Starting /dee2/code/volunteer_pipeline.sh SRR7169859 current disk space = 3052193865728 free memory = 1498244016 SRR7169859 SRAfilesize 1985ffd0995c8680b20786e86c5da133 SRR7169859.sra SRR7169859.sra file validated SRR7169859 is paired end SRR7169859 is conventional basespace SRR7169859 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169859_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.9845 30.0 18.0 33.0 18.0 33.0 2 29.87725 31.0 29.0 33.0 25.0 33.0 3 32.10175 33.0 31.0 33.0 30.0 33.0 4 32.79725 33.0 33.0 33.0 31.0 34.0 5 32.7515 33.0 33.0 34.0 32.0 34.0 6 37.0755 38.0 37.0 38.0 36.0 38.0 7 37.58475 38.0 38.0 38.0 37.0 38.0 8 37.63425 38.0 38.0 38.0 38.0 38.0 9 37.727 38.0 38.0 38.0 38.0 38.0 10-14 37.7427 38.0 38.0 38.0 38.0 38.0 15-19 37.6939 38.0 38.0 38.0 38.0 38.0 20-24 37.57195 38.0 38.0 38.0 37.8 38.0 25-29 37.6338 38.0 38.0 38.0 38.0 38.0 30-34 37.6278 38.0 38.0 38.0 38.0 38.0 35-39 37.53825 38.0 38.0 38.0 37.8 38.0 40-44 37.5731 38.0 38.0 38.0 38.0 38.0 45-49 37.522149999999996 38.0 38.0 38.0 37.8 38.0 50-54 37.51345 38.0 38.0 38.0 37.2 38.0 55-59 37.41335 38.0 38.0 38.0 37.0 38.0 60-64 37.34725 38.0 38.0 38.0 37.0 38.0 65-69 37.27225 38.0 38.0 38.0 36.4 38.0 70-74 37.24815 38.0 38.0 38.0 36.4 38.0 75-79 37.171800000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.84245 38.0 38.0 38.0 35.4 38.0 85-89 36.7932 38.0 38.0 38.0 34.8 38.0 90-94 36.317600000000006 38.0 37.4 38.0 33.2 38.0 95-99 36.71955 38.0 38.0 38.0 35.2 38.0 100-104 36.4798 38.0 37.6 38.0 34.2 38.0 105-109 36.04254999999999 38.0 37.2 38.0 30.4 38.0 110-114 35.624700000000004 38.0 36.4 38.0 30.8 38.0 115-119 35.238 38.0 36.0 38.0 27.8 38.0 120-124 35.86135 38.0 36.6 38.0 32.6 38.0 125-129 34.83505 38.0 35.0 38.0 26.6 38.0 130-134 35.21515 38.0 35.8 38.0 30.0 38.0 135-139 35.28515 38.0 35.8 38.0 29.8 38.0 140-144 34.42595 38.0 35.0 38.0 26.8 38.0 145-149 32.05325 37.0 32.2 38.0 18.0 38.0 150-151 28.5275 35.5 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 3.0 16 2.0 17 2.0 18 3.0 19 4.0 20 4.0 21 3.0 22 2.0 23 2.0 24 3.0 25 3.0 26 13.0 27 12.0 28 14.0 29 27.0 30 40.0 31 42.0 32 69.0 33 97.0 34 169.0 35 416.0 36 1088.0 37 1979.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.65 11.700000000000001 9.575 33.074999999999996 2 22.759138708062093 15.022533800701051 32.34852278417627 29.86980470706059 3 19.125 20.150000000000002 26.674999999999997 34.050000000000004 4 21.725 28.225 22.825 27.224999999999998 5 22.900000000000002 29.4 24.95 22.75 6 19.625 35.75 24.825 19.8 7 15.8 27.900000000000002 38.7 17.599999999999998 8 17.325 27.200000000000003 29.825000000000003 25.650000000000002 9 16.400000000000002 26.224999999999998 32.975 24.4 10-14 19.73 30.325000000000003 26.919999999999998 23.025000000000002 15-19 19.975 28.854999999999997 27.605 23.565 20-24 20.13 28.87 27.515 23.485 25-29 20.31 29.104999999999997 26.86 23.724999999999998 30-34 19.97 29.65 27.205000000000002 23.175 35-39 19.845 29.304999999999996 27.045 23.805 40-44 20.125 28.64 27.224999999999998 24.01 45-49 20.119999999999997 28.825 27.675 23.380000000000003 50-54 20.255000000000003 28.205000000000002 27.185 24.355 55-59 20.1 29.09 27.12 23.69 60-64 20.044999999999998 28.84 27.24 23.875 65-69 20.035 29.01 27.625 23.330000000000002 70-74 19.955000000000002 28.715000000000003 27.845 23.485 75-79 20.59 29.409999999999997 26.715 23.285 80-84 19.93 29.025000000000002 27.145000000000003 23.9 85-89 20.3 28.875 27.060000000000002 23.765 90-94 20.23 28.455000000000002 27.005000000000003 24.310000000000002 95-99 20.665 28.105000000000004 27.08 24.15 100-104 20.815 28.705000000000002 27.13 23.35 105-109 20.315 28.470000000000002 27.155 24.060000000000002 110-114 20.65 28.455000000000002 27.439999999999998 23.455000000000002 115-119 20.72468845403133 28.437015164406187 26.940593563885688 23.897702817676794 120-124 20.82 28.754999999999995 26.605 23.82 125-129 20.695 28.455000000000002 27.37 23.48 130-134 20.84 27.965 27.54 23.655 135-139 20.925 28.389999999999997 26.855 23.830000000000002 140-144 20.75 28.325 26.99 23.935000000000002 145-149 21.08 27.765 27.165 23.990000000000002 150-151 20.5 27.925 27.437499999999996 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 3.5 23 3.5 24 2.5 25 2.0 26 2.5 27 5.0 28 10.0 29 12.5 30 20.5 31 29.5 32 32.5 33 34.5 34 53.0 35 78.5 36 85.5 37 98.5 38 122.0 39 140.0 40 181.0 41 223.0 42 234.0 43 243.0 44 261.0 45 283.5 46 282.0 47 272.5 48 248.5 49 209.0 50 171.0 51 145.0 52 120.0 53 90.0 54 75.0 55 55.5 56 39.0 57 31.0 58 21.5 59 18.5 60 14.0 61 13.0 62 13.5 63 5.5 64 3.0 65 3.0 66 2.0 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.095 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64824120603015 99.15 2 0.3015075376884422 0.6 3 0.0 0.0 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.02512562814070352 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 6 0.15 TruSeq Adapter, Index 8 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.125 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 1.8875 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.5375 0.0 0.0 0.0 0.0 118-119 2.825 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.1500000000000004 0.0 0.0 0.0 0.0 124-125 3.3 0.0 0.0 0.0 0.0 126-127 3.525 0.0 0.0 0.0 0.0 128-129 3.7375 0.0 0.0 0.0 0.0 130-131 4.0125 0.0 0.0 0.0 0.0 132-133 4.3375 0.0 0.0 0.0 0.0 134-135 4.6625 0.0 0.0 0.0 0.0 136-137 4.9 0.0 0.0 0.0 0.0 138-139 5.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGAAAA 10 0.006830828 145.0 1 CGAAAAT 10 0.006830828 145.0 2 TGGTGTG 20 0.00593511 29.0 100-104 >>END_MODULE SRR7169859 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169859_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2185 34.0 33.0 34.0 33.0 34.0 2 33.29575 34.0 33.0 34.0 33.0 34.0 3 33.28725 34.0 33.0 34.0 33.0 34.0 4 33.28925 34.0 33.0 34.0 33.0 34.0 5 33.2375 34.0 33.0 34.0 33.0 34.0 6 37.38875 38.0 38.0 38.0 38.0 38.0 7 37.4005 38.0 38.0 38.0 38.0 38.0 8 37.462 38.0 38.0 38.0 38.0 38.0 9 37.48225 38.0 38.0 38.0 38.0 38.0 10-14 37.44815 38.0 38.0 38.0 38.0 38.0 15-19 37.334799999999994 38.0 38.0 38.0 37.4 38.0 20-24 37.3193 38.0 38.0 38.0 37.2 38.0 25-29 37.24395 38.0 38.0 38.0 37.6 38.0 30-34 37.10355 38.0 38.0 38.0 36.6 38.0 35-39 36.7165 38.0 38.0 38.0 34.8 38.0 40-44 37.1311 38.0 38.0 38.0 36.6 38.0 45-49 37.3107 38.0 38.0 38.0 37.0 38.0 50-54 37.28105 38.0 38.0 38.0 37.0 38.0 55-59 37.23025 38.0 38.0 38.0 37.0 38.0 60-64 37.04875 38.0 38.0 38.0 36.6 38.0 65-69 37.074 38.0 38.0 38.0 37.0 38.0 70-74 37.127050000000004 38.0 38.0 38.0 37.0 38.0 75-79 37.07520000000001 38.0 38.0 38.0 36.6 38.0 80-84 36.9095 38.0 38.0 38.0 36.2 38.0 85-89 36.3191 38.0 37.8 38.0 33.6 38.0 90-94 36.668600000000005 38.0 37.8 38.0 35.4 38.0 95-99 36.75315 38.0 38.0 38.0 36.0 38.0 100-104 36.629999999999995 38.0 38.0 38.0 35.2 38.0 105-109 36.25045 38.0 37.8 38.0 33.6 38.0 110-114 35.93455 38.0 37.2 38.0 31.6 38.0 115-119 36.197250000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.053 38.0 38.0 38.0 33.6 38.0 125-129 35.32495 38.0 36.2 38.0 29.2 38.0 130-134 35.640600000000006 38.0 36.6 38.0 32.0 38.0 135-139 35.19625 38.0 36.0 38.0 31.0 38.0 140-144 34.5613 38.0 35.4 38.0 27.4 38.0 145-149 32.7484 38.0 32.6 38.0 18.2 38.0 150-151 29.563375 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 1.0 4 2.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 3.0 14 5.0 15 1.0 16 0.0 17 1.0 18 6.0 19 5.0 20 9.0 21 3.0 22 5.0 23 8.0 24 5.0 25 8.0 26 13.0 27 7.0 28 25.0 29 26.0 30 33.0 31 45.0 32 56.0 33 85.0 34 115.0 35 270.0 36 680.0 37 2568.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.025 21.825 15.1 24.05 2 27.925 25.575 27.525 18.975 3 20.474999999999998 28.799999999999997 31.275 19.45 4 22.5 33.425 24.325 19.75 5 25.05 35.175 21.025 18.75 6 21.625 37.525 23.275000000000002 17.575 7 20.525 22.425 37.275000000000006 19.775000000000002 8 21.55 25.825 27.075 25.55 9 21.375 28.199999999999996 27.35 23.075000000000003 10-14 23.755000000000003 27.994999999999997 26.3 21.95 15-19 22.81 27.93 27.905 21.355 20-24 23.13 28.115000000000002 27.345000000000002 21.41 25-29 23.035 28.194999999999997 27.389999999999997 21.38 30-34 23.0 28.87 27.36 20.77 35-39 23.145 27.98 27.384999999999998 21.490000000000002 40-44 23.105 28.125 27.425 21.345 45-49 23.595 27.994999999999997 27.6 20.810000000000002 50-54 23.380000000000003 27.694999999999997 27.565 21.36 55-59 23.119999999999997 28.155 27.750000000000004 20.974999999999998 60-64 23.555 27.88 27.055 21.51 65-69 24.12 27.92 27.26 20.7 70-74 23.61 28.215 27.485 20.69 75-79 23.244999999999997 28.005000000000003 28.115000000000002 20.635 80-84 23.415 28.03 27.61 20.945 85-89 24.215 28.015 27.295 20.474999999999998 90-94 23.745 27.655 27.975 20.625 95-99 24.04 28.060000000000002 27.455000000000002 20.445 100-104 23.66 28.185 27.400000000000002 20.755000000000003 105-109 23.735 28.12 27.229999999999997 20.915 110-114 23.635 28.29 26.805 21.27 115-119 24.169999999999998 27.855 27.450000000000003 20.525 120-124 24.435000000000002 27.77 27.744999999999997 20.05 125-129 24.16 27.855 27.750000000000004 20.235 130-134 25.097548774387196 27.218609304652325 27.093546773386695 20.590295147573787 135-139 24.54 28.01 27.33 20.119999999999997 140-144 25.11 28.189999999999998 26.735 19.965 145-149 25.115 26.99 27.655 20.24 150-151 25.0375 27.0875 28.1625 19.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 2.0 26 1.5 27 1.0 28 4.5 29 4.0 30 6.0 31 13.5 32 17.0 33 25.0 34 35.5 35 50.5 36 76.0 37 103.0 38 130.0 39 166.5 40 195.0 41 218.0 42 252.5 43 277.5 44 278.0 45 289.0 46 297.0 47 273.0 48 253.5 49 223.0 50 184.5 51 139.5 52 110.5 53 95.5 54 70.5 55 58.5 56 41.5 57 24.5 58 16.0 59 16.0 60 16.0 61 9.5 62 6.0 63 4.5 64 3.5 65 1.5 66 1.0 67 1.0 68 2.0 69 2.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.05 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54739753583102 98.97500000000001 2 0.37716872014080965 0.75 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.025144581342720643 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.7749999999999999 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.0999999999999996 0.0 0.0 0.0 0.0 114-115 2.3375 0.0 0.0 0.0 0.0 116-117 2.5875 0.0 0.0 0.0 0.0 118-119 2.8875 0.0 0.0 0.0 0.0 120-121 3.0 0.0 0.0 0.0 0.0 122-123 3.2125 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.625 0.0 0.0 0.0 0.0 128-129 3.8375 0.0 0.0 0.0 0.0 130-131 4.1125 0.0 0.0 0.0 0.0 132-133 4.4375 0.0 0.0 0.0 0.0 134-135 4.7625 0.0 0.0 0.0 0.0 136-137 5.025 0.0 0.0 0.0 0.0 138-139 5.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAAAA 10 0.006830828 145.0 6 >>END_MODULE Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755937 spots for SRR7169859.sra Written 755937 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra Read 755927 spots for SRR7169859.sra Written 755927 spots for SRR7169859.sra SRR ids: ['SRR7169859.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rucq5_2d SRR7169859.sra spots: 15118550 blocks: [[1, 755927], [755928, 1511854], [1511855, 2267781], [2267782, 3023708], [3023709, 3779635], [3779636, 4535562], [4535563, 5291489], [5291490, 6047416], [6047417, 6803343], [6803344, 7559270], [7559271, 8315197], [8315198, 9071124], [9071125, 9827051], [9827052, 10582978], [10582979, 11338905], [11338906, 12094832], [12094833, 12850759], [12850760, 13606686], [13606687, 14362613], [14362614, 15118550]] SRR7169859 file size 5101480 SRR7169859 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169859 SRR7169859_1.fastq SRR7169859_2.fastq Input file: SRR7169859_1.fastq Paired file: SRR7169859_2.fastq trimmed: SRR7169859-trimmed-pair1.fastq, SRR7169859-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:35:34 2025 >> started Tue Feb 11 23:35:51 2025 >> done (16.968s) 15118550 read pairs processed; of these: 22281 ( 0.15%) short read pairs filtered out after trimming by size control 30342 ( 0.20%) empty read pairs filtered out after trimming by size control 15065927 (99.65%) read pairs available; of these: 6730589 (44.67%) trimmed read pairs available after processing 8335338 (55.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 4 0.00% 21 5 0.00% 22 6 0.00% 23 7 0.00% 24 4 0.00% 25 3 0.00% 26 5 0.00% 27 8 0.00% 28 3 0.00% 29 7 0.00% 30 8 0.00% 31 7 0.00% 32 9 0.00% 33 9 0.00% 34 10 0.00% 35 16 0.00% 36 15 0.00% 37 13 0.00% 38 13 0.00% 39 22 0.00% 40 18 0.00% 41 31 0.00% 42 30 0.00% 43 47 0.00% 44 26 0.00% 45 33 0.00% 46 61 0.00% 47 71 0.00% 48 60 0.00% 49 77 0.00% 50 81 0.00% 51 97 0.00% 52 122 0.00% 53 144 0.00% 54 165 0.00% 55 179 0.00% 56 207 0.00% 57 213 0.00% 58 252 0.00% 59 290 0.00% 60 336 0.00% 61 383 0.00% 62 471 0.00% 63 507 0.00% 64 591 0.00% 65 640 0.00% 66 722 0.00% 67 717 0.00% 68 876 0.01% 69 1020 0.01% 70 1205 0.01% 71 1419 0.01% 72 1588 0.01% 73 1908 0.01% 74 2049 0.01% 75 2290 0.02% 76 2856 0.02% 77 3208 0.02% 78 2990 0.02% 79 3185 0.02% 80 3419 0.02% 81 3879 0.03% 82 4256 0.03% 83 4905 0.03% 84 6233 0.04% 85 6713 0.04% 86 7159 0.05% 87 7466 0.05% 88 8034 0.05% 89 8323 0.06% 90 8596 0.06% 91 9022 0.06% 92 9503 0.06% 93 10214 0.07% 94 10846 0.07% 95 11498 0.08% 96 11792 0.08% 97 11892 0.08% 98 11805 0.08% 99 12198 0.08% 100 12850 0.09% 101 13343 0.09% 102 13963 0.09% 103 14923 0.10% 104 15339 0.10% 105 16025 0.11% 106 16705 0.11% 107 16816 0.11% 108 17035 0.11% 109 17318 0.11% 110 17696 0.12% 111 18086 0.12% 112 18945 0.13% 113 19703 0.13% 114 20263 0.13% 115 21273 0.14% 116 21596 0.14% 117 22119 0.15% 118 22367 0.15% 119 22426 0.15% 120 22699 0.15% 121 23357 0.16% 122 24081 0.16% 123 25160 0.17% 124 26484 0.18% 125 27146 0.18% 126 28469 0.19% 127 29521 0.20% 128 30021 0.20% 129 30633 0.20% 130 31780 0.21% 131 32951 0.22% 132 34225 0.23% 133 35962 0.24% 134 38282 0.25% 135 40613 0.27% 136 43194 0.29% 137 46077 0.31% 138 49197 0.33% 139 52668 0.35% 140 57743 0.38% 141 63111 0.42% 142 70578 0.47% 143 80484 0.53% 144 96074 0.64% 145 118454 0.79% 146 151487 1.01% 147 211490 1.40% 148 330330 2.19% 149 699659 4.64% 150 3620771 24.03% 151 8335338 55.33% 15065927 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=41 prefix-density=0.21 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=94.01 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=18.2 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=4.95 fanout-score-rank=27 prefix-density=0.36 prefix-fanout=3.6 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=42 fanout-score=147.38 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.0 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTTCTCGAGAAGATCAAGGAGA SRR7169859 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:36:42 Started mapping on | Feb 11 23:36:42 Finished on | Feb 11 23:38:08 Mapping speed, Million of reads per hour | 630.67 Number of input reads | 15065927 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14210078 Uniquely mapped reads % | 94.32% Average mapped length | 294.62 Number of splices: Total | 13663766 Number of splices: Annotated (sjdb) | 13431183 Number of splices: GT/AG | 13464184 Number of splices: GC/AG | 161785 Number of splices: AT/AC | 10881 Number of splices: Non-canonical | 26916 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271173 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 13762 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.76% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 603298 603298 603298 N_multimapping 271173 271173 271173 N_noFeature 274710 14060169 330615 N_ambiguous 156073 769 61568 UnstrandedReadsAssigned:13779295 PositiveStrandReadsAssigned:149140 NegativeStrandReadsAssigned:13817895 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169859 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169859-trimmed-pair1.fastq SRR7169859-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,065,927 reads, 13,704,091 reads pseudoaligned [quant] estimated average fragment length: 266.765 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,028 rounds 52401 SRR7169859.ke.tsv 34699 SRR7169859.se.tsv 87100 total ==> SRR7169859.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.23 237 8.92145 Potri.005G024800.1.v4.1 1035 769.235 52 4.45886 Potri.004G059700.1.v4.1 961 695.261 2 0.189741 Potri.007G009000.2.v4.1 1416 1150.23 0 0 Potri.003G141000.2.v4.1 2943 2677.23 226.029 5.56875 Potri.016G087400.1.v4.1 270 76.4084 1564 1350.13 Potri.015G069301.1.v4.1 564 303.934 0 0 Potri.010G195200.1.v4.1 1773 1507.23 22 0.962767 Potri.012G127500.1.v4.1 977 711.248 6180 573.122 ==> SRR7169859.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1138 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169859 completed mapping pipeline successfully