Starting /dee2/code/volunteer_pipeline.sh SRR7169856 current disk space = 3052345810944 free memory = 1456906368 SRR7169856 SRAfilesize 280cd9d26a27b8a2b23c9a8f26f7d183 SRR7169856.sra SRR7169856.sra file validated SRR7169856 is paired end SRR7169856 is conventional basespace SRR7169856 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169856_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.68375 18.0 18.0 25.0 18.0 32.0 2 29.158 30.0 27.0 31.0 27.0 33.0 3 31.3615 33.0 31.0 33.0 29.0 33.0 4 32.5025 33.0 33.0 33.0 31.0 33.0 5 32.7735 33.0 33.0 34.0 31.0 34.0 6 36.90275 38.0 37.0 38.0 35.0 38.0 7 37.37675 38.0 38.0 38.0 36.0 38.0 8 37.5005 38.0 38.0 38.0 37.0 38.0 9 36.6605 38.0 38.0 38.0 35.0 38.0 10-14 37.53035 38.0 38.0 38.0 37.2 38.0 15-19 37.4073 38.0 38.0 38.0 37.0 38.0 20-24 37.43814999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.5858 38.0 38.0 38.0 38.0 38.0 30-34 37.51350000000001 38.0 38.0 38.0 37.8 38.0 35-39 37.47195 38.0 38.0 38.0 37.2 38.0 40-44 37.36465 38.0 38.0 38.0 36.8 38.0 45-49 37.46825 38.0 38.0 38.0 37.0 38.0 50-54 37.3715 38.0 38.0 38.0 37.0 38.0 55-59 37.241099999999996 38.0 38.0 38.0 36.2 38.0 60-64 37.1918 38.0 38.0 38.0 36.4 38.0 65-69 37.09385 38.0 38.0 38.0 36.0 38.0 70-74 37.070049999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.97645 38.0 38.0 38.0 35.4 38.0 80-84 36.691199999999995 38.0 38.0 38.0 34.6 38.0 85-89 36.192949999999996 38.0 37.0 38.0 33.0 38.0 90-94 36.57045 38.0 38.0 38.0 34.2 38.0 95-99 36.4234 38.0 37.4 38.0 34.0 38.0 100-104 36.248149999999995 38.0 37.0 38.0 33.6 38.0 105-109 35.13685 38.0 35.6 38.0 26.8 38.0 110-114 35.1582 38.0 35.4 38.0 27.0 38.0 115-119 35.356399999999994 38.0 35.8 38.0 29.6 38.0 120-124 35.2851 38.0 35.8 38.0 29.6 38.0 125-129 33.510549999999995 37.2 32.2 38.0 22.6 38.0 130-134 33.7402 37.6 33.2 38.0 23.0 38.0 135-139 34.02305 38.0 33.6 38.0 23.6 38.0 140-144 32.88615 37.6 31.8 38.0 19.8 38.0 145-149 31.733449999999998 36.4 31.4 38.0 14.0 38.0 150-151 27.42 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 0.0 15 1.0 16 0.0 17 1.0 18 2.0 19 5.0 20 3.0 21 4.0 22 4.0 23 5.0 24 7.0 25 10.0 26 16.0 27 10.0 28 27.0 29 30.0 30 49.0 31 64.0 32 95.0 33 159.0 34 284.0 35 564.0 36 1301.0 37 1355.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.324999999999996 16.2 9.9 35.575 2 23.0 14.124999999999998 33.324999999999996 29.549999999999997 3 18.25 19.675 27.725 34.35 4 22.45 27.975 23.35 26.224999999999998 5 21.65 32.95 23.799999999999997 21.6 6 19.275000000000002 37.2 24.3 19.225 7 15.15 27.6 40.050000000000004 17.2 8 17.325 26.775 29.7 26.200000000000003 9 16.6 26.5 32.15 24.75 10-14 19.195 30.964999999999996 26.765 23.075000000000003 15-19 19.38 29.75 27.675 23.195 20-24 19.175 29.175 27.845 23.805 25-29 19.35 30.225 26.805 23.62 30-34 19.73 29.37 27.389999999999997 23.51 35-39 19.994999999999997 28.64 27.79 23.575 40-44 19.744999999999997 29.14 27.400000000000002 23.715 45-49 20.505000000000003 29.165000000000003 27.33 23.0 50-54 20.525 29.25 27.155 23.07 55-59 19.785 29.744999999999997 26.935 23.535 60-64 19.77 28.599999999999998 27.755000000000003 23.875 65-69 19.59 29.2 27.675 23.535 70-74 19.509999999999998 29.015 27.51 23.965 75-79 19.905 28.860000000000003 27.315 23.919999999999998 80-84 19.895 29.160000000000004 27.415 23.53 85-89 20.36 29.375 26.86 23.405 90-94 20.095 29.044999999999998 27.279999999999998 23.580000000000002 95-99 20.71 28.285 27.255000000000003 23.75 100-104 20.825 28.685 26.935 23.555 105-109 20.685000000000002 28.74 27.54 23.035 110-114 20.380000000000003 28.615000000000002 27.91 23.095 115-119 20.66 28.825 27.224999999999998 23.29 120-124 20.1 28.470000000000002 27.575 23.855 125-129 20.810000000000002 28.249999999999996 27.389999999999997 23.549999999999997 130-134 20.52 27.889999999999997 28.055000000000003 23.535 135-139 20.75 27.705000000000002 27.295 24.25 140-144 20.72 28.095 27.495000000000005 23.69 145-149 20.745 28.15 27.32 23.785 150-151 20.4625 28.037499999999998 27.200000000000003 24.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 1.5 22 2.0 23 2.0 24 2.0 25 3.0 26 6.5 27 8.0 28 13.0 29 20.5 30 24.5 31 28.5 32 40.0 33 43.5 34 60.0 35 90.0 36 103.5 37 118.5 38 130.0 39 145.5 40 177.5 41 220.0 42 240.0 43 246.0 44 274.5 45 278.0 46 262.0 47 255.5 48 228.0 49 203.5 50 182.5 51 130.5 52 100.5 53 91.5 54 72.0 55 53.0 56 34.5 57 26.5 58 24.5 59 16.5 60 8.5 61 7.5 62 6.0 63 3.0 64 1.0 65 2.0 66 2.5 67 1.5 68 1.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.2999999999999998 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 1.9625 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.2125000000000004 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.5999999999999996 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 2.875 0.0 0.0 0.0 0.0 128-129 3.05 0.0 0.0 0.0 0.0 130-131 3.2625 0.0 0.0 0.0 0.0 132-133 3.4375 0.0 0.0 0.0 0.0 134-135 3.6125 0.0 0.0 0.0 0.0 136-137 3.8625 0.0 0.0 0.0 0.0 138-139 4.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGGGAT 10 0.006830828 145.0 145 >>END_MODULE SRR7169856 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169856_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.135 34.0 33.0 34.0 32.0 34.0 2 33.217 34.0 33.0 34.0 33.0 34.0 3 33.21375 34.0 33.0 34.0 33.0 34.0 4 33.165 34.0 33.0 34.0 33.0 34.0 5 33.26525 34.0 33.0 34.0 33.0 34.0 6 37.36525 38.0 38.0 38.0 37.0 38.0 7 37.31325 38.0 38.0 38.0 37.0 38.0 8 37.22025 38.0 38.0 38.0 37.0 38.0 9 37.317 38.0 38.0 38.0 37.0 38.0 10-14 37.25214999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.2594 38.0 38.0 38.0 37.0 38.0 20-24 37.27205 38.0 38.0 38.0 37.0 38.0 25-29 36.85265 38.0 38.0 38.0 35.0 38.0 30-34 37.207 38.0 38.0 38.0 36.8 38.0 35-39 36.9211 38.0 38.0 38.0 35.8 38.0 40-44 37.1786 38.0 38.0 38.0 36.8 38.0 45-49 36.7183 38.0 37.8 38.0 35.0 38.0 50-54 36.9791 38.0 38.0 38.0 36.2 38.0 55-59 36.979699999999994 38.0 38.0 38.0 36.0 38.0 60-64 36.9052 38.0 38.0 38.0 36.0 38.0 65-69 36.9103 38.0 38.0 38.0 36.0 38.0 70-74 36.9235 38.0 38.0 38.0 36.0 38.0 75-79 36.91185 38.0 38.0 38.0 36.0 38.0 80-84 36.687250000000006 38.0 38.0 38.0 35.0 38.0 85-89 36.5587 38.0 38.0 38.0 34.8 38.0 90-94 36.57615 38.0 38.0 38.0 34.8 38.0 95-99 36.45415 38.0 38.0 38.0 34.2 38.0 100-104 36.20625 38.0 38.0 38.0 33.6 38.0 105-109 36.1563 38.0 37.8 38.0 33.8 38.0 110-114 36.10965 38.0 37.4 38.0 33.8 38.0 115-119 35.8871 38.0 37.4 38.0 32.8 38.0 120-124 35.514 38.0 36.6 38.0 30.8 38.0 125-129 34.785900000000005 38.0 35.4 38.0 26.4 38.0 130-134 34.992149999999995 38.0 35.8 38.0 28.6 38.0 135-139 33.4341 38.0 33.4 38.0 19.6 38.0 140-144 33.1135 37.6 32.8 38.0 20.6 38.0 145-149 32.2981 37.6 32.2 38.0 14.8 38.0 150-151 28.55075 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 2.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 3.0 12 2.0 13 1.0 14 0.0 15 3.0 16 3.0 17 3.0 18 5.0 19 5.0 20 5.0 21 5.0 22 7.0 23 10.0 24 4.0 25 8.0 26 17.0 27 18.0 28 24.0 29 37.0 30 47.0 31 70.0 32 88.0 33 111.0 34 170.0 35 313.0 36 820.0 37 2207.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.95 21.425 15.75 24.875 2 27.35 25.775 28.9 17.974999999999998 3 19.675 29.825000000000003 31.125000000000004 19.375 4 22.3 34.150000000000006 24.4 19.15 5 24.15 35.55 22.35 17.95 6 20.625 39.225 21.7 18.45 7 19.975 21.025 38.725 20.275000000000002 8 22.325 24.725 27.474999999999998 25.474999999999998 9 21.95 25.624999999999996 28.95 23.474999999999998 10-14 22.665 29.744999999999997 26.279999999999998 21.310000000000002 15-19 23.32 28.775000000000002 27.0 20.905 20-24 22.675 28.410000000000004 27.27 21.645 25-29 23.095 28.43 27.465 21.01 30-34 22.939999999999998 27.97 28.060000000000002 21.029999999999998 35-39 22.955000000000002 28.465 28.055000000000003 20.525 40-44 22.884999999999998 27.975 28.050000000000004 21.09 45-49 22.965 28.044999999999998 27.68 21.310000000000002 50-54 22.994999999999997 28.410000000000004 28.035 20.560000000000002 55-59 23.02 28.08 28.43 20.47 60-64 23.095 28.449999999999996 28.005000000000003 20.45 65-69 23.435 27.445000000000004 28.499999999999996 20.62 70-74 23.485 28.144999999999996 28.449999999999996 19.919999999999998 75-79 23.585 27.675 28.025 20.715 80-84 23.24 28.384999999999998 28.17 20.205000000000002 85-89 23.46 27.825 28.375 20.34 90-94 23.294999999999998 27.589999999999996 28.485 20.630000000000003 95-99 23.385 28.055000000000003 27.965 20.595 100-104 23.735 27.994999999999997 28.025 20.244999999999997 105-109 23.849999999999998 27.88 27.715 20.555 110-114 24.16 27.634999999999998 27.465 20.74 115-119 24.145 27.67 27.855 20.330000000000002 120-124 24.065 27.415 27.994999999999997 20.525 125-129 24.060000000000002 27.725 27.639999999999997 20.575 130-134 24.345 27.465 27.375 20.815 135-139 23.87 27.49 27.91 20.73 140-144 24.240000000000002 27.37 27.66 20.73 145-149 24.335 28.1 27.185 20.380000000000003 150-151 24.349999999999998 27.900000000000002 27.787499999999998 19.9625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.0 23 2.5 24 2.0 25 1.5 26 2.5 27 4.0 28 9.0 29 9.5 30 10.0 31 17.0 32 24.5 33 42.0 34 53.0 35 53.0 36 78.0 37 115.0 38 140.5 39 171.0 40 201.5 41 244.0 42 279.0 43 276.0 44 281.5 45 288.0 46 273.5 47 258.0 48 221.0 49 195.0 50 177.0 51 136.5 52 111.0 53 89.0 54 65.5 55 46.5 56 37.0 57 30.0 58 15.5 59 9.0 60 7.5 61 5.0 62 4.5 63 4.0 64 2.5 65 1.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.20060180541624875 0.4 3 0.05015045135406219 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 1.9625 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.2125000000000004 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.5875 0.0 0.0 0.0 0.0 124-125 2.6624999999999996 0.0 0.0 0.0 0.0 126-127 2.875 0.0 0.0 0.0 0.0 128-129 3.05 0.0 0.0 0.0 0.0 130-131 3.2625 0.0 0.0 0.0 0.0 132-133 3.4625 0.0 0.0 0.0 0.0 134-135 3.65 0.0 0.0 0.0 0.0 136-137 3.8875 0.0 0.0 0.0 0.0 138-139 4.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra Read 659935 spots for SRR7169856.sra Written 659935 spots for SRR7169856.sra Read 659921 spots for SRR7169856.sra Written 659921 spots for SRR7169856.sra SRR ids: ['SRR7169856.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8qmabkox SRR7169856.sra spots: 13198434 blocks: [[1, 659921], [659922, 1319842], [1319843, 1979763], [1979764, 2639684], [2639685, 3299605], [3299606, 3959526], [3959527, 4619447], [4619448, 5279368], [5279369, 5939289], [5939290, 6599210], [6599211, 7259131], [7259132, 7919052], [7919053, 8578973], [8578974, 9238894], [9238895, 9898815], [9898816, 10558736], [10558737, 11218657], [11218658, 11878578], [11878579, 12538499], [12538500, 13198434]] SRR7169856 file size 4450815 SRR7169856 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169856 SRR7169856_1.fastq SRR7169856_2.fastq Input file: SRR7169856_1.fastq Paired file: SRR7169856_2.fastq trimmed: SRR7169856-trimmed-pair1.fastq, SRR7169856-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:16:28 2025 >> started Tue Feb 11 23:16:47 2025 >> done (19.111s) 13198434 read pairs processed; of these: 10754 ( 0.08%) short read pairs filtered out after trimming by size control 14999 ( 0.11%) empty read pairs filtered out after trimming by size control 13172681 (99.80%) read pairs available; of these: 6411595 (48.67%) trimmed read pairs available after processing 6761086 (51.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 2 0.00% 23 5 0.00% 24 4 0.00% 25 7 0.00% 26 4 0.00% 27 3 0.00% 28 7 0.00% 29 5 0.00% 30 12 0.00% 31 3 0.00% 32 5 0.00% 33 5 0.00% 34 11 0.00% 35 9 0.00% 36 16 0.00% 37 19 0.00% 38 24 0.00% 39 22 0.00% 40 24 0.00% 41 32 0.00% 42 29 0.00% 43 26 0.00% 44 38 0.00% 45 33 0.00% 46 65 0.00% 47 62 0.00% 48 76 0.00% 49 78 0.00% 50 95 0.00% 51 112 0.00% 52 107 0.00% 53 142 0.00% 54 166 0.00% 55 179 0.00% 56 190 0.00% 57 220 0.00% 58 253 0.00% 59 329 0.00% 60 335 0.00% 61 423 0.00% 62 441 0.00% 63 540 0.00% 64 623 0.00% 65 608 0.00% 66 745 0.01% 67 801 0.01% 68 867 0.01% 69 998 0.01% 70 1213 0.01% 71 1402 0.01% 72 1606 0.01% 73 1783 0.01% 74 1974 0.01% 75 2151 0.02% 76 2535 0.02% 77 2580 0.02% 78 2623 0.02% 79 2875 0.02% 80 3336 0.03% 81 3479 0.03% 82 4096 0.03% 83 4554 0.03% 84 5379 0.04% 85 6078 0.05% 86 6046 0.05% 87 6392 0.05% 88 6871 0.05% 89 7129 0.05% 90 7577 0.06% 91 7967 0.06% 92 8407 0.06% 93 9026 0.07% 94 9649 0.07% 95 9993 0.08% 96 10236 0.08% 97 10240 0.08% 98 10695 0.08% 99 10842 0.08% 100 11291 0.09% 101 11719 0.09% 102 12198 0.09% 103 12765 0.10% 104 13500 0.10% 105 13807 0.10% 106 14157 0.11% 107 14269 0.11% 108 14382 0.11% 109 14825 0.11% 110 15120 0.11% 111 15710 0.12% 112 16097 0.12% 113 16740 0.13% 114 17360 0.13% 115 17900 0.14% 116 18210 0.14% 117 18376 0.14% 118 19198 0.15% 119 18868 0.14% 120 19486 0.15% 121 20009 0.15% 122 20760 0.16% 123 21486 0.16% 124 22252 0.17% 125 23094 0.18% 126 24164 0.18% 127 25106 0.19% 128 25774 0.20% 129 26887 0.20% 130 27807 0.21% 131 29333 0.22% 132 30624 0.23% 133 32558 0.25% 134 34624 0.26% 135 37059 0.28% 136 40164 0.30% 137 43074 0.33% 138 46771 0.36% 139 50891 0.39% 140 55999 0.43% 141 62698 0.48% 142 72039 0.55% 143 83616 0.63% 144 100642 0.76% 145 126859 0.96% 146 166328 1.26% 147 235906 1.79% 148 374638 2.84% 149 746261 5.67% 150 3300651 25.06% 151 6761086 51.33% 13172681 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=41 prefix-density=0.20 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=277.82 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=19.2 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=43 prefix-density=0.33 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=268.83 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=28.3 sequence=AAGAAGAAGAAA SRR7169856 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:17:30 Started mapping on | Feb 11 23:17:30 Finished on | Feb 11 23:18:34 Mapping speed, Million of reads per hour | 740.96 Number of input reads | 13172681 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12477109 Uniquely mapped reads % | 94.72% Average mapped length | 294.16 Number of splices: Total | 11694204 Number of splices: Annotated (sjdb) | 11509215 Number of splices: GT/AG | 11521278 Number of splices: GC/AG | 140113 Number of splices: AT/AC | 8841 Number of splices: Non-canonical | 23972 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 235145 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 20301 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.31% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 472409 472409 472409 N_multimapping 235145 235145 235145 N_noFeature 278689 12351141 326593 N_ambiguous 133681 889 55005 UnstrandedReadsAssigned:12064739 PositiveStrandReadsAssigned:125079 NegativeStrandReadsAssigned:12095511 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169856 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169856-trimmed-pair1.fastq SRR7169856-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,172,681 reads, 11,988,402 reads pseudoaligned [quant] estimated average fragment length: 287.767 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 992 rounds 52401 SRR7169856.ke.tsv 34699 SRR7169856.se.tsv 87100 total ==> SRR7169856.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1731.23 232 11.0511 Potri.005G024800.1.v4.1 1035 748.233 23 2.53492 Potri.004G059700.1.v4.1 961 674.256 6 0.733837 Potri.007G009000.2.v4.1 1416 1129.23 0 0 Potri.003G141000.2.v4.1 2943 2656.23 233.068 7.23585 Potri.016G087400.1.v4.1 270 80.238 965 991.791 Potri.015G069301.1.v4.1 564 285.747 0 0 Potri.010G195200.1.v4.1 1773 1486.23 22 1.2207 Potri.012G127500.1.v4.1 977 690.239 5760 688.17 ==> SRR7169856.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1174 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 190 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169856 completed mapping pipeline successfully