Starting /dee2/code/volunteer_pipeline.sh SRR7169862 current disk space = 3052129943552 free memory = 1499140412 SRR7169862 SRAfilesize 2f5c0b00e858313d6c699b396aa14b05 SRR7169862.sra SRR7169862.sra file validated SRR7169862 is paired end SRR7169862 is conventional basespace SRR7169862 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169862_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.789 27.0 18.0 33.0 18.0 33.0 2 28.95025 30.0 28.0 31.0 18.0 33.0 3 31.9205 33.0 31.0 33.0 29.0 33.0 4 32.53175 33.0 33.0 33.0 31.0 34.0 5 33.08675 33.0 33.0 34.0 33.0 34.0 6 37.116 38.0 37.0 38.0 36.0 38.0 7 36.206 38.0 37.0 38.0 33.0 38.0 8 37.138 38.0 38.0 38.0 36.0 38.0 9 37.54375 38.0 38.0 38.0 37.0 38.0 10-14 37.605 38.0 38.0 38.0 38.0 38.0 15-19 37.62429999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.590999999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.57015 38.0 38.0 38.0 38.0 38.0 30-34 37.5163 38.0 38.0 38.0 38.0 38.0 35-39 37.45885 38.0 38.0 38.0 37.0 38.0 40-44 37.41915 38.0 38.0 38.0 37.0 38.0 45-49 37.4439 38.0 38.0 38.0 37.6 38.0 50-54 37.1383 38.0 38.0 38.0 36.2 38.0 55-59 36.9901 38.0 38.0 38.0 35.8 38.0 60-64 37.107000000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.646699999999996 38.0 37.6 38.0 34.0 38.0 70-74 36.9321 38.0 38.0 38.0 35.6 38.0 75-79 36.982150000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.912850000000006 38.0 38.0 38.0 35.4 38.0 85-89 36.70625 38.0 38.0 38.0 34.8 38.0 90-94 35.382600000000004 38.0 36.0 38.0 29.2 38.0 95-99 36.17545 38.0 37.0 38.0 33.0 38.0 100-104 35.34195 38.0 36.2 38.0 29.2 38.0 105-109 35.694599999999994 38.0 36.2 38.0 29.4 38.0 110-114 34.8688 38.0 35.2 38.0 26.6 38.0 115-119 34.93655 38.0 35.2 38.0 26.2 38.0 120-124 34.21505 38.0 33.6 38.0 24.6 38.0 125-129 34.531349999999996 38.0 35.2 38.0 23.8 38.0 130-134 34.84895 38.0 34.8 38.0 27.6 38.0 135-139 34.206149999999994 38.0 34.4 38.0 24.2 38.0 140-144 33.3671 37.6 33.0 38.0 21.2 38.0 145-149 32.9341 37.6 33.6 38.0 19.6 38.0 150-151 29.849874999999997 36.0 27.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 2.0 14 0.0 15 0.0 16 1.0 17 8.0 18 7.0 19 3.0 20 1.0 21 4.0 22 5.0 23 6.0 24 11.0 25 11.0 26 10.0 27 26.0 28 25.0 29 29.0 30 37.0 31 59.0 32 82.0 33 116.0 34 249.0 35 499.0 36 1310.0 37 1498.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.15 11.575000000000001 9.225 35.05 2 22.71703777833375 13.985489116837629 34.42581936452339 28.87165374030523 3 18.85 20.150000000000002 26.650000000000002 34.35 4 23.225 28.050000000000004 23.575 25.15 5 24.6 31.724999999999998 23.7 19.975 6 19.55 36.7 24.05 19.7 7 15.075 26.200000000000003 40.550000000000004 18.175 8 17.7 26.474999999999998 30.4 25.424999999999997 9 17.7 25.074999999999996 33.074999999999996 24.15 10-14 20.02 30.18 27.105 22.695 15-19 20.135 29.04 27.76 23.064999999999998 20-24 19.73 28.904999999999998 27.915 23.45 25-29 20.330000000000002 28.939999999999998 27.485 23.244999999999997 30-34 20.385 29.325000000000003 27.450000000000003 22.84 35-39 20.84 28.68 27.345000000000002 23.135 40-44 19.78 29.215000000000003 27.74 23.265 45-49 21.085 28.49 27.605 22.82 50-54 20.45 29.354999999999997 27.095000000000002 23.1 55-59 20.695 29.015 27.134999999999998 23.155 60-64 20.669999999999998 28.349999999999998 27.405 23.575 65-69 20.34 28.765 27.755000000000003 23.14 70-74 20.794999999999998 28.625 27.52 23.06 75-79 20.68 28.444999999999997 26.935 23.94 80-84 20.72 28.51 27.13 23.64 85-89 20.82 28.560000000000002 27.175 23.445 90-94 20.145 29.34 27.21 23.305 95-99 20.880000000000003 28.51 27.02 23.59 100-104 20.549999999999997 28.645 27.22 23.585 105-109 20.560000000000002 28.51 27.625 23.305 110-114 20.560000000000002 28.27 27.634999999999998 23.535 115-119 21.361314234198137 28.413302614444557 27.166182510267454 23.059200641089852 120-124 20.937797127558426 28.158935094830607 27.063003553020064 23.8402642245909 125-129 21.29 28.575 26.51 23.625 130-134 20.09 28.485 27.365000000000002 24.060000000000002 135-139 20.61 28.194999999999997 27.46 23.735 140-144 20.838335334133653 28.326330532212886 27.030812324929972 23.80452180872349 145-149 20.849999999999998 28.73 26.584999999999997 23.835 150-151 19.775000000000002 28.799999999999997 26.575 24.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 2.0 25 3.5 26 5.0 27 5.5 28 6.0 29 11.0 30 17.5 31 24.5 32 34.0 33 44.5 34 55.5 35 67.0 36 81.5 37 102.0 38 128.5 39 149.0 40 182.0 41 234.0 42 254.0 43 261.5 44 268.5 45 270.5 46 266.0 47 245.5 48 239.5 49 225.5 50 187.0 51 146.5 52 124.5 53 102.5 54 71.5 55 50.5 56 31.5 57 18.5 58 13.5 59 13.0 60 14.5 61 10.5 62 7.0 63 5.0 64 2.5 65 2.5 66 3.0 67 2.5 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.16999999999999998 120-124 0.08499999999999999 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.04 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.7125 0.0 0.0 0.0 0.0 106-107 0.9750000000000001 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.4249999999999998 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.3375000000000004 0.0 0.0 0.0 0.0 124-125 2.4 0.0 0.0 0.0 0.0 126-127 2.55 0.0 0.0 0.0 0.0 128-129 2.7875 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.55 0.0 0.0 0.0 0.0 136-137 3.8 0.0 0.0 0.0 0.0 138-139 4.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGGGGT 10 0.006846698 144.88751 3 GGGGGTT 10 0.006846698 144.88751 4 >>END_MODULE SRR7169862 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169862_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.253 34.0 33.0 34.0 33.0 34.0 2 33.32325 34.0 33.0 34.0 33.0 34.0 3 33.3805 34.0 33.0 34.0 33.0 34.0 4 33.35075 34.0 33.0 34.0 33.0 34.0 5 33.34775 34.0 33.0 34.0 33.0 34.0 6 37.5295 38.0 38.0 38.0 38.0 38.0 7 37.54225 38.0 38.0 38.0 38.0 38.0 8 37.4675 38.0 38.0 38.0 38.0 38.0 9 37.53275 38.0 38.0 38.0 38.0 38.0 10-14 37.412800000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.4482 38.0 38.0 38.0 38.0 38.0 20-24 37.114549999999994 38.0 38.0 38.0 36.4 38.0 25-29 36.095299999999995 38.0 37.6 38.0 31.4 38.0 30-34 37.216899999999995 38.0 38.0 38.0 36.6 38.0 35-39 37.382400000000004 38.0 38.0 38.0 37.4 38.0 40-44 37.174099999999996 38.0 38.0 38.0 36.8 38.0 45-49 37.292449999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.06875 38.0 38.0 38.0 36.0 38.0 55-59 37.2943 38.0 38.0 38.0 37.0 38.0 60-64 37.1973 38.0 38.0 38.0 37.0 38.0 65-69 37.163149999999995 38.0 38.0 38.0 36.8 38.0 70-74 37.195100000000004 38.0 38.0 38.0 37.0 38.0 75-79 37.14255000000001 38.0 38.0 38.0 36.4 38.0 80-84 37.0816 38.0 38.0 38.0 36.4 38.0 85-89 36.86125 38.0 38.0 38.0 35.6 38.0 90-94 37.0125 38.0 38.0 38.0 36.0 38.0 95-99 36.9281 38.0 38.0 38.0 36.0 38.0 100-104 36.738150000000005 38.0 38.0 38.0 35.0 38.0 105-109 36.57935 38.0 38.0 38.0 34.6 38.0 110-114 36.59005 38.0 38.0 38.0 34.4 38.0 115-119 36.40984999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.23105 38.0 38.0 38.0 34.0 38.0 125-129 36.0156 38.0 37.4 38.0 33.2 38.0 130-134 35.78615 38.0 36.8 38.0 33.0 38.0 135-139 34.97305 38.0 35.8 38.0 29.0 38.0 140-144 34.9384 38.0 35.4 38.0 28.6 38.0 145-149 34.179050000000004 38.0 35.2 38.0 25.0 38.0 150-151 30.542250000000003 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 1.0 13 0.0 14 1.0 15 1.0 16 4.0 17 4.0 18 3.0 19 6.0 20 6.0 21 3.0 22 1.0 23 6.0 24 8.0 25 6.0 26 10.0 27 22.0 28 21.0 29 18.0 30 27.0 31 43.0 32 62.0 33 88.0 34 128.0 35 210.0 36 621.0 37 2694.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.775 21.25 14.249999999999998 26.724999999999998 2 26.150000000000002 26.75 29.175 17.925 3 20.025000000000002 28.325 31.35 20.3 4 22.930732683170792 34.28357089272318 23.680920230057513 19.10477619404851 5 24.056014003500874 35.108777194298575 21.73043260815204 19.10477619404851 6 20.4 36.1 24.85 18.65 7 18.975 22.025 39.5 19.5 8 20.4 25.1 28.125 26.375 9 21.975 25.05 29.675 23.3 10-14 22.68 28.915000000000003 26.655 21.75 15-19 22.755 28.144999999999996 27.465 21.634999999999998 20-24 22.025 28.08 28.199999999999996 21.695 25-29 23.01 27.96 27.92 21.11 30-34 22.32 27.755000000000003 28.384999999999998 21.54 35-39 22.62 28.084999999999997 28.315 20.979999999999997 40-44 22.255 27.765 28.815 21.165 45-49 22.919999999999998 28.305000000000003 27.465 21.310000000000002 50-54 22.165000000000003 28.275 28.144999999999996 21.415 55-59 23.064999999999998 27.915 28.22 20.8 60-64 22.45 28.244999999999997 27.834999999999997 21.47 65-69 22.759999999999998 27.685 28.23 21.325 70-74 23.09 27.27 28.720000000000002 20.919999999999998 75-79 22.73 27.68 28.345 21.245 80-84 23.119999999999997 28.16 28.139999999999997 20.580000000000002 85-89 23.23 27.735 28.345 20.69 90-94 23.16 27.750000000000004 28.405 20.685000000000002 95-99 22.79 27.445000000000004 28.58 21.185000000000002 100-104 23.805 27.529999999999998 28.03 20.635 105-109 23.415 27.57 28.055000000000003 20.96 110-114 24.165 27.93 27.534999999999997 20.369999999999997 115-119 24.07 28.04 27.6 20.29 120-124 24.275 28.345 26.950000000000003 20.43 125-129 23.95 27.855 27.834999999999997 20.36 130-134 24.135 27.474999999999998 27.52 20.87 135-139 24.124124124124123 27.942942942942945 27.767767767767772 20.165165165165167 140-144 23.669999999999998 27.805000000000003 27.735 20.79 145-149 24.48 28.035 27.29 20.195 150-151 24.3125 28.1875 27.675 19.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 1.0 26 2.5 27 4.5 28 7.5 29 8.5 30 8.5 31 14.5 32 23.5 33 33.0 34 43.0 35 55.5 36 77.0 37 106.0 38 142.0 39 182.5 40 209.0 41 241.5 42 273.5 43 272.0 44 282.0 45 287.0 46 284.5 47 284.5 48 239.0 49 195.5 50 173.5 51 145.5 52 113.0 53 81.5 54 56.5 55 44.0 56 36.5 57 18.5 58 12.0 59 10.0 60 5.0 61 5.5 62 5.0 63 5.0 64 2.5 65 1.0 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.1 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.675 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.5875000000000004 0.0 0.0 0.0 0.0 124-125 2.6625 0.0 0.0 0.0 0.0 126-127 2.8499999999999996 0.0 0.0 0.0 0.0 128-129 3.0875 0.0 0.0 0.0 0.0 130-131 3.2375 0.0 0.0 0.0 0.0 132-133 3.5375 0.0 0.0 0.0 0.0 134-135 3.85 0.0 0.0 0.0 0.0 136-137 4.15 0.0 0.0 0.0 0.0 138-139 4.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTCCA 10 0.006843168 144.91249 1 >>END_MODULE Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586753 spots for SRR7169862.sra Written 586753 spots for SRR7169862.sra Read 586763 spots for SRR7169862.sra Written 586763 spots for SRR7169862.sra SRR ids: ['SRR7169862.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_68889q3p SRR7169862.sra spots: 11735070 blocks: [[1, 586753], [586754, 1173506], [1173507, 1760259], [1760260, 2347012], [2347013, 2933765], [2933766, 3520518], [3520519, 4107271], [4107272, 4694024], [4694025, 5280777], [5280778, 5867530], [5867531, 6454283], [6454284, 7041036], [7041037, 7627789], [7627790, 8214542], [8214543, 8801295], [8801296, 9388048], [9388049, 9974801], [9974802, 10561554], [10561555, 11148307], [11148308, 11735070]] SRR7169862 file size 3954929 SRR7169862 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169862 SRR7169862_1.fastq SRR7169862_2.fastq Input file: SRR7169862_1.fastq Paired file: SRR7169862_2.fastq trimmed: SRR7169862-trimmed-pair1.fastq, SRR7169862-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:38:07 2025 >> started Tue Feb 11 23:38:20 2025 >> done (12.853s) 11735070 read pairs processed; of these: 8844 ( 0.08%) short read pairs filtered out after trimming by size control 8397 ( 0.07%) empty read pairs filtered out after trimming by size control 11717829 (99.85%) read pairs available; of these: 5023250 (42.87%) trimmed read pairs available after processing 6694579 (57.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 3 0.00% 22 3 0.00% 23 3 0.00% 24 0 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 2 0.00% 29 4 0.00% 30 3 0.00% 31 3 0.00% 32 3 0.00% 33 5 0.00% 34 2 0.00% 35 8 0.00% 36 5 0.00% 37 4 0.00% 38 6 0.00% 39 5 0.00% 40 9 0.00% 41 10 0.00% 42 18 0.00% 43 17 0.00% 44 22 0.00% 45 19 0.00% 46 16 0.00% 47 26 0.00% 48 26 0.00% 49 34 0.00% 50 43 0.00% 51 47 0.00% 52 60 0.00% 53 65 0.00% 54 83 0.00% 55 79 0.00% 56 76 0.00% 57 111 0.00% 58 137 0.00% 59 151 0.00% 60 207 0.00% 61 199 0.00% 62 219 0.00% 63 294 0.00% 64 303 0.00% 65 326 0.00% 66 354 0.00% 67 429 0.00% 68 459 0.00% 69 524 0.00% 70 607 0.01% 71 667 0.01% 72 809 0.01% 73 947 0.01% 74 1096 0.01% 75 1083 0.01% 76 1289 0.01% 77 1410 0.01% 78 1513 0.01% 79 1554 0.01% 80 1784 0.02% 81 2003 0.02% 82 2288 0.02% 83 2757 0.02% 84 3229 0.03% 85 3763 0.03% 86 3909 0.03% 87 4209 0.04% 88 4401 0.04% 89 4523 0.04% 90 4802 0.04% 91 5258 0.04% 92 5683 0.05% 93 6148 0.05% 94 6358 0.05% 95 6691 0.06% 96 7110 0.06% 97 7143 0.06% 98 7310 0.06% 99 7645 0.07% 100 7872 0.07% 101 8303 0.07% 102 8626 0.07% 103 9382 0.08% 104 9671 0.08% 105 10526 0.09% 106 10570 0.09% 107 10692 0.09% 108 10935 0.09% 109 11398 0.10% 110 11519 0.10% 111 12020 0.10% 112 12414 0.11% 113 12970 0.11% 114 13666 0.12% 115 14290 0.12% 116 14580 0.12% 117 15100 0.13% 118 15283 0.13% 119 15389 0.13% 120 15711 0.13% 121 16018 0.14% 122 16628 0.14% 123 17381 0.15% 124 18425 0.16% 125 19145 0.16% 126 20047 0.17% 127 20657 0.18% 128 21676 0.18% 129 22296 0.19% 130 23430 0.20% 131 24238 0.21% 132 25882 0.22% 133 27220 0.23% 134 29136 0.25% 135 30673 0.26% 136 32225 0.28% 137 34678 0.30% 138 37299 0.32% 139 40547 0.35% 140 43772 0.37% 141 48209 0.41% 142 54869 0.47% 143 62555 0.53% 144 74832 0.64% 145 92630 0.79% 146 119285 1.02% 147 165605 1.41% 148 257843 2.20% 149 528384 4.51% 150 2734324 23.33% 151 6694579 57.13% 11717829 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=35 prefix-density=0.24 prefix-fanout=2.4 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=172.94 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=13.7 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=36 prefix-density=0.33 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=38 fanout-score=117.42 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=13.9 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169862 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:39:11 Started mapping on | Feb 11 23:39:12 Finished on | Feb 11 23:40:16 Mapping speed, Million of reads per hour | 659.13 Number of input reads | 11717829 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11101306 Uniquely mapped reads % | 94.74% Average mapped length | 295.38 Number of splices: Total | 10613429 Number of splices: Annotated (sjdb) | 10441002 Number of splices: GT/AG | 10469598 Number of splices: GC/AG | 115504 Number of splices: AT/AC | 8278 Number of splices: Non-canonical | 20049 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 200393 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 30359 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.24% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 425641 425641 425641 N_multimapping 200393 200393 200393 N_noFeature 244104 10978440 290067 N_ambiguous 125509 616 48113 UnstrandedReadsAssigned:10731693 PositiveStrandReadsAssigned:122250 NegativeStrandReadsAssigned:10763126 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169862 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169862-trimmed-pair1.fastq SRR7169862-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,717,829 reads, 10,694,273 reads pseudoaligned [quant] estimated average fragment length: 284.519 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR7169862.ke.tsv 34699 SRR7169862.se.tsv 87100 total ==> SRR7169862.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1734.48 182 10.0922 Potri.005G024800.1.v4.1 1035 751.481 19 2.43176 Potri.004G059700.1.v4.1 961 677.547 0 0 Potri.007G009000.2.v4.1 1416 1132.48 0 0 Potri.003G141000.2.v4.1 2943 2659.48 205.063 7.4161 Potri.016G087400.1.v4.1 270 75.6902 1145 1454.96 Potri.015G069301.1.v4.1 564 289.26 0 0 Potri.010G195200.1.v4.1 1773 1489.48 11 0.710302 Potri.012G127500.1.v4.1 977 693.511 2715 376.532 ==> SRR7169862.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1227 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 150 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169862 completed mapping pipeline successfully