Starting /dee2/code/volunteer_pipeline.sh SRR7169857 current disk space = 3052373987328 free memory = 1455594188 SRR7169857 SRAfilesize c4b33835adab9d957c14848f11d21180 SRR7169857.sra SRR7169857.sra file validated SRR7169857 is paired end SRR7169857 is conventional basespace SRR7169857 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169857_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.2945 28.0 18.0 33.0 18.0 33.0 2 27.185 29.0 25.0 31.0 18.0 33.0 3 30.52975 31.0 29.0 33.0 27.0 33.0 4 32.1485 33.0 31.0 33.0 30.0 33.0 5 32.71725 33.0 33.0 33.0 31.0 34.0 6 36.98875 38.0 37.0 38.0 35.0 38.0 7 37.42275 38.0 38.0 38.0 36.0 38.0 8 37.69275 38.0 38.0 38.0 38.0 38.0 9 37.692 38.0 38.0 38.0 38.0 38.0 10-14 37.714299999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.705850000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.7056 38.0 38.0 38.0 38.0 38.0 25-29 37.627449999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.6017 38.0 38.0 38.0 37.8 38.0 35-39 37.585449999999994 38.0 38.0 38.0 38.0 38.0 40-44 37.56415 38.0 38.0 38.0 37.8 38.0 45-49 37.501099999999994 38.0 38.0 38.0 37.4 38.0 50-54 37.37065 38.0 38.0 38.0 37.0 38.0 55-59 37.232549999999996 38.0 38.0 38.0 36.4 38.0 60-64 37.0739 38.0 38.0 38.0 36.0 38.0 65-69 36.71125 38.0 37.8 38.0 34.4 38.0 70-74 36.9234 38.0 38.0 38.0 35.6 38.0 75-79 36.921949999999995 38.0 38.0 38.0 35.6 38.0 80-84 36.67215 38.0 37.8 38.0 34.8 38.0 85-89 36.2648 38.0 37.4 38.0 33.2 38.0 90-94 36.34165 38.0 37.6 38.0 33.8 38.0 95-99 36.2972 38.0 37.4 38.0 34.0 38.0 100-104 35.80665 38.0 36.8 38.0 32.0 38.0 105-109 35.449149999999996 38.0 36.2 38.0 30.0 38.0 110-114 35.25485 38.0 36.0 38.0 29.4 38.0 115-119 34.42675 38.0 34.6 38.0 24.6 38.0 120-124 33.74315 37.8 33.0 38.0 22.0 38.0 125-129 32.70845 37.4 31.6 38.0 16.2 38.0 130-134 33.261399999999995 37.6 32.2 38.0 21.0 38.0 135-139 32.7675 37.8 32.2 38.0 16.6 38.0 140-144 32.07155 37.6 31.2 38.0 14.4 38.0 145-149 30.21785 36.0 28.0 38.0 6.2 38.0 150-151 23.561124999999997 30.5 11.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 2.0 14 2.0 15 2.0 16 1.0 17 3.0 18 7.0 19 5.0 20 4.0 21 7.0 22 3.0 23 12.0 24 6.0 25 11.0 26 16.0 27 17.0 28 24.0 29 35.0 30 50.0 31 75.0 32 130.0 33 165.0 34 327.0 35 627.0 36 1337.0 37 1128.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.93845767395127 11.479527756845014 10.34915850288872 33.232856066314994 2 26.474999999999998 11.625 34.050000000000004 27.85 3 20.325 18.45 25.874999999999996 35.35 4 22.650000000000002 25.775 24.725 26.85 5 22.875 30.75 24.275 22.1 6 19.525000000000002 34.975 25.224999999999998 20.275000000000002 7 13.450000000000001 27.275 41.875 17.4 8 17.575 27.250000000000004 31.324999999999996 23.849999999999998 9 17.025000000000002 26.025 33.675 23.275000000000002 10-14 20.155 30.5 27.455000000000002 21.89 15-19 19.59 28.83 28.34 23.24 20-24 20.235 29.299999999999997 27.205000000000002 23.26 25-29 20.06 29.415000000000003 27.639999999999997 22.884999999999998 30-34 20.285 28.804999999999996 27.765 23.145 35-39 20.244999999999997 29.2 27.415 23.14 40-44 20.23 29.044999999999998 27.705000000000002 23.02 45-49 19.605 28.665000000000003 27.79 23.94 50-54 20.69 28.535 27.295 23.48 55-59 20.02 28.884999999999998 27.37 23.724999999999998 60-64 20.355 29.32 27.084999999999997 23.24 65-69 20.285 28.444999999999997 27.689999999999998 23.580000000000002 70-74 20.305 29.01 27.6 23.085 75-79 19.705000000000002 28.92 27.834999999999997 23.54 80-84 20.015 28.205000000000002 27.800000000000004 23.98 85-89 20.630000000000003 28.43 27.08 23.86 90-94 20.62 29.044999999999998 26.66 23.674999999999997 95-99 20.055 29.104999999999997 27.83 23.01 100-104 20.549999999999997 28.199999999999996 27.985 23.265 105-109 19.96 28.29 27.85 23.9 110-114 21.028926033430086 28.48063256931238 28.025222700430387 22.465218696827144 115-119 21.24943685238024 28.332582469840318 27.676828352605497 22.74115232517395 120-124 21.05289496071661 28.62933493469449 27.12305459640695 23.194715508181954 125-129 20.497298379027416 28.286972183309988 27.951771062637583 23.263958375025016 130-134 20.705000000000002 28.435 27.165 23.695 135-139 20.72 28.405 27.089999999999996 23.785 140-144 20.3 28.025 27.715 23.96 145-149 20.595 28.689999999999998 27.395000000000003 23.32 150-151 21.099999999999998 28.8625 27.400000000000002 22.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 1.5 21 2.0 22 0.5 23 1.5 24 2.0 25 1.0 26 4.0 27 9.5 28 11.5 29 15.0 30 21.5 31 27.0 32 34.0 33 46.0 34 57.0 35 61.0 36 81.0 37 108.0 38 122.0 39 153.5 40 194.0 41 208.5 42 236.0 43 266.5 44 273.0 45 286.5 46 280.0 47 264.0 48 248.5 49 219.0 50 180.0 51 144.5 52 116.0 53 83.5 54 62.0 55 45.0 56 28.5 57 22.0 58 19.5 59 13.5 60 8.0 61 6.5 62 5.0 63 4.5 64 4.5 65 3.0 66 4.0 67 3.5 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.09 115-119 0.11499999999999999 120-124 0.08499999999999999 125-129 0.06 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09136799596163 98.15 2 0.88339222614841 1.7500000000000002 3 0.0 0.0 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.1125 0.0 0.0 0.0 0.0 108-109 1.2375 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.55 0.0 0.0 0.0 0.0 114-115 1.7000000000000002 0.0 0.0 0.0 0.0 116-117 1.825 0.0 0.0 0.0 0.0 118-119 1.975 0.0 0.0 0.0 0.0 120-121 2.1500000000000004 0.0 0.0 0.0 0.0 122-123 2.375 0.0 0.0 0.0 0.0 124-125 2.5125 0.0 0.0 0.0 0.0 126-127 2.6375 0.0 0.0 0.0 0.0 128-129 2.8125 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.05 0.0 0.0 0.0 0.0 134-135 3.275 0.0 0.0 0.0 0.0 136-137 3.5375 0.0 0.0 0.0 0.0 138-139 3.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACATGA 10 0.006916044 144.40001 6 >>END_MODULE SRR7169857 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169857_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2825 34.0 33.0 34.0 33.0 34.0 2 33.40925 34.0 33.0 34.0 33.0 34.0 3 33.39225 34.0 33.0 34.0 33.0 34.0 4 33.3815 34.0 33.0 34.0 33.0 34.0 5 33.36775 34.0 33.0 34.0 33.0 34.0 6 37.602 38.0 38.0 38.0 38.0 38.0 7 37.556 38.0 38.0 38.0 38.0 38.0 8 37.509 38.0 38.0 38.0 38.0 38.0 9 37.49625 38.0 38.0 38.0 38.0 38.0 10-14 37.14985 38.0 38.0 38.0 36.6 38.0 15-19 37.4527 38.0 38.0 38.0 37.8 38.0 20-24 37.31205 38.0 38.0 38.0 37.4 38.0 25-29 37.381150000000005 38.0 38.0 38.0 37.6 38.0 30-34 37.41145 38.0 38.0 38.0 38.0 38.0 35-39 37.20715 38.0 38.0 38.0 37.0 38.0 40-44 37.342999999999996 38.0 38.0 38.0 37.4 38.0 45-49 37.381099999999996 38.0 38.0 38.0 37.2 38.0 50-54 37.348200000000006 38.0 38.0 38.0 37.4 38.0 55-59 37.2838 38.0 38.0 38.0 37.0 38.0 60-64 37.2 38.0 38.0 38.0 37.0 38.0 65-69 36.93 38.0 38.0 38.0 35.8 38.0 70-74 37.11835 38.0 38.0 38.0 36.8 38.0 75-79 37.1145 38.0 38.0 38.0 36.6 38.0 80-84 36.890049999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.5571 38.0 38.0 38.0 34.6 38.0 90-94 36.6716 38.0 38.0 38.0 34.8 38.0 95-99 36.56915 38.0 38.0 38.0 34.4 38.0 100-104 35.4679 38.0 36.8 38.0 29.2 38.0 105-109 35.96105 38.0 37.2 38.0 32.2 38.0 110-114 35.7772 38.0 37.2 38.0 31.6 38.0 115-119 34.822849999999995 38.0 35.4 38.0 27.0 38.0 120-124 34.9425 38.0 35.4 38.0 27.8 38.0 125-129 33.914849999999994 38.0 34.2 38.0 22.6 38.0 130-134 33.19045 38.0 32.6 38.0 19.2 38.0 135-139 32.94835 38.0 32.6 38.0 18.6 38.0 140-144 32.5591 37.6 32.0 38.0 18.0 38.0 145-149 30.49975 36.4 29.0 38.0 7.8 38.0 150-151 25.0575 32.0 16.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 3.0 13 1.0 14 3.0 15 1.0 16 3.0 17 3.0 18 5.0 19 6.0 20 7.0 21 5.0 22 7.0 23 8.0 24 13.0 25 11.0 26 17.0 27 25.0 28 28.0 29 33.0 30 43.0 31 58.0 32 81.0 33 133.0 34 249.0 35 426.0 36 1067.0 37 1755.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.475 23.25 14.174999999999999 25.1 2 27.175 27.875 28.175 16.775000000000002 3 21.224999999999998 29.049999999999997 30.375000000000004 19.35 4 23.05 34.5 23.7 18.75 5 23.75 35.5 22.05 18.7 6 21.425 38.125 22.775000000000002 17.675 7 20.075000000000003 23.375 36.9 19.650000000000002 8 22.575 26.125 26.450000000000003 24.85 9 20.8 25.724999999999998 30.25 23.225 10-14 23.74 29.665000000000003 25.495 21.099999999999998 15-19 22.825 28.994999999999997 27.205000000000002 20.974999999999998 20-24 22.825 28.76 27.76 20.655 25-29 23.215 28.48 27.405 20.9 30-34 22.375 28.82 27.505000000000003 21.3 35-39 23.445 28.98 27.16 20.415 40-44 23.36 28.355000000000004 28.125 20.16 45-49 23.35 27.735 28.084999999999997 20.830000000000002 50-54 22.925 28.410000000000004 27.98 20.685000000000002 55-59 23.45 27.87 27.76 20.919999999999998 60-64 23.075000000000003 28.110000000000003 27.775 21.04 65-69 23.455000000000002 28.365000000000002 27.665 20.515 70-74 22.759999999999998 28.235 28.189999999999998 20.815 75-79 23.005 27.644999999999996 28.645 20.705000000000002 80-84 23.385 27.284999999999997 28.694999999999997 20.635 85-89 23.96 27.865000000000002 27.685 20.49 90-94 23.395 27.889999999999997 28.1 20.615 95-99 23.345 28.305000000000003 27.435 20.915 100-104 23.69 28.044999999999998 27.42 20.845 105-109 23.14 27.465 28.299999999999997 21.095 110-114 24.165 28.015 27.22 20.599999999999998 115-119 23.745 28.38 27.575 20.3 120-124 23.880000000000003 27.455000000000002 27.584999999999997 21.08 125-129 24.62738821646494 27.798339501850556 27.383214964489344 20.191057317195156 130-134 23.685000000000002 27.894999999999996 27.750000000000004 20.669999999999998 135-139 24.33 27.794999999999998 27.71 20.165 140-144 24.525 28.095 26.845000000000002 20.535 145-149 24.169999999999998 28.115000000000002 27.189999999999998 20.525 150-151 25.15 27.500000000000004 27.55 19.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 2.0 27 4.0 28 3.0 29 4.5 30 7.5 31 12.5 32 20.0 33 29.0 34 39.0 35 59.5 36 84.0 37 101.0 38 135.0 39 180.0 40 202.5 41 235.5 42 268.0 43 277.0 44 300.0 45 316.0 46 298.5 47 284.0 48 260.5 49 207.0 50 163.0 51 117.5 52 87.5 53 80.0 54 65.5 55 49.0 56 37.0 57 24.5 58 14.0 59 9.0 60 4.5 61 3.5 62 3.5 63 2.0 64 1.0 65 1.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.03 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01440485216074 97.95 2 0.960323477381855 1.9 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025271670457417232 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 6 0.15 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8500000000000001 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.3624999999999998 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.8 0.0 0.0 0.0 0.0 118-119 1.9500000000000002 0.0 0.0 0.0 0.0 120-121 2.125 0.0 0.0 0.0 0.0 122-123 2.35 0.0 0.0 0.0 0.0 124-125 2.4875 0.0 0.0 0.0 0.0 126-127 2.625 0.0 0.0 0.0 0.0 128-129 2.7625 0.0 0.0 0.0 0.0 130-131 2.9000000000000004 0.0 0.0 0.0 0.0 132-133 3.0250000000000004 0.0 0.0 0.0 0.0 134-135 3.25 0.0 0.0 0.0 0.0 136-137 3.5125 0.0 0.0 0.0 0.0 138-139 3.7249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTATGC 10 0.006843168 144.91249 145 ACTTCAC 10 0.006843168 144.91249 5 >>END_MODULE Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571197 spots for SRR7169857.sra Written 571197 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra Read 571186 spots for SRR7169857.sra Written 571186 spots for SRR7169857.sra SRR ids: ['SRR7169857.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nptuipnb SRR7169857.sra spots: 11423731 blocks: [[1, 571186], [571187, 1142372], [1142373, 1713558], [1713559, 2284744], [2284745, 2855930], [2855931, 3427116], [3427117, 3998302], [3998303, 4569488], [4569489, 5140674], [5140675, 5711860], [5711861, 6283046], [6283047, 6854232], [6854233, 7425418], [7425419, 7996604], [7996605, 8567790], [8567791, 9138976], [9138977, 9710162], [9710163, 10281348], [10281349, 10852534], [10852535, 11423731]] SRR7169857 file size 3849427 SRR7169857 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169857 SRR7169857_1.fastq SRR7169857_2.fastq Input file: SRR7169857_1.fastq Paired file: SRR7169857_2.fastq trimmed: SRR7169857-trimmed-pair1.fastq, SRR7169857-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:05:45 2025 >> started Tue Feb 11 23:05:58 2025 >> done (12.792s) 11423731 read pairs processed; of these: 8160 ( 0.07%) short read pairs filtered out after trimming by size control 14179 ( 0.12%) empty read pairs filtered out after trimming by size control 11401392 (99.80%) read pairs available; of these: 5669881 (49.73%) trimmed read pairs available after processing 5731511 (50.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 3 0.00% 21 2 0.00% 22 5 0.00% 23 5 0.00% 24 2 0.00% 25 3 0.00% 26 2 0.00% 27 4 0.00% 28 4 0.00% 29 6 0.00% 30 2 0.00% 31 2 0.00% 32 5 0.00% 33 2 0.00% 34 8 0.00% 35 7 0.00% 36 8 0.00% 37 7 0.00% 38 12 0.00% 39 13 0.00% 40 19 0.00% 41 10 0.00% 42 18 0.00% 43 20 0.00% 44 25 0.00% 45 29 0.00% 46 31 0.00% 47 31 0.00% 48 42 0.00% 49 43 0.00% 50 46 0.00% 51 55 0.00% 52 62 0.00% 53 67 0.00% 54 79 0.00% 55 96 0.00% 56 101 0.00% 57 112 0.00% 58 122 0.00% 59 155 0.00% 60 179 0.00% 61 207 0.00% 62 270 0.00% 63 286 0.00% 64 317 0.00% 65 336 0.00% 66 372 0.00% 67 403 0.00% 68 438 0.00% 69 508 0.00% 70 609 0.01% 71 731 0.01% 72 854 0.01% 73 929 0.01% 74 1005 0.01% 75 1180 0.01% 76 1237 0.01% 77 1484 0.01% 78 1555 0.01% 79 1776 0.02% 80 1852 0.02% 81 2142 0.02% 82 2389 0.02% 83 2678 0.02% 84 3297 0.03% 85 3799 0.03% 86 4143 0.04% 87 4327 0.04% 88 4537 0.04% 89 4710 0.04% 90 5136 0.05% 91 5371 0.05% 92 5927 0.05% 93 6256 0.05% 94 6488 0.06% 95 6912 0.06% 96 7322 0.06% 97 7530 0.07% 98 7746 0.07% 99 7855 0.07% 100 8699 0.08% 101 8575 0.08% 102 9314 0.08% 103 9643 0.08% 104 10186 0.09% 105 10702 0.09% 106 11023 0.10% 107 11300 0.10% 108 11691 0.10% 109 12140 0.11% 110 12082 0.11% 111 12612 0.11% 112 13190 0.12% 113 13733 0.12% 114 14249 0.12% 115 15136 0.13% 116 15452 0.14% 117 15920 0.14% 118 16108 0.14% 119 16260 0.14% 120 17040 0.15% 121 17021 0.15% 122 17796 0.16% 123 18395 0.16% 124 19259 0.17% 125 20419 0.18% 126 20984 0.18% 127 22136 0.19% 128 23053 0.20% 129 24329 0.21% 130 24988 0.22% 131 25916 0.23% 132 27496 0.24% 133 29517 0.26% 134 31932 0.28% 135 34058 0.30% 136 36973 0.32% 137 39706 0.35% 138 43751 0.38% 139 47129 0.41% 140 52014 0.46% 141 57995 0.51% 142 65927 0.58% 143 75575 0.66% 144 90352 0.79% 145 112505 0.99% 146 144300 1.27% 147 203328 1.78% 148 322822 2.83% 149 656577 5.76% 150 2982213 26.16% 151 5731511 50.27% 11401392 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=28 prefix-density=0.27 prefix-fanout=2.5 sequence=AAAGAAGTCAAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=217.36 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=38 prefix-density=0.22 prefix-fanout=2.2 sequence=ATTGAATGGCCAGTTCAGATGGATTTCTTCTCAGATGAACCGCGTGAGGAATGGAGAGCTCTACCGTTACATTTGTGATACCAAGGGAGCTTTCGTGCAGCCTGCTTTGTATGAGGCTTTTGGATTGACTGTTGTTGAGGCCATGACATGTGGTTTGCCAACCTTTGCTACTTGCAATGGTGGTCCTGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCACGGAGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=29 fanout-score=48.49 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=11.0 sequence=TCAAGGAAGCTTTCAG SRR7169857 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:06:42 Started mapping on | Feb 11 23:06:42 Finished on | Feb 11 23:07:54 Mapping speed, Million of reads per hour | 570.07 Number of input reads | 11401392 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 10738966 Uniquely mapped reads % | 94.19% Average mapped length | 294.80 Number of splices: Total | 10319943 Number of splices: Annotated (sjdb) | 10159062 Number of splices: GT/AG | 10180881 Number of splices: GC/AG | 112808 Number of splices: AT/AC | 7588 Number of splices: Non-canonical | 18666 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 179182 % of reads mapped to multiple loci | 1.57% Number of reads mapped to too many loci | 30759 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.91% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 492672 492672 492672 N_multimapping 179182 179182 179182 N_noFeature 185439 10609862 229022 N_ambiguous 127619 611 41728 UnstrandedReadsAssigned:10425908 PositiveStrandReadsAssigned:128493 NegativeStrandReadsAssigned:10468216 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169857 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169857-trimmed-pair1.fastq SRR7169857-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,401,392 reads, 10,386,061 reads pseudoaligned [quant] estimated average fragment length: 276.285 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 979 rounds 52401 SRR7169857.ke.tsv 34699 SRR7169857.se.tsv 87100 total ==> SRR7169857.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.72 206 11.1939 Potri.005G024800.1.v4.1 1035 759.715 35 4.36271 Potri.004G059700.1.v4.1 961 685.772 4 0.552356 Potri.007G009000.2.v4.1 1416 1140.72 0 0 Potri.003G141000.2.v4.1 2943 2667.72 225 7.98696 Potri.016G087400.1.v4.1 270 75.7575 1109 1386.26 Potri.015G069301.1.v4.1 564 295.136 0 0 Potri.010G195200.1.v4.1 1773 1497.72 18 1.1381 Potri.012G127500.1.v4.1 977 701.744 2803 378.254 ==> SRR7169857.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 992 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 170 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169857 completed mapping pipeline successfully