Starting /dee2/code/volunteer_pipeline.sh SRR7169861 current disk space = 3052394455040 free memory = 1450285356 SRR7169861 SRAfilesize 9168cb59ef9c7a35f82a9241ba855cff SRR7169861.sra SRR7169861.sra file validated SRR7169861 is paired end SRR7169861 is conventional basespace SRR7169861 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169861_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.14025 32.0 25.0 33.0 18.0 34.0 2 30.885 31.0 29.0 33.0 27.0 34.0 3 32.3835 33.0 33.0 33.0 31.0 34.0 4 32.92725 33.0 33.0 34.0 33.0 34.0 5 33.3105 34.0 33.0 34.0 33.0 34.0 6 37.20475 38.0 37.0 38.0 36.0 38.0 7 36.70875 38.0 38.0 38.0 35.0 38.0 8 37.467 38.0 38.0 38.0 37.0 38.0 9 37.6625 38.0 38.0 38.0 38.0 38.0 10-14 37.7265 38.0 38.0 38.0 38.0 38.0 15-19 37.6985 38.0 38.0 38.0 38.0 38.0 20-24 37.634699999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.6529 38.0 38.0 38.0 38.0 38.0 30-34 37.61305 38.0 38.0 38.0 38.0 38.0 35-39 37.63245 38.0 38.0 38.0 38.0 38.0 40-44 37.491600000000005 38.0 38.0 38.0 37.6 38.0 45-49 37.55405 38.0 38.0 38.0 38.0 38.0 50-54 37.4699 38.0 38.0 38.0 37.4 38.0 55-59 37.38695 38.0 38.0 38.0 37.0 38.0 60-64 37.337900000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.2832 38.0 38.0 38.0 37.0 38.0 70-74 37.22019999999999 38.0 38.0 38.0 36.6 38.0 75-79 37.15220000000001 38.0 38.0 38.0 36.2 38.0 80-84 37.0772 38.0 38.0 38.0 36.0 38.0 85-89 36.6858 38.0 38.0 38.0 34.6 38.0 90-94 36.56425 38.0 37.8 38.0 34.0 38.0 95-99 36.4611 38.0 37.8 38.0 34.0 38.0 100-104 35.6572 38.0 36.8 38.0 30.4 38.0 105-109 36.3134 38.0 37.2 38.0 33.8 38.0 110-114 36.31425 38.0 37.6 38.0 34.0 38.0 115-119 35.801300000000005 38.0 36.6 38.0 31.8 38.0 120-124 35.0366 38.0 35.2 38.0 26.4 38.0 125-129 35.59495 38.0 36.0 38.0 31.0 38.0 130-134 34.37535 38.0 34.6 38.0 24.8 38.0 135-139 35.0516 38.0 35.0 38.0 29.0 38.0 140-144 34.040499999999994 38.0 34.6 38.0 23.0 38.0 145-149 32.9274 37.2 33.0 38.0 20.4 38.0 150-151 29.286625 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 4.0 15 1.0 16 2.0 17 5.0 18 3.0 19 2.0 20 2.0 21 1.0 22 5.0 23 2.0 24 3.0 25 8.0 26 4.0 27 14.0 28 19.0 29 18.0 30 36.0 31 45.0 32 74.0 33 88.0 34 168.0 35 359.0 36 1071.0 37 2062.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.55 12.375 11.85 33.225 2 22.8 16.825000000000003 31.775 28.599999999999998 3 19.35 23.35 25.775 31.525 4 22.375 28.4 23.45 25.775 5 22.275 33.15 23.724999999999998 20.849999999999998 6 19.625 34.375 24.925 21.075 7 13.900000000000002 29.175 39.675 17.25 8 18.175 28.449999999999996 29.799999999999997 23.575 9 17.45 26.275 32.625 23.65 10-14 19.3 32.17 26.21 22.32 15-19 19.215 30.209999999999997 27.025 23.549999999999997 20-24 19.515 30.380000000000003 26.87 23.235 25-29 19.645000000000003 30.354999999999997 27.255000000000003 22.745 30-34 20.215 29.89 27.355 22.54 35-39 19.85 30.2 27.189999999999998 22.759999999999998 40-44 19.835 30.235 27.13 22.8 45-49 19.705000000000002 30.115 27.034999999999997 23.145 50-54 19.7 30.264999999999997 26.945000000000004 23.09 55-59 20.01 30.080000000000002 26.375 23.535 60-64 19.835 29.520000000000003 26.8 23.845 65-69 20.04 29.26 26.665 24.035 70-74 20.05 30.070000000000004 26.939999999999998 22.939999999999998 75-79 19.885 29.875 26.450000000000003 23.79 80-84 19.73 29.525000000000002 26.75 23.995 85-89 19.46 29.815 26.99 23.735 90-94 19.93 29.93 26.265 23.875 95-99 20.150000000000002 29.685 26.71 23.455000000000002 100-104 19.885 29.580000000000002 27.089999999999996 23.445 105-109 20.794999999999998 28.910000000000004 26.915 23.380000000000003 110-114 21.25 28.38 27.089999999999996 23.28 115-119 20.575 28.7 27.689999999999998 23.035 120-124 20.91 28.565 26.840000000000003 23.685000000000002 125-129 20.474999999999998 28.78 27.205000000000002 23.54 130-134 20.415 28.12 27.474999999999998 23.990000000000002 135-139 20.955 28.255000000000003 27.084999999999997 23.705000000000002 140-144 20.815 28.194999999999997 27.125 23.865 145-149 20.71 28.33 27.38 23.580000000000002 150-151 21.087500000000002 27.537499999999998 26.9125 24.462500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 2.0 20 1.5 21 1.0 22 2.5 23 4.0 24 3.5 25 3.5 26 10.5 27 16.0 28 14.0 29 19.5 30 23.0 31 27.5 32 43.5 33 61.0 34 79.5 35 88.5 36 111.5 37 148.5 38 158.5 39 170.5 40 184.0 41 192.5 42 219.0 43 244.0 44 255.5 45 267.0 46 247.5 47 212.0 48 200.5 49 184.0 50 168.5 51 141.0 52 108.5 53 91.0 54 73.5 55 54.0 56 36.0 57 33.0 58 28.5 59 18.5 60 13.5 61 6.5 62 5.0 63 5.5 64 4.0 65 3.5 66 3.0 67 1.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.35167043456417985 0.7000000000000001 3 0.025119316754584273 0.075 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.6375000000000002 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.1500000000000004 0.0 0.0 0.0 0.0 116-117 2.275 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 2.8375 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.2625 0.0 0.0 0.0 0.0 128-129 3.4375 0.0 0.0 0.0 0.0 130-131 3.5374999999999996 0.0 0.0 0.0 0.0 132-133 3.7 0.0 0.0 0.0 0.0 134-135 3.9000000000000004 0.0 0.0 0.0 0.0 136-137 4.0 0.0 0.0 0.0 0.0 138-139 4.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCTTC 10 0.006830828 145.0 5 ATCTTCA 10 0.006830828 145.0 6 TTTTTTA 10 0.006830828 145.0 4 >>END_MODULE SRR7169861 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169861_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.22825 34.0 33.0 34.0 33.0 34.0 2 33.359 34.0 33.0 34.0 33.0 34.0 3 33.38725 34.0 33.0 34.0 33.0 34.0 4 33.3265 34.0 33.0 34.0 33.0 34.0 5 33.34325 34.0 33.0 34.0 33.0 34.0 6 37.466 38.0 38.0 38.0 38.0 38.0 7 37.42675 38.0 38.0 38.0 38.0 38.0 8 37.4745 38.0 38.0 38.0 38.0 38.0 9 37.43375 38.0 38.0 38.0 38.0 38.0 10-14 37.408249999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.411500000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.192499999999995 38.0 38.0 38.0 37.2 38.0 25-29 36.7367 38.0 37.8 38.0 35.0 38.0 30-34 36.5546 38.0 37.8 38.0 34.0 38.0 35-39 37.096250000000005 38.0 38.0 38.0 36.8 38.0 40-44 36.92975 38.0 38.0 38.0 36.0 38.0 45-49 37.0306 38.0 38.0 38.0 36.2 38.0 50-54 37.15035 38.0 38.0 38.0 37.0 38.0 55-59 37.24705 38.0 38.0 38.0 37.0 38.0 60-64 37.1693 38.0 38.0 38.0 37.0 38.0 65-69 37.156400000000005 38.0 38.0 38.0 37.0 38.0 70-74 37.160900000000005 38.0 38.0 38.0 37.0 38.0 75-79 37.15239999999999 38.0 38.0 38.0 37.0 38.0 80-84 36.98095000000001 38.0 38.0 38.0 36.2 38.0 85-89 36.89775 38.0 38.0 38.0 36.0 38.0 90-94 36.943799999999996 38.0 38.0 38.0 36.0 38.0 95-99 36.8073 38.0 38.0 38.0 36.0 38.0 100-104 36.624100000000006 38.0 38.0 38.0 35.4 38.0 105-109 36.61409999999999 38.0 38.0 38.0 35.0 38.0 110-114 36.6147 38.0 38.0 38.0 35.0 38.0 115-119 36.3879 38.0 38.0 38.0 34.2 38.0 120-124 36.1678 38.0 38.0 38.0 34.0 38.0 125-129 36.08970000000001 38.0 38.0 38.0 33.4 38.0 130-134 35.796049999999994 38.0 37.0 38.0 32.8 38.0 135-139 35.44315 38.0 36.0 38.0 31.0 38.0 140-144 35.1964 38.0 36.0 38.0 31.0 38.0 145-149 34.654199999999996 38.0 35.6 38.0 28.0 38.0 150-151 30.540875 35.5 28.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 2.0 5 1.0 6 1.0 7 1.0 8 1.0 9 0.0 10 2.0 11 3.0 12 2.0 13 1.0 14 3.0 15 3.0 16 1.0 17 3.0 18 2.0 19 3.0 20 4.0 21 5.0 22 6.0 23 4.0 24 4.0 25 8.0 26 11.0 27 15.0 28 17.0 29 24.0 30 33.0 31 42.0 32 43.0 33 71.0 34 97.0 35 211.0 36 570.0 37 2798.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.125 20.375 15.525 24.975 2 26.825 25.374999999999996 30.2 17.599999999999998 3 21.8 27.075 31.4 19.725 4 24.175 34.050000000000004 23.025000000000002 18.75 5 24.75 34.925 22.2 18.125 6 21.975 36.25 24.625 17.150000000000002 7 20.549999999999997 21.75 37.05 20.65 8 22.625 26.974999999999998 24.85 25.55 9 21.4 26.400000000000002 28.749999999999996 23.45 10-14 23.65 28.499999999999996 26.229999999999997 21.62 15-19 23.525 27.785 27.58 21.11 20-24 23.355 28.15 27.66 20.835 25-29 23.48 28.110000000000003 27.295 21.115000000000002 30-34 23.22 27.98 27.705000000000002 21.095 35-39 23.544999999999998 27.165 27.935 21.355 40-44 23.875 27.72 27.744999999999997 20.66 45-49 23.74 27.185 27.495000000000005 21.58 50-54 24.005000000000003 28.175 26.834999999999997 20.985 55-59 24.065 27.54 27.639999999999997 20.755000000000003 60-64 23.44 27.445000000000004 28.675 20.44 65-69 23.865 27.845 27.66 20.630000000000003 70-74 23.555 28.189999999999998 27.43 20.825 75-79 23.34 27.605 28.360000000000003 20.695 80-84 23.724999999999998 27.689999999999998 28.18 20.405 85-89 23.86 27.35 28.01 20.78 90-94 23.68 28.34 27.375 20.605 95-99 23.96 27.655 27.99 20.395 100-104 23.755000000000003 27.525 27.82 20.9 105-109 24.66 27.315 28.155 19.869999999999997 110-114 24.490000000000002 26.974999999999998 28.544999999999998 19.99 115-119 24.37 27.41 27.884999999999998 20.335 120-124 24.47 28.18 27.275 20.075000000000003 125-129 23.835 27.805000000000003 27.744999999999997 20.615 130-134 24.895 27.810000000000002 26.99 20.305 135-139 24.21 27.02 28.42 20.349999999999998 140-144 24.154999999999998 27.3 28.199999999999996 20.345 145-149 24.349999999999998 26.87 28.52 20.26 150-151 24.15 27.075 28.849999999999998 19.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.5 24 1.0 25 0.5 26 0.5 27 4.0 28 6.5 29 7.5 30 9.5 31 13.0 32 19.5 33 29.0 34 42.0 35 50.0 36 64.5 37 91.0 38 124.0 39 150.5 40 166.0 41 201.5 42 244.0 43 285.0 44 309.0 45 302.5 46 287.5 47 270.0 48 243.5 49 221.5 50 190.0 51 144.5 52 131.5 53 110.0 54 74.0 55 55.0 56 39.0 57 28.0 58 20.5 59 14.0 60 8.5 61 9.0 62 7.0 63 4.0 64 5.0 65 2.5 66 1.5 67 2.0 68 1.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.23750000000000002 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.8875 0.0 0.0 0.0 0.0 114-115 2.1625 0.0 0.0 0.0 0.0 116-117 2.275 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.5875 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.05 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.425 0.0 0.0 0.0 0.0 130-131 3.55 0.0 0.0 0.0 0.0 132-133 3.725 0.0 0.0 0.0 0.0 134-135 3.95 0.0 0.0 0.0 0.0 136-137 4.050000000000001 0.0 0.0 0.0 0.0 138-139 4.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGTCA 10 0.006830828 145.0 8 >>END_MODULE Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra Read 591346 spots for SRR7169861.sra Written 591346 spots for SRR7169861.sra Read 591337 spots for SRR7169861.sra Written 591337 spots for SRR7169861.sra SRR ids: ['SRR7169861.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m0q85b22 SRR7169861.sra spots: 11826749 blocks: [[1, 591337], [591338, 1182674], [1182675, 1774011], [1774012, 2365348], [2365349, 2956685], [2956686, 3548022], [3548023, 4139359], [4139360, 4730696], [4730697, 5322033], [5322034, 5913370], [5913371, 6504707], [6504708, 7096044], [7096045, 7687381], [7687382, 8278718], [8278719, 8870055], [8870056, 9461392], [9461393, 10052729], [10052730, 10644066], [10644067, 11235403], [11235404, 11826749]] SRR7169861 file size 3985996 SRR7169861 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169861 SRR7169861_1.fastq SRR7169861_2.fastq Input file: SRR7169861_1.fastq Paired file: SRR7169861_2.fastq trimmed: SRR7169861-trimmed-pair1.fastq, SRR7169861-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:25:02 2025 >> started Tue Feb 11 23:25:15 2025 >> done (13.059s) 11826749 read pairs processed; of these: 17215 ( 0.15%) short read pairs filtered out after trimming by size control 21355 ( 0.18%) empty read pairs filtered out after trimming by size control 11788179 (99.67%) read pairs available; of these: 5190057 (44.03%) trimmed read pairs available after processing 6598122 (55.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 4 0.00% 21 2 0.00% 22 7 0.00% 23 4 0.00% 24 6 0.00% 25 6 0.00% 26 1 0.00% 27 5 0.00% 28 5 0.00% 29 3 0.00% 30 3 0.00% 31 7 0.00% 32 3 0.00% 33 6 0.00% 34 10 0.00% 35 5 0.00% 36 10 0.00% 37 12 0.00% 38 13 0.00% 39 12 0.00% 40 17 0.00% 41 9 0.00% 42 14 0.00% 43 16 0.00% 44 18 0.00% 45 20 0.00% 46 36 0.00% 47 33 0.00% 48 49 0.00% 49 39 0.00% 50 59 0.00% 51 68 0.00% 52 58 0.00% 53 96 0.00% 54 91 0.00% 55 91 0.00% 56 112 0.00% 57 102 0.00% 58 144 0.00% 59 184 0.00% 60 194 0.00% 61 197 0.00% 62 281 0.00% 63 308 0.00% 64 309 0.00% 65 357 0.00% 66 385 0.00% 67 439 0.00% 68 520 0.00% 69 578 0.00% 70 667 0.01% 71 793 0.01% 72 921 0.01% 73 1068 0.01% 74 1092 0.01% 75 1298 0.01% 76 1633 0.01% 77 1944 0.02% 78 1765 0.01% 79 1815 0.02% 80 2105 0.02% 81 2266 0.02% 82 2659 0.02% 83 2952 0.03% 84 3849 0.03% 85 4528 0.04% 86 4729 0.04% 87 4856 0.04% 88 5264 0.04% 89 5407 0.05% 90 5605 0.05% 91 5984 0.05% 92 6512 0.06% 93 6883 0.06% 94 7234 0.06% 95 7620 0.06% 96 7885 0.07% 97 7945 0.07% 98 8148 0.07% 99 8344 0.07% 100 8859 0.08% 101 9119 0.08% 102 9887 0.08% 103 10136 0.09% 104 10761 0.09% 105 11519 0.10% 106 11773 0.10% 107 11864 0.10% 108 12021 0.10% 109 12303 0.10% 110 12678 0.11% 111 13124 0.11% 112 13790 0.12% 113 14267 0.12% 114 15269 0.13% 115 15901 0.13% 116 16098 0.14% 117 16361 0.14% 118 16615 0.14% 119 17004 0.14% 120 17268 0.15% 121 17709 0.15% 122 18213 0.15% 123 19237 0.16% 124 20179 0.17% 125 20782 0.18% 126 21614 0.18% 127 22313 0.19% 128 23404 0.20% 129 23968 0.20% 130 24388 0.21% 131 25598 0.22% 132 27048 0.23% 133 28794 0.24% 134 30018 0.25% 135 32034 0.27% 136 34278 0.29% 137 36874 0.31% 138 39516 0.34% 139 42262 0.36% 140 46154 0.39% 141 50999 0.43% 142 56872 0.48% 143 64855 0.55% 144 78266 0.66% 145 95392 0.81% 146 122769 1.04% 147 170999 1.45% 148 268026 2.27% 149 552025 4.68% 150 2770132 23.50% 151 6598122 55.97% 11788179 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=41 prefix-density=0.22 prefix-fanout=2.5 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=361.24 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=23.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCAGGACCACCATTGCAAGTAGCAAAGGTTGGCAAACCACATGTCATGGCCTCAACAACAGTCAAT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.65 fanout-score-rank=35 prefix-density=0.29 prefix-fanout=2.7 sequence=GTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGGCGAGGGTATGGAGGAAGGAGAGTTCTCAGAGGCTCGTGAGGATCTTGCTGCCCTGGAGAAGGATTATGAGGAGGTTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=47 fanout-score=128.83 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=12.8 sequence=GAAAATGGAGGGCAAAGAAGAGGATGTTAAGCTCGGAGCTAACAAGTTCTCAGAAAGACAGCCTATTGGGACATCAGCTCAAACAGACAAGGATTACAAAGAGGCGCCACCGGCTCCTTTGTTTGAGCCTGGTGAACTCAAGTCATGGTCCTTTTACAGGGCTGGTATTGCTGAGTTCATAGCCACTTTCTTGTTCCTTTACATCACTGTCTTGACTGTCATGGGTGTTACTAAGCCTGGTACCAGCAAATGTTCCACTGTTGGTATTCAAGGCATTGCTTGGGCTTTTGGTGGCATGATCTTTGCCCTTGTTTACTGCACTGCTGGTATCTCAGGTGGACACATCAACCCAGCTGTGACCTTTGGGCTGTTTTTGGCAAGGAAGCTCTCTTTGACAAGGGCTGTGTTTTACATCATCATGCAGTGCCTTGGTGCAATCTGTGGTGCTGGTGTAGTGAAGGGTCTCCAAGGAAGCCACAACTACGAGCTTCAGGGTGGCGGAGCTAATGTT SRR7169861 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:26:00 Started mapping on | Feb 11 23:26:00 Finished on | Feb 11 23:27:07 Mapping speed, Million of reads per hour | 633.39 Number of input reads | 11788179 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 11029457 Uniquely mapped reads % | 93.56% Average mapped length | 294.85 Number of splices: Total | 9306171 Number of splices: Annotated (sjdb) | 9130454 Number of splices: GT/AG | 9161099 Number of splices: GC/AG | 114871 Number of splices: AT/AC | 6691 Number of splices: Non-canonical | 23510 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 217931 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 28109 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.30% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 554710 554710 554710 N_multimapping 217931 217931 217931 N_noFeature 250912 10894690 295626 N_ambiguous 139019 812 48752 UnstrandedReadsAssigned:10639526 PositiveStrandReadsAssigned:133955 NegativeStrandReadsAssigned:10685079 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169861 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169861-trimmed-pair1.fastq SRR7169861-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,788,179 reads, 10,641,492 reads pseudoaligned [quant] estimated average fragment length: 272.698 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52401 SRR7169861.ke.tsv 34699 SRR7169861.se.tsv 87100 total ==> SRR7169861.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.3 198 9.36668 Potri.005G024800.1.v4.1 1035 763.302 58 6.27728 Potri.004G059700.1.v4.1 961 689.322 1 0.119844 Potri.007G009000.2.v4.1 1416 1144.3 0 0 Potri.003G141000.2.v4.1 2943 2671.3 228.104 7.05423 Potri.016G087400.1.v4.1 270 74.0079 1226 1368.52 Potri.015G069301.1.v4.1 564 296.776 0 0 Potri.010G195200.1.v4.1 1773 1501.3 69 3.79683 Potri.012G127500.1.v4.1 977 705.317 5439 637.051 ==> SRR7169861.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1563 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 382 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169861 completed mapping pipeline successfully