Starting /dee2/code/volunteer_pipeline.sh SRR7169858 current disk space = 3051863040000 free memory = 1579058976 SRR7169858 SRAfilesize c49f4f40535328d046fca13849c3dd56 SRR7169858.sra SRR7169858.sra file validated SRR7169858 is paired end SRR7169858 is conventional basespace SRR7169858 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169858_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.434 30.0 18.0 33.0 18.0 33.0 2 23.78325 25.0 18.0 29.0 18.0 33.0 3 28.23325 29.0 27.0 31.0 18.0 33.0 4 31.2995 31.0 31.0 33.0 29.0 33.0 5 32.3555 33.0 32.0 33.0 32.0 33.0 6 36.50625 38.0 36.0 38.0 34.0 38.0 7 35.79825 38.0 36.0 38.0 31.0 38.0 8 37.1265 38.0 38.0 38.0 36.0 38.0 9 37.4785 38.0 38.0 38.0 37.0 38.0 10-14 37.5818 38.0 38.0 38.0 37.6 38.0 15-19 37.6369 38.0 38.0 38.0 38.0 38.0 20-24 37.65215 38.0 38.0 38.0 38.0 38.0 25-29 37.6157 38.0 38.0 38.0 38.0 38.0 30-34 37.5212 38.0 38.0 38.0 38.0 38.0 35-39 37.49485 38.0 38.0 38.0 37.4 38.0 40-44 37.41100000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.452 38.0 38.0 38.0 37.2 38.0 50-54 37.18805 38.0 38.0 38.0 36.4 38.0 55-59 37.04005 38.0 38.0 38.0 35.8 38.0 60-64 37.103 38.0 38.0 38.0 36.0 38.0 65-69 36.789 38.0 38.0 38.0 35.0 38.0 70-74 37.0059 38.0 38.0 38.0 35.6 38.0 75-79 37.062200000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.915499999999994 38.0 38.0 38.0 35.6 38.0 85-89 36.80715 38.0 38.0 38.0 34.8 38.0 90-94 35.563300000000005 38.0 36.6 38.0 29.6 38.0 95-99 36.2809 38.0 37.0 38.0 33.4 38.0 100-104 35.464150000000004 38.0 36.4 38.0 29.4 38.0 105-109 35.7244 38.0 36.8 38.0 29.6 38.0 110-114 34.7245 38.0 35.2 38.0 24.2 38.0 115-119 35.023300000000006 38.0 35.2 38.0 26.2 38.0 120-124 34.3423 38.0 34.0 38.0 24.2 38.0 125-129 34.70205 38.0 35.2 38.0 25.2 38.0 130-134 35.021300000000004 38.0 35.2 38.0 28.2 38.0 135-139 34.3669 38.0 34.8 38.0 24.6 38.0 140-144 33.5591 37.6 33.6 38.0 22.0 38.0 145-149 33.110850000000006 37.8 33.8 38.0 19.8 38.0 150-151 30.2075 36.5 28.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 2.0 14 1.0 15 1.0 16 2.0 17 2.0 18 0.0 19 2.0 20 3.0 21 6.0 22 10.0 23 7.0 24 9.0 25 13.0 26 14.0 27 10.0 28 18.0 29 29.0 30 36.0 31 53.0 32 95.0 33 125.0 34 262.0 35 498.0 36 1386.0 37 1412.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.349999999999994 13.100000000000001 10.100000000000001 29.45 2 24.7623811905953 14.507253626813407 32.61630815407704 28.114057028514257 3 19.625 23.375 27.150000000000002 29.849999999999998 4 22.1 28.675 25.324999999999996 23.9 5 22.725 32.7 23.75 20.825 6 20.474999999999998 35.975 24.875 18.675 7 14.524999999999999 26.224999999999998 42.5 16.75 8 18.075 25.7 30.225 26.0 9 17.375 25.85 34.1 22.675 10-14 20.555 29.975 26.855 22.615 15-19 20.055 29.709999999999997 27.29 22.945 20-24 20.055 29.64 27.185 23.119999999999997 25-29 20.285 29.544999999999998 27.515 22.655 30-34 20.285 29.425 27.339999999999996 22.95 35-39 20.125 29.385 27.189999999999998 23.3 40-44 20.515 29.244999999999997 27.57 22.67 45-49 20.244999999999997 28.96 28.025 22.770000000000003 50-54 20.485 29.115000000000002 27.529999999999998 22.869999999999997 55-59 20.474999999999998 29.24 26.405 23.880000000000003 60-64 20.105 29.459999999999997 26.705000000000002 23.73 65-69 19.939999999999998 29.604999999999997 27.27 23.185 70-74 20.57 29.67 26.735 23.025000000000002 75-79 20.45 29.21 27.6 22.74 80-84 20.39 28.78 27.425 23.405 85-89 20.445 28.78 27.384999999999998 23.39 90-94 20.015 29.005 27.095000000000002 23.885 95-99 20.51 28.689999999999998 27.48 23.32 100-104 20.82 28.935 26.66 23.585 105-109 20.615 28.68 27.445000000000004 23.26 110-114 21.135 28.754999999999995 26.669999999999998 23.44 115-119 21.2012012012012 28.243243243243242 27.72272272272272 22.832832832832832 120-124 21.200600300150075 28.799399699849925 27.333666833416707 22.666333166583293 125-129 20.665 28.299999999999997 27.325 23.71 130-134 21.02 27.955000000000002 27.800000000000004 23.225 135-139 20.49 28.165000000000003 27.765 23.580000000000002 140-144 20.347121492522383 28.03481218426449 27.75471414995248 23.86335217326064 145-149 20.880000000000003 27.655 27.534999999999997 23.93 150-151 21.5625 27.8375 27.8875 22.7125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 1.0 3 1.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.5 23 2.0 24 3.0 25 3.5 26 6.0 27 7.5 28 11.0 29 18.0 30 20.5 31 34.0 32 50.0 33 52.5 34 59.0 35 76.5 36 90.0 37 111.0 38 142.5 39 175.5 40 196.0 41 190.5 42 210.0 43 238.5 44 257.0 45 278.0 46 272.5 47 255.5 48 239.5 49 211.5 50 172.5 51 137.0 52 121.0 53 103.0 54 68.0 55 43.0 56 34.0 57 24.5 58 16.0 59 13.5 60 10.0 61 6.5 62 5.0 63 4.5 64 6.0 65 5.0 66 4.0 67 3.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.1 120-124 0.05 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.034999999999999996 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.7875000000000001 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 0.9875 0.0 0.0 0.0 0.0 112-113 1.0750000000000002 0.0 0.0 0.0 0.0 114-115 1.2000000000000002 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.5125000000000002 0.0 0.0 0.0 0.0 120-121 1.675 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 2.0 0.0 0.0 0.0 0.0 126-127 2.0875 0.0 0.0 0.0 0.0 128-129 2.3 0.0 0.0 0.0 0.0 130-131 2.5125 0.0 0.0 0.0 0.0 132-133 2.725 0.0 0.0 0.0 0.0 134-135 2.7875 0.0 0.0 0.0 0.0 136-137 2.925 0.0 0.0 0.0 0.0 138-139 3.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAACT 10 0.006846698 144.88751 2 GCCCGGG 10 0.006846698 144.88751 1 >>END_MODULE SRR7169858 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169858_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1165 34.0 33.0 34.0 33.0 34.0 2 33.22825 34.0 33.0 34.0 33.0 34.0 3 33.2515 34.0 33.0 34.0 33.0 34.0 4 33.1975 34.0 33.0 34.0 33.0 34.0 5 33.21075 34.0 33.0 34.0 33.0 34.0 6 37.3405 38.0 38.0 38.0 38.0 38.0 7 37.352 38.0 38.0 38.0 38.0 38.0 8 37.4235 38.0 38.0 38.0 38.0 38.0 9 37.37175 38.0 38.0 38.0 38.0 38.0 10-14 37.30245 38.0 38.0 38.0 37.4 38.0 15-19 37.2612 38.0 38.0 38.0 37.6 38.0 20-24 36.96275 38.0 38.0 38.0 35.4 38.0 25-29 35.92845 38.0 37.4 38.0 31.2 38.0 30-34 37.10295 38.0 38.0 38.0 36.4 38.0 35-39 37.2258 38.0 38.0 38.0 37.0 38.0 40-44 37.072199999999995 38.0 38.0 38.0 36.8 38.0 45-49 37.173649999999995 38.0 38.0 38.0 37.0 38.0 50-54 36.87545 38.0 38.0 38.0 35.8 38.0 55-59 37.1034 38.0 38.0 38.0 36.8 38.0 60-64 36.973650000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.9696 38.0 38.0 38.0 36.0 38.0 70-74 37.0629 38.0 38.0 38.0 36.2 38.0 75-79 36.9984 38.0 38.0 38.0 36.0 38.0 80-84 36.90335 38.0 38.0 38.0 36.0 38.0 85-89 36.59075 38.0 38.0 38.0 35.0 38.0 90-94 36.7549 38.0 38.0 38.0 36.0 38.0 95-99 36.6611 38.0 38.0 38.0 35.4 38.0 100-104 36.53475 38.0 38.0 38.0 34.8 38.0 105-109 36.42075 38.0 38.0 38.0 34.0 38.0 110-114 36.364700000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.167950000000005 38.0 38.0 38.0 34.0 38.0 120-124 35.93405 38.0 37.2 38.0 33.0 38.0 125-129 35.7536 38.0 37.0 38.0 33.0 38.0 130-134 35.484449999999995 38.0 36.2 38.0 31.4 38.0 135-139 34.690250000000006 38.0 35.6 38.0 26.2 38.0 140-144 34.587650000000004 38.0 35.2 38.0 26.6 38.0 145-149 34.03415 38.0 35.0 38.0 24.4 38.0 150-151 30.395625000000003 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 0.0 5 0.0 6 3.0 7 0.0 8 1.0 9 2.0 10 0.0 11 0.0 12 2.0 13 2.0 14 2.0 15 7.0 16 0.0 17 4.0 18 4.0 19 6.0 20 2.0 21 4.0 22 4.0 23 9.0 24 6.0 25 7.0 26 19.0 27 15.0 28 22.0 29 16.0 30 32.0 31 51.0 32 72.0 33 94.0 34 131.0 35 228.0 36 638.0 37 2607.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.050000000000004 22.525000000000002 15.25 22.175 2 26.275 27.1 28.15 18.475 3 20.974999999999998 29.4 30.775000000000002 18.85 4 23.35 32.800000000000004 23.599999999999998 20.25 5 25.224999999999998 35.85 21.375 17.549999999999997 6 21.8 36.1 23.325000000000003 18.775 7 20.75 21.725 36.9 20.625 8 23.45 24.2 26.775 25.575 9 21.85 27.150000000000002 28.125 22.875 10-14 22.875 28.9 26.58 21.645 15-19 23.395 27.395000000000003 27.98 21.23 20-24 23.0 28.349999999999998 27.900000000000002 20.75 25-29 23.035 28.32 27.439999999999998 21.205 30-34 23.05 27.61 28.384999999999998 20.955 35-39 23.26 27.615000000000002 27.794999999999998 21.33 40-44 22.755 28.895 27.47 20.880000000000003 45-49 23.51 27.834999999999997 28.01 20.645 50-54 23.01 27.48 28.64 20.87 55-59 23.575 27.515 27.43 21.48 60-64 23.395 27.875 27.935 20.794999999999998 65-69 23.435 27.505000000000003 27.994999999999997 21.065 70-74 23.855 27.62 27.865000000000002 20.66 75-79 22.884999999999998 27.85 28.43 20.835 80-84 23.025000000000002 27.85 27.884999999999998 21.240000000000002 85-89 23.57 28.13 27.565 20.735 90-94 23.18 28.585 27.779999999999998 20.455000000000002 95-99 23.395 27.860000000000003 27.51 21.235 100-104 23.185 28.205000000000002 27.735 20.875 105-109 23.275000000000002 27.715 28.185 20.825 110-114 23.44 27.794999999999998 27.765 21.0 115-119 24.01 27.195000000000004 27.705000000000002 21.09 120-124 23.655 27.625 27.634999999999998 21.085 125-129 24.03 27.950000000000003 27.200000000000003 20.82 130-134 23.895 27.32 28.29 20.495 135-139 24.234540724434662 27.676605963578147 27.391434860916554 20.697418451070643 140-144 23.885 28.205000000000002 27.195000000000004 20.715 145-149 24.12 27.465 27.675 20.74 150-151 24.224999999999998 28.000000000000004 27.224999999999998 20.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.0 25 2.5 26 2.5 27 4.0 28 5.0 29 5.5 30 9.0 31 13.0 32 21.0 33 27.0 34 31.0 35 43.5 36 74.5 37 117.0 38 138.0 39 148.5 40 193.5 41 230.5 42 261.5 43 283.0 44 291.0 45 301.5 46 281.5 47 265.0 48 252.5 49 217.0 50 190.0 51 153.5 52 107.5 53 93.0 54 74.0 55 44.5 56 29.5 57 22.0 58 18.5 59 13.0 60 8.0 61 8.5 62 5.0 63 2.0 64 1.0 65 1.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.06 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1625 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.9125 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.6625 0.0 0.0 0.0 0.0 120-121 1.825 0.0 0.0 0.0 0.0 122-123 1.975 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.2249999999999996 0.0 0.0 0.0 0.0 128-129 2.4875 0.0 0.0 0.0 0.0 130-131 2.7125 0.0 0.0 0.0 0.0 132-133 2.9625 0.0 0.0 0.0 0.0 134-135 3.0375 0.0 0.0 0.0 0.0 136-137 3.175 0.0 0.0 0.0 0.0 138-139 3.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATTAC 10 0.006843168 144.91249 3 GGATCAC 10 0.006843168 144.91249 1 >>END_MODULE Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537076 spots for SRR7169858.sra Written 537076 spots for SRR7169858.sra Read 537090 spots for SRR7169858.sra Written 537090 spots for SRR7169858.sra SRR ids: ['SRR7169858.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x678pib2 SRR7169858.sra spots: 10741534 blocks: [[1, 537076], [537077, 1074152], [1074153, 1611228], [1611229, 2148304], [2148305, 2685380], [2685381, 3222456], [3222457, 3759532], [3759533, 4296608], [4296609, 4833684], [4833685, 5370760], [5370761, 5907836], [5907837, 6444912], [6444913, 6981988], [6981989, 7519064], [7519065, 8056140], [8056141, 8593216], [8593217, 9130292], [9130293, 9667368], [9667369, 10204444], [10204445, 10741534]] SRR7169858 file size 3618253 SRR7169858 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169858 SRR7169858_1.fastq SRR7169858_2.fastq Input file: SRR7169858_1.fastq Paired file: SRR7169858_2.fastq trimmed: SRR7169858-trimmed-pair1.fastq, SRR7169858-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:59:15 2025 >> started Tue Feb 11 23:59:27 2025 >> done (12.282s) 10741534 read pairs processed; of these: 15093 ( 0.14%) short read pairs filtered out after trimming by size control 12615 ( 0.12%) empty read pairs filtered out after trimming by size control 10713826 (99.74%) read pairs available; of these: 4648444 (43.39%) trimmed read pairs available after processing 6065382 (56.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 2 0.00% 22 4 0.00% 23 0 0.00% 24 3 0.00% 25 2 0.00% 26 6 0.00% 27 2 0.00% 28 6 0.00% 29 1 0.00% 30 7 0.00% 31 7 0.00% 32 7 0.00% 33 5 0.00% 34 1 0.00% 35 2 0.00% 36 6 0.00% 37 10 0.00% 38 6 0.00% 39 9 0.00% 40 8 0.00% 41 10 0.00% 42 14 0.00% 43 15 0.00% 44 12 0.00% 45 33 0.00% 46 15 0.00% 47 24 0.00% 48 29 0.00% 49 22 0.00% 50 32 0.00% 51 39 0.00% 52 49 0.00% 53 52 0.00% 54 61 0.00% 55 56 0.00% 56 69 0.00% 57 94 0.00% 58 106 0.00% 59 101 0.00% 60 147 0.00% 61 144 0.00% 62 158 0.00% 63 187 0.00% 64 211 0.00% 65 244 0.00% 66 249 0.00% 67 287 0.00% 68 323 0.00% 69 374 0.00% 70 414 0.00% 71 500 0.00% 72 579 0.01% 73 624 0.01% 74 733 0.01% 75 766 0.01% 76 841 0.01% 77 974 0.01% 78 1065 0.01% 79 1179 0.01% 80 1332 0.01% 81 1448 0.01% 82 1696 0.02% 83 1955 0.02% 84 2728 0.03% 85 3297 0.03% 86 3444 0.03% 87 3776 0.04% 88 3867 0.04% 89 3951 0.04% 90 4292 0.04% 91 4367 0.04% 92 4694 0.04% 93 4896 0.05% 94 5306 0.05% 95 5461 0.05% 96 5332 0.05% 97 5755 0.05% 98 5985 0.06% 99 6044 0.06% 100 6455 0.06% 101 6759 0.06% 102 7166 0.07% 103 7454 0.07% 104 7979 0.07% 105 8240 0.08% 106 8573 0.08% 107 8644 0.08% 108 9007 0.08% 109 9004 0.08% 110 9277 0.09% 111 9967 0.09% 112 10280 0.10% 113 11037 0.10% 114 11538 0.11% 115 12044 0.11% 116 12399 0.12% 117 12532 0.12% 118 12993 0.12% 119 12863 0.12% 120 13770 0.13% 121 13647 0.13% 122 14527 0.14% 123 15045 0.14% 124 16474 0.15% 125 16909 0.16% 126 17783 0.17% 127 18344 0.17% 128 18949 0.18% 129 20037 0.19% 130 20625 0.19% 131 22135 0.21% 132 23206 0.22% 133 24838 0.23% 134 26646 0.25% 135 28333 0.26% 136 30095 0.28% 137 32424 0.30% 138 34778 0.32% 139 37444 0.35% 140 40925 0.38% 141 45431 0.42% 142 51413 0.48% 143 60157 0.56% 144 71732 0.67% 145 89147 0.83% 146 115452 1.08% 147 160519 1.50% 148 248364 2.32% 149 506742 4.73% 150 2527789 23.59% 151 6065382 56.61% 10713826 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=41 prefix-density=0.23 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=234.62 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=16.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=6.04 fanout-score-rank=24 prefix-density=0.33 prefix-fanout=4.2 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=45 fanout-score=53.17 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=7.7 sequence=CTCTTCTTTTCTCCCGGAAAATGGCCGGTTTAATTTCAAGATCAGTTCCTTGTGCAATCCTAGTAGTCTTGTGCACGGTGGTGCCCATTTTGGCTAAAGATCACACTGTAGGAGATAGTTCAGGCTGGGCAATTGGTATGGATTATAGCACCTGGACTAGTGGCAAGACCTTTTCAGTTGGCGACAGCCTTGTGTTTAACTACGGAGGAGGCCACACGGTGGATGAAGTGAGAGCCAGTGACTACAGCACATGCACTACAGGCAATGCAATCACTTCAGATAGCAGTGGTGCTACCACAATAGCCCTCAAGACTGCCGGAACTCATTATTTCATTTGTGGTGTTCCTGGCCACTGTGGGAGTGGCATGAAGGTTGCAGTCACTGTTGCAGCAGCAGGATCGAGCACAAGTCCCTCCTCCGGAACTCCATCTTCTGAT SRR7169858 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:00:10 Started mapping on | Feb 12 00:00:11 Finished on | Feb 12 00:01:14 Mapping speed, Million of reads per hour | 612.22 Number of input reads | 10713826 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 9992112 Uniquely mapped reads % | 93.26% Average mapped length | 295.58 Number of splices: Total | 9389414 Number of splices: Annotated (sjdb) | 9239780 Number of splices: GT/AG | 9255631 Number of splices: GC/AG | 107543 Number of splices: AT/AC | 6889 Number of splices: Non-canonical | 19351 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 184454 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 9129 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.90% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 553093 553093 553093 N_multimapping 184454 184454 184454 N_noFeature 192488 9877495 228386 N_ambiguous 120295 724 41091 UnstrandedReadsAssigned:9679329 PositiveStrandReadsAssigned:113893 NegativeStrandReadsAssigned:9722635 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169858 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169858-trimmed-pair1.fastq SRR7169858-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,713,826 reads, 9,646,078 reads pseudoaligned [quant] estimated average fragment length: 289.158 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 SRR7169858.ke.tsv 34699 SRR7169858.se.tsv 87100 total ==> SRR7169858.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1729.84 219 12.16 Potri.005G024800.1.v4.1 1035 746.842 25 3.21519 Potri.004G059700.1.v4.1 961 672.909 0 0 Potri.007G009000.2.v4.1 1416 1127.84 0 0 Potri.003G141000.2.v4.1 2943 2654.84 190.076 6.87675 Potri.016G087400.1.v4.1 270 71.6536 1247 1671.57 Potri.015G069301.1.v4.1 564 283.779 0 0 Potri.010G195200.1.v4.1 1773 1484.84 22 1.42311 Potri.012G127500.1.v4.1 977 688.885 3052 425.533 ==> SRR7169858.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 848 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 217 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169858 completed mapping pipeline successfully