Starting /dee2/code/volunteer_pipeline.sh SRR7169860 current disk space = 3052078772224 free memory = 1326940384 SRR7169860 SRAfilesize 65d1ac4b41b3a6a541f4b5f7758a641d SRR7169860.sra SRR7169860.sra file validated SRR7169860 is paired end SRR7169860 is conventional basespace SRR7169860 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169860_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.66725 18.0 18.0 25.0 18.0 32.0 2 29.42675 30.0 27.0 31.0 27.0 33.0 3 31.27 33.0 31.0 33.0 29.0 33.0 4 32.23225 33.0 33.0 33.0 31.0 33.0 5 32.955 33.0 33.0 33.0 33.0 34.0 6 37.00775 38.0 37.0 38.0 36.0 38.0 7 36.64875 38.0 38.0 38.0 35.0 38.0 8 37.37175 38.0 38.0 38.0 37.0 38.0 9 37.518 38.0 38.0 38.0 37.0 38.0 10-14 37.55825 38.0 38.0 38.0 37.4 38.0 15-19 37.57745 38.0 38.0 38.0 37.8 38.0 20-24 37.53245 38.0 38.0 38.0 37.6 38.0 25-29 37.590149999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.544650000000004 38.0 38.0 38.0 37.4 38.0 35-39 37.50915 38.0 38.0 38.0 37.2 38.0 40-44 37.3536 38.0 38.0 38.0 36.8 38.0 45-49 37.450149999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.363749999999996 38.0 38.0 38.0 36.6 38.0 55-59 37.175149999999995 38.0 38.0 38.0 36.0 38.0 60-64 37.080850000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.98505 38.0 38.0 38.0 35.6 38.0 70-74 36.915499999999994 38.0 38.0 38.0 35.2 38.0 75-79 36.85744999999999 38.0 38.0 38.0 35.0 38.0 80-84 36.723850000000006 38.0 38.0 38.0 34.6 38.0 85-89 36.454699999999995 38.0 37.4 38.0 34.0 38.0 90-94 36.1199 38.0 36.8 38.0 32.8 38.0 95-99 36.08275 38.0 37.0 38.0 32.6 38.0 100-104 35.084050000000005 38.0 35.6 38.0 27.8 38.0 105-109 35.718 38.0 36.2 38.0 31.0 38.0 110-114 35.680150000000005 38.0 36.6 38.0 31.8 38.0 115-119 35.251599999999996 38.0 35.4 38.0 29.2 38.0 120-124 34.3777 38.0 34.4 38.0 24.6 38.0 125-129 34.74615 38.0 35.0 38.0 27.6 38.0 130-134 33.629850000000005 37.4 33.0 38.0 22.6 38.0 135-139 34.1544 38.0 34.0 38.0 25.4 38.0 140-144 33.1883 37.2 33.6 38.0 18.8 38.0 145-149 31.64395 35.8 30.2 38.0 13.8 38.0 150-151 27.7785 33.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 3.0 16 4.0 17 2.0 18 2.0 19 6.0 20 4.0 21 1.0 22 5.0 23 6.0 24 4.0 25 7.0 26 7.0 27 19.0 28 18.0 29 31.0 30 53.0 31 61.0 32 101.0 33 163.0 34 276.0 35 569.0 36 1362.0 37 1294.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.775 11.15 13.750000000000002 36.325 2 22.475 14.725 32.5 30.3 3 20.0 18.15 25.8 36.05 4 21.9 27.450000000000003 23.375 27.275 5 23.3 31.674999999999997 24.025 21.0 6 19.675 35.275 23.400000000000002 21.65 7 14.799999999999999 27.3 40.25 17.65 8 18.0 26.325 31.374999999999996 24.3 9 17.849999999999998 24.55 35.15 22.45 10-14 20.165 30.245 27.175 22.415 15-19 20.555 29.25 26.900000000000002 23.294999999999998 20-24 19.775000000000002 29.335 27.634999999999998 23.255 25-29 20.064999999999998 28.854999999999997 27.305 23.775 30-34 20.11 29.270000000000003 27.12 23.5 35-39 20.035 29.215000000000003 27.54 23.21 40-44 20.175 28.57 27.875 23.380000000000003 45-49 20.375 28.665000000000003 27.415 23.544999999999998 50-54 20.255000000000003 28.28 27.735 23.73 55-59 20.53 28.345 27.63 23.494999999999997 60-64 19.939999999999998 28.865000000000002 27.32 23.875 65-69 20.325 28.139999999999997 27.779999999999998 23.755000000000003 70-74 19.869999999999997 29.04 27.35 23.74 75-79 20.630000000000003 28.73 27.12 23.52 80-84 20.200000000000003 28.79 27.095000000000002 23.915 85-89 20.630000000000003 28.439999999999998 27.54 23.39 90-94 20.68 28.194999999999997 27.845 23.28 95-99 21.12 27.595 27.73 23.555 100-104 20.185 28.749999999999996 27.46 23.605 105-109 20.5 28.305000000000003 27.560000000000002 23.635 110-114 20.665 27.665 27.860000000000003 23.810000000000002 115-119 20.880000000000003 28.475 27.49 23.155 120-124 20.32 28.58 27.07 24.03 125-129 21.38 28.18 27.12 23.32 130-134 20.865000000000002 28.244999999999997 27.139999999999997 23.75 135-139 20.849999999999998 28.299999999999997 27.095000000000002 23.755000000000003 140-144 21.12 27.525 27.455000000000002 23.9 145-149 20.71 27.67 27.66 23.96 150-151 21.2375 27.6375 27.6 23.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.5 22 2.5 23 1.5 24 0.5 25 1.5 26 2.5 27 5.0 28 8.0 29 11.0 30 24.0 31 32.0 32 29.5 33 40.5 34 58.5 35 67.5 36 82.5 37 106.0 38 130.0 39 150.5 40 185.0 41 210.0 42 227.0 43 260.0 44 276.0 45 271.5 46 268.5 47 282.0 48 262.0 49 206.5 50 164.5 51 136.0 52 116.0 53 100.5 54 72.5 55 53.5 56 45.0 57 31.0 58 20.0 59 11.5 60 8.5 61 7.5 62 6.5 63 3.5 64 1.5 65 2.0 66 2.0 67 2.0 68 4.0 69 3.5 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.5375 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7124999999999999 0.0 0.0 0.0 0.0 92-93 0.85 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.5750000000000002 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.65 0.0 0.0 0.0 0.0 110-111 1.7375 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.1 0.0 0.0 0.0 0.0 118-119 2.2 0.0 0.0 0.0 0.0 120-121 2.4749999999999996 0.0 0.0 0.0 0.0 122-123 2.9000000000000004 0.0 0.0 0.0 0.0 124-125 3.025 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.6125 0.0 0.0 0.0 0.0 130-131 3.9125 0.0 0.0 0.0 0.0 132-133 4.112500000000001 0.0 0.0 0.0 0.0 134-135 4.4375 0.0 0.0 0.0 0.0 136-137 4.5875 0.0 0.0 0.0 0.0 138-139 4.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGGCC 10 0.006830828 145.0 8 CCATGGG 10 0.006830828 145.0 8 GCTGCAG 10 0.006830828 145.0 5 GTAACTC 10 0.006830828 145.0 8 GCACAGG 10 0.006830828 145.0 145 TGTAACT 10 0.006830828 145.0 7 TTTTTTT 20 0.00593511 29.0 60-64 >>END_MODULE SRR7169860 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169860_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2455 34.0 33.0 34.0 33.0 34.0 2 33.37325 34.0 33.0 34.0 33.0 34.0 3 33.43075 34.0 33.0 34.0 33.0 34.0 4 33.3905 34.0 33.0 34.0 33.0 34.0 5 33.376 34.0 33.0 34.0 33.0 34.0 6 37.4295 38.0 38.0 38.0 38.0 38.0 7 37.52775 38.0 38.0 38.0 38.0 38.0 8 37.50325 38.0 38.0 38.0 38.0 38.0 9 37.546 38.0 38.0 38.0 38.0 38.0 10-14 37.53845 38.0 38.0 38.0 38.0 38.0 15-19 37.5346 38.0 38.0 38.0 38.0 38.0 20-24 37.3086 38.0 38.0 38.0 37.4 38.0 25-29 36.934749999999994 38.0 37.8 38.0 35.0 38.0 30-34 36.53225 38.0 37.8 38.0 33.8 38.0 35-39 37.203599999999994 38.0 38.0 38.0 36.8 38.0 40-44 37.16115 38.0 38.0 38.0 36.8 38.0 45-49 37.125350000000005 38.0 38.0 38.0 36.4 38.0 50-54 37.300799999999995 38.0 38.0 38.0 36.8 38.0 55-59 37.36115 38.0 38.0 38.0 37.0 38.0 60-64 37.22115 38.0 38.0 38.0 37.0 38.0 65-69 37.2521 38.0 38.0 38.0 37.0 38.0 70-74 37.230999999999995 38.0 38.0 38.0 37.0 38.0 75-79 37.20635 38.0 38.0 38.0 37.0 38.0 80-84 37.01735 38.0 38.0 38.0 36.4 38.0 85-89 37.006550000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.9778 38.0 38.0 38.0 36.0 38.0 95-99 36.8634 38.0 38.0 38.0 35.8 38.0 100-104 36.69445 38.0 38.0 38.0 35.2 38.0 105-109 36.63385 38.0 38.0 38.0 35.0 38.0 110-114 36.6703 38.0 38.0 38.0 35.0 38.0 115-119 36.332649999999994 38.0 38.0 38.0 34.2 38.0 120-124 36.11465 38.0 38.0 38.0 33.6 38.0 125-129 36.119600000000005 38.0 38.0 38.0 33.8 38.0 130-134 35.84015000000001 38.0 37.0 38.0 32.2 38.0 135-139 35.56575 38.0 36.0 38.0 31.8 38.0 140-144 35.42255 38.0 36.0 38.0 32.0 38.0 145-149 34.76275 38.0 35.6 38.0 28.8 38.0 150-151 30.55225 35.5 28.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 2.0 14 2.0 15 3.0 16 0.0 17 3.0 18 4.0 19 3.0 20 9.0 21 4.0 22 6.0 23 4.0 24 5.0 25 7.0 26 7.0 27 14.0 28 16.0 29 22.0 30 22.0 31 32.0 32 56.0 33 65.0 34 124.0 35 212.0 36 545.0 37 2823.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.2 22.125 13.65 27.025 2 27.581895473868467 26.206551637909474 29.057264316079017 17.154288572143038 3 20.5 27.900000000000002 32.1 19.5 4 23.755938984746187 34.00850212553138 22.330582645661416 19.904976244061015 5 24.006001500375092 36.33408352088022 22.330582645661416 17.329332333083272 6 21.4 38.1 22.6 17.9 7 19.675 23.1 38.324999999999996 18.9 8 22.55 25.674999999999997 26.375 25.4 9 20.549999999999997 25.924999999999997 28.749999999999996 24.775 10-14 22.46 29.509999999999998 26.405 21.625 15-19 22.21 27.634999999999998 28.205000000000002 21.95 20-24 22.939999999999998 28.155 27.375 21.529999999999998 25-29 23.064999999999998 28.595 27.455000000000002 20.885 30-34 23.085 28.355000000000004 27.589999999999996 20.97 35-39 22.775000000000002 28.02 27.82 21.385 40-44 22.86 28.144999999999996 28.375 20.62 45-49 23.26 28.065 27.865000000000002 20.810000000000002 50-54 22.869999999999997 28.18 27.975 20.974999999999998 55-59 23.335 27.57 28.365000000000002 20.73 60-64 23.064999999999998 27.965 28.084999999999997 20.885 65-69 22.99 27.88 28.050000000000004 21.08 70-74 23.34 27.495000000000005 28.23 20.935000000000002 75-79 23.06 27.884999999999998 28.249999999999996 20.805 80-84 23.7 27.925 28.155 20.22 85-89 23.28 28.18 27.99 20.549999999999997 90-94 23.830000000000002 27.705000000000002 27.810000000000002 20.655 95-99 24.169999999999998 27.915 27.925 19.99 100-104 24.065 27.67 27.525 20.74 105-109 23.305 28.27 27.355 21.07 110-114 23.810000000000002 27.96 27.884999999999998 20.345 115-119 23.645 27.384999999999998 27.97 21.0 120-124 24.169999999999998 27.944999999999997 27.189999999999998 20.695 125-129 23.665 28.689999999999998 27.529999999999998 20.115 130-134 24.490000000000002 27.705000000000002 27.015 20.79 135-139 24.38 27.639999999999997 27.405 20.575 140-144 24.255 28.27 27.034999999999997 20.44 145-149 24.48 27.73 27.42 20.369999999999997 150-151 24.5625 27.35 27.737499999999997 20.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.5 23 2.0 24 2.5 25 3.0 26 2.5 27 3.0 28 4.0 29 6.5 30 11.5 31 16.5 32 24.0 33 32.5 34 34.0 35 43.0 36 77.0 37 110.0 38 141.5 39 169.5 40 195.5 41 237.0 42 267.0 43 279.5 44 290.5 45 309.0 46 302.5 47 266.0 48 225.5 49 196.5 50 173.0 51 145.5 52 110.5 53 85.0 54 70.0 55 42.5 56 30.0 57 23.5 58 16.5 59 12.0 60 8.5 61 7.5 62 4.5 63 3.5 64 2.5 65 2.0 66 2.0 67 1.5 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.40190906807334836 0.8 3 0.0 0.0 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.5375 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7124999999999999 0.0 0.0 0.0 0.0 92-93 0.85 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.5499999999999998 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.175 0.0 0.0 0.0 0.0 120-121 2.4625 0.0 0.0 0.0 0.0 122-123 2.9000000000000004 0.0 0.0 0.0 0.0 124-125 3.025 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.6 0.0 0.0 0.0 0.0 130-131 3.9125 0.0 0.0 0.0 0.0 132-133 4.112500000000001 0.0 0.0 0.0 0.0 134-135 4.425000000000001 0.0 0.0 0.0 0.0 136-137 4.5625 0.0 0.0 0.0 0.0 138-139 4.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603199 spots for SRR7169860.sra Written 603199 spots for SRR7169860.sra Read 603206 spots for SRR7169860.sra Written 603206 spots for SRR7169860.sra SRR ids: ['SRR7169860.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q1d6qjyv SRR7169860.sra spots: 12063987 blocks: [[1, 603199], [603200, 1206398], [1206399, 1809597], [1809598, 2412796], [2412797, 3015995], [3015996, 3619194], [3619195, 4222393], [4222394, 4825592], [4825593, 5428791], [5428792, 6031990], [6031991, 6635189], [6635190, 7238388], [7238389, 7841587], [7841588, 8444786], [8444787, 9047985], [9047986, 9651184], [9651185, 10254383], [10254384, 10857582], [10857583, 11460781], [11460782, 12063987]] SRR7169860 file size 4066388 SRR7169860 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169860 SRR7169860_1.fastq SRR7169860_2.fastq Input file: SRR7169860_1.fastq Paired file: SRR7169860_2.fastq trimmed: SRR7169860-trimmed-pair1.fastq, SRR7169860-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:46:18 2025 >> started Tue Feb 11 23:46:33 2025 >> done (14.802s) 12063987 read pairs processed; of these: 8935 ( 0.07%) short read pairs filtered out after trimming by size control 14580 ( 0.12%) empty read pairs filtered out after trimming by size control 12040472 (99.81%) read pairs available; of these: 5412168 (44.95%) trimmed read pairs available after processing 6628304 (55.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 3 0.00% 24 4 0.00% 25 4 0.00% 26 1 0.00% 27 9 0.00% 28 9 0.00% 29 6 0.00% 30 4 0.00% 31 6 0.00% 32 5 0.00% 33 3 0.00% 34 5 0.00% 35 10 0.00% 36 10 0.00% 37 10 0.00% 38 15 0.00% 39 15 0.00% 40 17 0.00% 41 21 0.00% 42 38 0.00% 43 29 0.00% 44 21 0.00% 45 54 0.00% 46 42 0.00% 47 41 0.00% 48 58 0.00% 49 72 0.00% 50 80 0.00% 51 105 0.00% 52 113 0.00% 53 127 0.00% 54 129 0.00% 55 132 0.00% 56 153 0.00% 57 189 0.00% 58 202 0.00% 59 235 0.00% 60 338 0.00% 61 369 0.00% 62 397 0.00% 63 468 0.00% 64 509 0.00% 65 598 0.00% 66 647 0.01% 67 675 0.01% 68 814 0.01% 69 943 0.01% 70 1043 0.01% 71 1171 0.01% 72 1428 0.01% 73 1601 0.01% 74 1752 0.01% 75 1951 0.02% 76 2213 0.02% 77 2257 0.02% 78 2531 0.02% 79 2700 0.02% 80 3024 0.03% 81 3318 0.03% 82 3781 0.03% 83 4267 0.04% 84 4850 0.04% 85 5537 0.05% 86 5731 0.05% 87 6092 0.05% 88 6282 0.05% 89 6709 0.06% 90 7240 0.06% 91 7689 0.06% 92 7731 0.06% 93 8487 0.07% 94 8895 0.07% 95 9320 0.08% 96 9515 0.08% 97 9628 0.08% 98 9766 0.08% 99 10201 0.08% 100 10649 0.09% 101 10839 0.09% 102 11438 0.09% 103 11978 0.10% 104 12411 0.10% 105 12869 0.11% 106 13135 0.11% 107 13355 0.11% 108 13650 0.11% 109 13634 0.11% 110 14067 0.12% 111 14498 0.12% 112 14893 0.12% 113 15368 0.13% 114 15983 0.13% 115 16416 0.14% 116 16943 0.14% 117 17348 0.14% 118 17737 0.15% 119 17740 0.15% 120 17491 0.15% 121 18056 0.15% 122 18440 0.15% 123 19275 0.16% 124 20017 0.17% 125 20481 0.17% 126 21658 0.18% 127 22301 0.19% 128 22822 0.19% 129 23495 0.20% 130 24138 0.20% 131 25188 0.21% 132 26497 0.22% 133 27890 0.23% 134 29260 0.24% 135 30815 0.26% 136 32907 0.27% 137 35655 0.30% 138 38246 0.32% 139 41663 0.35% 140 45569 0.38% 141 50541 0.42% 142 57625 0.48% 143 66146 0.55% 144 79887 0.66% 145 99635 0.83% 146 129419 1.07% 147 181539 1.51% 148 290632 2.41% 149 598085 4.97% 150 2847396 23.65% 151 6628304 55.05% 12040472 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=29 prefix-density=0.29 prefix-fanout=2.4 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.18 sequence-density-rank=5 fanout-score=48.91 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=13.0 sequence=CCACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAACACCTTGTTGAATCTTGGATCCGTGCCATGATATTCAAATGCAGTCATCCCATAGGCCTTGTTAAATGGAATTCCTCCATCAAGAATTGCATCTTTCAAATAATACCAGCTTTCCATGAGGACCTTGTCCTGGTTCATGAGA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=33 prefix-density=0.28 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.17 sequence-density-rank=9 fanout-score=33.53 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=10.7 sequence=TGTTGGTGGTGGTACTGGA SRR7169860 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:47:23 Started mapping on | Feb 11 23:47:23 Finished on | Feb 11 23:48:25 Mapping speed, Million of reads per hour | 699.12 Number of input reads | 12040472 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 11521271 Uniquely mapped reads % | 95.69% Average mapped length | 294.46 Number of splices: Total | 10695910 Number of splices: Annotated (sjdb) | 10527663 Number of splices: GT/AG | 10549222 Number of splices: GC/AG | 117014 Number of splices: AT/AC | 8610 Number of splices: Non-canonical | 21064 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 188382 % of reads mapped to multiple loci | 1.56% Number of reads mapped to too many loci | 31742 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.43% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 339305 339305 339305 N_multimapping 188382 188382 188382 N_noFeature 261675 11392263 311023 N_ambiguous 128827 550 48860 UnstrandedReadsAssigned:11130769 PositiveStrandReadsAssigned:128458 NegativeStrandReadsAssigned:11161388 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169860 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169860-trimmed-pair1.fastq SRR7169860-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,040,472 reads, 11,097,467 reads pseudoaligned [quant] estimated average fragment length: 286.117 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,000 rounds 52401 SRR7169860.ke.tsv 34699 SRR7169860.se.tsv 87100 total ==> SRR7169860.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.88 213 11.708 Potri.005G024800.1.v4.1 1035 749.883 33 4.19172 Potri.004G059700.1.v4.1 961 675.953 1 0.140914 Potri.007G009000.2.v4.1 1416 1130.88 0 0 Potri.003G141000.2.v4.1 2943 2657.88 194.06 6.9546 Potri.016G087400.1.v4.1 270 81.4636 864 1010.23 Potri.015G069301.1.v4.1 564 287.432 0 0 Potri.010G195200.1.v4.1 1773 1487.88 24 1.53643 Potri.012G127500.1.v4.1 977 691.928 2303 317.033 ==> SRR7169860.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1803 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 170 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 551 Potri.001G452600.v4.1 3 SRR7169860 completed mapping pipeline successfully