001 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 1.9874999999999998 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.4124999999999996 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 2.7875 0.0 0.0 0.0 0.0 120-121 3.0250000000000004 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.75 0.0 0.0 0.0 0.0 128-129 4.1375 0.0 0.0 0.0 0.0 130-131 4.625 0.0 0.0 0.0 0.0 132-133 5.0125 0.0 0.0 0.0 0.0 134-135 5.375 0.0 0.0 0.0 0.0 136-137 5.6625 0.0 0.0 0.0 0.0 138-139 5.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169855 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169855_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.28125 34.0 33.0 34.0 33.0 34.0 2 33.38125 34.0 33.0 34.0 33.0 34.0 3 33.43375 34.0 33.0 34.0 33.0 34.0 4 33.34575 34.0 33.0 34.0 33.0 34.0 5 33.38325 34.0 33.0 34.0 33.0 34.0 6 37.50425 38.0 38.0 38.0 38.0 38.0 7 37.50675 38.0 38.0 38.0 38.0 38.0 8 37.49625 38.0 38.0 38.0 38.0 38.0 9 37.565 38.0 38.0 38.0 38.0 38.0 10-14 37.453199999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.477549999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.1592 38.0 38.0 38.0 36.6 38.0 25-29 36.099849999999996 38.0 37.4 38.0 32.0 38.0 30-34 37.2264 38.0 38.0 38.0 36.8 38.0 35-39 37.43 38.0 38.0 38.0 38.0 38.0 40-44 37.260149999999996 38.0 38.0 38.0 37.4 38.0 45-49 37.331849999999996 38.0 38.0 38.0 37.6 38.0 50-54 37.18405 38.0 38.0 38.0 37.2 38.0 55-59 37.3374 38.0 38.0 38.0 37.4 38.0 60-64 37.1707 38.0 38.0 38.0 37.0 38.0 65-69 37.182249999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.2457 38.0 38.0 38.0 37.0 38.0 75-79 37.227250000000005 38.0 38.0 38.0 37.0 38.0 80-84 37.0886 38.0 38.0 38.0 37.0 38.0 85-89 36.78235 38.0 38.0 38.0 35.6 38.0 90-94 37.02955 38.0 38.0 38.0 36.8 38.0 95-99 36.947449999999996 38.0 38.0 38.0 36.0 38.0 100-104 36.7606 38.0 38.0 38.0 35.6 38.0 105-109 36.66054999999999 38.0 38.0 38.0 35.4 38.0 110-114 36.65125 38.0 38.0 38.0 35.0 38.0 115-119 36.498000000000005 38.0 38.0 38.0 34.6 38.0 120-124 36.313900000000004 38.0 38.0 38.0 34.0 38.0 125-129 36.18320000000001 38.0 37.8 38.0 33.8 38.0 130-134 36.00085 38.0 38.0 38.0 33.2 38.0 135-139 35.34895 38.0 36.0 38.0 30.8 38.0 140-144 35.296499999999995 38.0 36.0 38.0 30.8 38.0 145-149 34.4173 38.0 35.2 38.0 25.4 38.0 150-151 30.956625000000003 36.5 29.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 0.0 14 1.0 15 5.0 16 2.0 17 3.0 18 2.0 19 3.0 20 8.0 21 3.0 22 3.0 23 0.0 24 7.0 25 5.0 26 10.0 27 12.0 28 16.0 29 24.0 30 25.0 31 36.0 32 44.0 33 63.0 34 115.0 35 202.0 36 559.0 37 2837.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.125 21.7 13.125 27.05 2 26.775 26.25 29.825000000000003 17.150000000000002 3 19.975 28.299999999999997 31.75 19.975 4 24.15 32.775 23.25 19.825 5 24.349999999999998 36.55 21.575 17.525 6 20.599999999999998 39.300000000000004 22.225 17.875 7 19.475 22.7 38.4 19.425 8 20.925 25.8 28.4 24.875 9 21.25 25.324999999999996 29.775000000000002 23.65 10-14 23.09 29.035 26.465 21.41 15-19 22.865 27.91 28.4 20.825 20-24 22.86 28.08 27.6 21.46 25-29 22.295 28.37 27.534999999999997 21.8 30-34 23.14 28.27 27.805000000000003 20.785 35-39 22.830000000000002 27.855 28.29 21.025 40-44 22.91 28.685 27.88 20.525 45-49 22.54 27.800000000000004 28.475 21.185000000000002 50-54 23.14 28.32 27.224999999999998 21.315 55-59 23.0 27.544999999999998 28.27 21.185000000000002 60-64 22.835 27.955000000000002 28.360000000000003 20.849999999999998 65-69 23.11 28.055000000000003 28.084999999999997 20.75 70-74 23.095 28.294999999999998 27.639999999999997 20.97 75-79 23.47 28.09 28.07 20.369999999999997 80-84 23.56 27.925 27.63 20.885 85-89 23.275000000000002 27.889999999999997 28.075 20.76 90-94 23.474999999999998 27.3 28.29 20.935000000000002 95-99 23.565 28.134999999999998 27.43 20.87 100-104 23.549999999999997 27.925 28.115000000000002 20.41 105-109 23.815 27.88 27.435 20.87 110-114 23.585 27.785 28.405 20.225 115-119 23.735 28.185 27.93 20.150000000000002 120-124 23.86 27.384999999999998 28.189999999999998 20.565 125-129 24.21 27.71 27.715 20.365 130-134 23.919999999999998 28.365000000000002 27.565 20.150000000000002 135-139 24.831038798498124 28.130162703379224 26.90362953692115 20.1351689612015 140-144 24.925 28.27 27.155 19.650000000000002 145-149 24.83 27.615000000000002 27.505000000000003 20.05 150-151 24.825 28.475 27.0125 19.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 2.0 26 2.0 27 3.5 28 5.5 29 8.0 30 11.0 31 16.0 32 22.5 33 38.5 34 55.0 35 67.0 36 77.0 37 96.5 38 132.0 39 152.5 40 194.5 41 252.0 42 275.5 43 281.5 44 295.5 45 288.5 46 270.5 47 256.5 48 222.5 49 205.5 50 190.5 51 146.0 52 108.5 53 88.5 54 69.5 55 43.0 56 18.5 57 18.5 58 18.5 59 13.5 60 11.5 61 6.5 62 4.5 63 7.0 64 7.0 65 2.5 66 2.0 67 1.5 68 1.0 69 1.5 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.125 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4271356783919598 0.8500000000000001 3 0.0 0.0 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.925 0.0 0.0 0.0 0.0 110-111 2.175 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 2.8125 0.0 0.0 0.0 0.0 118-119 3.0375 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.5 0.0 0.0 0.0 0.0 124-125 3.8375 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.5125 0.0 0.0 0.0 0.0 130-131 4.9875 0.0 0.0 0.0 0.0 132-133 5.4125 0.0 0.0 0.0 0.0 134-135 5.800000000000001 0.0 0.0 0.0 0.0 136-137 6.0875 0.0 0.0 0.0 0.0 138-139 6.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGTTCT 10 0.006830828 145.0 3 >>END_MODULE Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657715 spots for SRR7169855.sra Written 657715 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra Read 657714 spots for SRR7169855.sra Written 657714 spots for SRR7169855.sra SRR ids: ['SRR7169855.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s41d97i5 SRR7169855.sra spots: 13154281 blocks: [[1, 657714], [657715, 1315428], [1315429, 1973142], [1973143, 2630856], [2630857, 3288570], [3288571, 3946284], [3946285, 4603998], [4603999, 5261712], [5261713, 5919426], [5919427, 6577140], [6577141, 7234854], [7234855, 7892568], [7892569, 8550282], [8550283, 9207996], [9207997, 9865710], [9865711, 10523424], [10523425, 11181138], [11181139, 11838852], [11838853, 12496566], [12496567, 13154281]] SRR7169855 file size 4435853 SRR7169855 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169855 SRR7169855_1.fastq SRR7169855_2.fastq Input file: SRR7169855_1.fastq Paired file: SRR7169855_2.fastq trimmed: SRR7169855-trimmed-pair1.fastq, SRR7169855-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:05:36 2025 >> started Tue Feb 11 23:05:52 2025 >> done (15.970s) 13154281 read pairs processed; of these: 7675 ( 0.06%) short read pairs filtered out after trimming by size control 15422 ( 0.12%) empty read pairs filtered out after trimming by size control 13131184 (99.82%) read pairs available; of these: 5657803 (43.09%) trimmed read pairs available after processing 7473381 (56.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 0 0.00% 21 0 0.00% 22 3 0.00% 23 2 0.00% 24 4 0.00% 25 4 0.00% 26 1 0.00% 27 1 0.00% 28 5 0.00% 29 5 0.00% 30 5 0.00% 31 4 0.00% 32 7 0.00% 33 6 0.00% 34 4 0.00% 35 7 0.00% 36 7 0.00% 37 7 0.00% 38 11 0.00% 39 9 0.00% 40 19 0.00% 41 17 0.00% 42 19 0.00% 43 15 0.00% 44 22 0.00% 45 19 0.00% 46 38 0.00% 47 31 0.00% 48 45 0.00% 49 40 0.00% 50 45 0.00% 51 79 0.00% 52 82 0.00% 53 81 0.00% 54 90 0.00% 55 97 0.00% 56 128 0.00% 57 154 0.00% 58 151 0.00% 59 189 0.00% 60 232 0.00% 61 232 0.00% 62 293 0.00% 63 349 0.00% 64 414 0.00% 65 416 0.00% 66 485 0.00% 67 557 0.00% 68 654 0.00% 69 743 0.01% 70 812 0.01% 71 899 0.01% 72 1121 0.01% 73 1253 0.01% 74 1411 0.01% 75 1567 0.01% 76 1751 0.01% 77 2005 0.02% 78 2076 0.02% 79 2358 0.02% 80 2549 0.02% 81 3028 0.02% 82 3298 0.03% 83 3662 0.03% 84 4572 0.03% 85 5108 0.04% 86 5402 0.04% 87 5942 0.05% 88 6229 0.05% 89 6495 0.05% 90 7017 0.05% 91 7431 0.06% 92 8016 0.06% 93 8578 0.07% 94 9117 0.07% 95 9752 0.07% 96 10219 0.08% 97 10787 0.08% 98 10948 0.08% 99 11385 0.09% 100 11902 0.09% 101 12148 0.09% 102 13102 0.10% 103 13632 0.10% 104 14146 0.11% 105 14910 0.11% 106 15795 0.12% 107 16125 0.12% 108 16445 0.13% 109 16827 0.13% 110 17271 0.13% 111 17796 0.14% 112 18420 0.14% 113 18962 0.14% 114 19953 0.15% 115 20689 0.16% 116 21405 0.16% 117 22185 0.17% 118 22480 0.17% 119 22705 0.17% 120 23063 0.18% 121 23481 0.18% 122 24157 0.18% 123 24937 0.19% 124 25916 0.20% 125 26711 0.20% 126 27791 0.21% 127 28768 0.22% 128 29719 0.23% 129 30447 0.23% 130 31582 0.24% 131 32133 0.24% 132 33579 0.26% 133 35095 0.27% 134 36268 0.28% 135 37649 0.29% 136 40010 0.30% 137 42212 0.32% 138 44623 0.34% 139 48133 0.37% 140 50730 0.39% 141 55387 0.42% 142 61084 0.47% 143 69073 0.53% 144 80400 0.61% 145 98005 0.75% 146 124589 0.95% 147 170132 1.30% 148 263381 2.01% 149 546884 4.16% 150 2984347 22.73% 151 7473381 56.91% 13131184 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=33 prefix-density=0.25 prefix-fanout=2.3 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAAGGAAGAATAGAATAAAAGAAGCTGAGAACAGAAATTGTGGCACCATTTTAGTGGTTTTTGGATGAGGTGGGCTATATTGCTGCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=286.34 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.1 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=40 prefix-density=0.40 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.13 sequence-density-rank=12 fanout-score=55.14 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=13.9 sequence=TGTTGGTGGTGG SRR7169855 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:06:35 Started mapping on | Feb 11 23:06:35 Finished on | Feb 11 23:07:45 Mapping speed, Million of reads per hour | 675.32 Number of input reads | 13131184 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12599220 Uniquely mapped reads % | 95.95% Average mapped length | 294.34 Number of splices: Total | 12026649 Number of splices: Annotated (sjdb) | 11836955 Number of splices: GT/AG | 11858162 Number of splices: GC/AG | 136378 Number of splices: AT/AC | 9990 Number of splices: Non-canonical | 22119 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 216559 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 10807 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.28% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 323721 323721 323721 N_multimapping 216559 216559 216559 N_noFeature 293988 12473492 347649 N_ambiguous 125279 605 52770 UnstrandedReadsAssigned:12179953 PositiveStrandReadsAssigned:125123 NegativeStrandReadsAssigned:12198801 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169855 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169855-trimmed-pair1.fastq SRR7169855-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,131,184 reads, 12,102,963 reads pseudoaligned [quant] estimated average fragment length: 250.268 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR7169855.ke.tsv 34699 SRR7169855.se.tsv 87100 total ==> SRR7169855.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.73 151 7.34143 Potri.005G024800.1.v4.1 1035 785.732 28 3.06443 Potri.004G059700.1.v4.1 961 711.768 2 0.241633 Potri.007G009000.2.v4.1 1416 1166.73 0 0 Potri.003G141000.2.v4.1 2943 2693.73 295.069 9.41965 Potri.016G087400.1.v4.1 270 79.126 1046 1136.78 Potri.015G069301.1.v4.1 564 319.244 0 0 Potri.010G195200.1.v4.1 1773 1523.73 21 1.18516 Potri.012G127500.1.v4.1 977 727.762 2800 330.852 ==> SRR7169855.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1085 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 170 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169855 completed mapping pipeline successfully