Starting /dee2/code/volunteer_pipeline.sh SRR7169863 current disk space = 3052012335104 free memory = 1503457608 SRR7169863 SRAfilesize 50a195b633847c63489dd3b688723779 SRR7169863.sra SRR7169863.sra file validated SRR7169863 is paired end SRR7169863 is conventional basespace SRR7169863 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169863_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.12075 32.0 25.0 33.0 18.0 33.0 2 27.40425 29.0 25.0 31.0 18.0 33.0 3 30.433 31.0 29.0 33.0 27.0 33.0 4 32.138 33.0 31.0 33.0 30.0 33.0 5 32.706 33.0 33.0 33.0 32.0 34.0 6 36.8895 38.0 37.0 38.0 35.0 38.0 7 36.2025 38.0 37.0 38.0 33.0 38.0 8 37.33975 38.0 38.0 38.0 36.0 38.0 9 37.579 38.0 38.0 38.0 37.0 38.0 10-14 37.67375 38.0 38.0 38.0 38.0 38.0 15-19 37.6927 38.0 38.0 38.0 38.0 38.0 20-24 37.6007 38.0 38.0 38.0 37.8 38.0 25-29 37.67405 38.0 38.0 38.0 38.0 38.0 30-34 37.632799999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.638549999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.5205 38.0 38.0 38.0 37.4 38.0 45-49 37.56935 38.0 38.0 38.0 38.0 38.0 50-54 37.47455 38.0 38.0 38.0 37.4 38.0 55-59 37.3848 38.0 38.0 38.0 37.0 38.0 60-64 37.348400000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.28985 38.0 38.0 38.0 36.8 38.0 70-74 37.2647 38.0 38.0 38.0 36.6 38.0 75-79 37.2029 38.0 38.0 38.0 36.0 38.0 80-84 37.129999999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.8355 38.0 38.0 38.0 35.2 38.0 90-94 36.6395 38.0 37.8 38.0 34.4 38.0 95-99 36.6216 38.0 37.8 38.0 34.6 38.0 100-104 35.6725 38.0 36.6 38.0 30.2 38.0 105-109 36.38584999999999 38.0 37.2 38.0 33.6 38.0 110-114 36.3837 38.0 37.8 38.0 34.0 38.0 115-119 35.8756 38.0 36.6 38.0 32.0 38.0 120-124 35.06935 38.0 35.0 38.0 27.6 38.0 125-129 35.57099999999999 38.0 36.0 38.0 31.0 38.0 130-134 34.37275 38.0 34.6 38.0 24.8 38.0 135-139 35.09035 38.0 35.0 38.0 29.2 38.0 140-144 34.094 38.0 34.6 38.0 23.2 38.0 145-149 32.9379 37.2 32.4 38.0 20.8 38.0 150-151 29.213125 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 2.0 13 0.0 14 1.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 2.0 22 7.0 23 6.0 24 3.0 25 4.0 26 10.0 27 11.0 28 24.0 29 20.0 30 40.0 31 28.0 32 65.0 33 102.0 34 182.0 35 413.0 36 1205.0 37 1869.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.7 11.4 10.15 33.75 2 23.980995248812203 15.103775943985998 33.9584896224056 26.9567391847962 3 20.549999999999997 20.05 26.25 33.15 4 22.625 28.775000000000002 24.349999999999998 24.25 5 23.025000000000002 31.15 25.7 20.125 6 19.725 36.125 24.275 19.875 7 15.075 26.55 41.6 16.775000000000002 8 20.225 25.624999999999996 30.0 24.15 9 17.95 25.324999999999996 32.85 23.875 10-14 20.080000000000002 30.09 26.86 22.97 15-19 20.075000000000003 29.345 27.534999999999997 23.044999999999998 20-24 20.625 29.15 27.095000000000002 23.13 25-29 20.285 28.904999999999998 27.605 23.205000000000002 30-34 20.595 28.645 27.445000000000004 23.315 35-39 20.26 29.035 27.505000000000003 23.200000000000003 40-44 20.565 27.755000000000003 28.015 23.665 45-49 20.645 29.225 26.810000000000002 23.32 50-54 20.585 29.2 26.44 23.775 55-59 20.43 28.27 27.515 23.785 60-64 20.380000000000003 28.549999999999997 27.015 24.055 65-69 20.32 28.34 27.6 23.74 70-74 20.49 28.515 27.175 23.82 75-79 20.405 28.79 27.415 23.39 80-84 20.615 27.944999999999997 27.455000000000002 23.985 85-89 20.765 28.794999999999998 27.18 23.26 90-94 20.865000000000002 29.09 26.834999999999997 23.21 95-99 20.685000000000002 28.384999999999998 27.295 23.635 100-104 21.32 28.115000000000002 27.155 23.41 105-109 20.895 27.689999999999998 27.32 24.095 110-114 21.115000000000002 28.59 27.115000000000002 23.18 115-119 21.63 28.48 27.675 22.215 120-124 21.34 28.255000000000003 27.134999999999998 23.27 125-129 21.065 28.694999999999997 26.735 23.505000000000003 130-134 20.925 28.410000000000004 27.295 23.369999999999997 135-139 20.560000000000002 28.08 27.555000000000003 23.805 140-144 21.665 27.22 27.785 23.330000000000002 145-149 21.545 27.755000000000003 27.215 23.485 150-151 20.7375 27.35 27.375 24.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 2.5 23 2.0 24 0.5 25 3.0 26 4.5 27 6.0 28 6.0 29 6.5 30 16.5 31 24.0 32 28.5 33 44.0 34 61.5 35 66.5 36 78.5 37 110.0 38 132.0 39 152.0 40 177.5 41 203.5 42 238.5 43 262.0 44 272.0 45 279.0 46 264.5 47 252.5 48 246.0 49 207.0 50 177.5 51 147.5 52 122.5 53 109.5 54 71.5 55 52.5 56 43.0 57 30.5 58 24.0 59 13.5 60 10.5 61 11.0 62 8.0 63 5.5 64 3.5 65 2.5 66 1.5 67 2.0 68 3.5 69 3.5 70 3.5 71 1.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.7875000000000001 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.0750000000000002 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.4249999999999998 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 1.95 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.2874999999999996 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.625 0.0 0.0 0.0 0.0 124-125 2.825 0.0 0.0 0.0 0.0 126-127 2.95 0.0 0.0 0.0 0.0 128-129 3.1 0.0 0.0 0.0 0.0 130-131 3.3 0.0 0.0 0.0 0.0 132-133 3.55 0.0 0.0 0.0 0.0 134-135 3.8375 0.0 0.0 0.0 0.0 136-137 4.0125 0.0 0.0 0.0 0.0 138-139 4.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACTAT 10 0.006830828 145.0 3 GCACCTT 10 0.006830828 145.0 4 >>END_MODULE SRR7169863 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169863_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.197 34.0 33.0 34.0 33.0 34.0 2 33.2955 34.0 33.0 34.0 33.0 34.0 3 33.3145 34.0 33.0 34.0 33.0 34.0 4 33.32025 34.0 33.0 34.0 33.0 34.0 5 33.277 34.0 33.0 34.0 33.0 34.0 6 37.377 38.0 38.0 38.0 38.0 38.0 7 37.42175 38.0 38.0 38.0 38.0 38.0 8 37.41225 38.0 38.0 38.0 38.0 38.0 9 37.35925 38.0 38.0 38.0 38.0 38.0 10-14 37.42625 38.0 38.0 38.0 38.0 38.0 15-19 37.396950000000004 38.0 38.0 38.0 37.8 38.0 20-24 37.15265000000001 38.0 38.0 38.0 36.6 38.0 25-29 36.664500000000004 38.0 37.8 38.0 34.4 38.0 30-34 36.32955 38.0 37.6 38.0 32.6 38.0 35-39 37.03645 38.0 38.0 38.0 36.2 38.0 40-44 36.85695 38.0 38.0 38.0 35.6 38.0 45-49 36.95675 38.0 38.0 38.0 36.2 38.0 50-54 37.1317 38.0 38.0 38.0 36.6 38.0 55-59 37.217349999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.07449999999999 38.0 38.0 38.0 36.4 38.0 65-69 37.118700000000004 38.0 38.0 38.0 36.6 38.0 70-74 37.090250000000005 38.0 38.0 38.0 36.4 38.0 75-79 37.08109999999999 38.0 38.0 38.0 36.2 38.0 80-84 36.8897 38.0 38.0 38.0 36.0 38.0 85-89 36.8233 38.0 38.0 38.0 36.0 38.0 90-94 36.82495 38.0 38.0 38.0 35.8 38.0 95-99 36.7016 38.0 38.0 38.0 35.6 38.0 100-104 36.50115 38.0 38.0 38.0 34.4 38.0 105-109 36.51155 38.0 38.0 38.0 34.2 38.0 110-114 36.4532 38.0 38.0 38.0 34.2 38.0 115-119 36.20705 38.0 37.8 38.0 33.6 38.0 120-124 36.043 38.0 37.6 38.0 33.4 38.0 125-129 35.83979999999999 38.0 37.2 38.0 33.0 38.0 130-134 35.57995 38.0 36.4 38.0 31.4 38.0 135-139 35.25375 38.0 36.0 38.0 31.0 38.0 140-144 34.9899 38.0 36.0 38.0 28.8 38.0 145-149 34.238150000000005 38.0 35.2 38.0 25.6 38.0 150-151 30.30325 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 1.0 5 0.0 6 1.0 7 0.0 8 3.0 9 0.0 10 0.0 11 3.0 12 0.0 13 1.0 14 3.0 15 1.0 16 4.0 17 6.0 18 4.0 19 2.0 20 5.0 21 4.0 22 5.0 23 7.0 24 5.0 25 9.0 26 10.0 27 18.0 28 19.0 29 31.0 30 44.0 31 39.0 32 49.0 33 85.0 34 113.0 35 271.0 36 602.0 37 2649.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.975 20.925 14.45 27.650000000000002 2 26.456614153538382 26.63165791447862 28.95723930982746 17.95448862215554 3 21.080270067516878 28.80720180045011 30.457614403600903 19.654913728432106 4 22.930732683170792 33.48337084271068 23.730932733183295 19.854963740935233 5 23.755938984746187 34.883720930232556 23.40585146286572 17.95448862215554 6 20.525 37.8 22.95 18.725 7 20.424999999999997 21.5 37.2 20.875 8 21.575 25.474999999999998 26.775 26.174999999999997 9 21.725 25.25 28.95 24.075 10-14 23.1 29.375 26.19 21.335 15-19 22.830000000000002 27.96 27.97 21.240000000000002 20-24 22.845 28.32 27.400000000000002 21.435000000000002 25-29 23.115 28.499999999999996 27.155 21.23 30-34 23.07 27.73 27.785 21.415 35-39 22.605 28.694999999999997 27.365000000000002 21.335 40-44 22.869999999999997 27.825 28.225 21.08 45-49 23.265 27.439999999999998 27.800000000000004 21.495 50-54 23.835 28.439999999999998 27.205000000000002 20.52 55-59 23.055 27.794999999999998 27.71 21.44 60-64 23.095 27.655 27.860000000000003 21.39 65-69 23.16 28.175 27.96 20.705000000000002 70-74 23.265 28.15 27.450000000000003 21.135 75-79 23.06 27.85 28.09 21.0 80-84 23.455000000000002 27.37 27.955000000000002 21.22 85-89 23.655 27.295 27.884999999999998 21.165 90-94 23.865 28.044999999999998 27.405 20.685000000000002 95-99 23.294999999999998 28.225 27.6 20.880000000000003 100-104 24.025 27.089999999999996 28.244999999999997 20.64 105-109 23.73 27.27 28.144999999999996 20.855 110-114 23.835 27.415 27.900000000000002 20.849999999999998 115-119 23.53 27.715 27.985 20.77 120-124 23.615 28.12 27.334999999999997 20.93 125-129 23.94 27.900000000000002 27.36 20.8 130-134 24.45 27.505000000000003 27.384999999999998 20.66 135-139 23.895 27.315 27.834999999999997 20.955 140-144 23.985 27.62 27.46 20.935000000000002 145-149 24.01 27.58 27.255000000000003 21.154999999999998 150-151 24.1375 27.950000000000003 26.9625 20.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.0 27 3.5 28 5.0 29 6.0 30 8.5 31 10.0 32 13.0 33 22.0 34 46.0 35 59.5 36 67.0 37 95.5 38 128.5 39 160.0 40 197.0 41 230.0 42 257.0 43 276.0 44 296.0 45 307.0 46 300.5 47 287.0 48 241.5 49 198.0 50 175.5 51 141.0 52 109.0 53 93.0 54 74.5 55 51.0 56 36.5 57 33.0 58 25.5 59 12.0 60 5.5 61 5.5 62 3.0 63 2.0 64 4.5 65 3.5 66 1.5 67 2.0 68 1.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.0750000000000002 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.4249999999999998 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 1.9625000000000001 0.0 0.0 0.0 0.0 116-117 2.15 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.475 0.0 0.0 0.0 0.0 122-123 2.675 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.125 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.5625 0.0 0.0 0.0 0.0 134-135 3.8125 0.0 0.0 0.0 0.0 136-137 3.9875 0.0 0.0 0.0 0.0 138-139 4.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 25 4.977651E-4 29.0 15-19 >>END_MODULE Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Read 610445 spots for SRR7169863.sra Written 610445 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra Read 610439 spots for SRR7169863.sra Written 610439 spots for SRR7169863.sra SRR ids: ['SRR7169863.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_buedk5y9 SRR7169863.sra spots: 12208786 blocks: [[1, 610439], [610440, 1220878], [1220879, 1831317], [1831318, 2441756], [2441757, 3052195], [3052196, 3662634], [3662635, 4273073], [4273074, 4883512], [4883513, 5493951], [5493952, 6104390], [6104391, 6714829], [6714830, 7325268], [7325269, 7935707], [7935708, 8546146], [8546147, 9156585], [9156586, 9767024], [9767025, 10377463], [10377464, 10987902], [10987903, 11598341], [11598342, 12208786]] SRR7169863 file size 4115456 SRR7169863 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169863 SRR7169863_1.fastq SRR7169863_2.fastq Input file: SRR7169863_1.fastq Paired file: SRR7169863_2.fastq trimmed: SRR7169863-trimmed-pair1.fastq, SRR7169863-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:52:16 2025 >> started Tue Feb 11 23:52:29 2025 >> done (12.969s) 12208786 read pairs processed; of these: 10148 ( 0.08%) short read pairs filtered out after trimming by size control 9177 ( 0.08%) empty read pairs filtered out after trimming by size control 12189461 (99.84%) read pairs available; of these: 5394438 (44.25%) trimmed read pairs available after processing 6795023 (55.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 1 0.00% 21 1 0.00% 22 5 0.00% 23 5 0.00% 24 0 0.00% 25 4 0.00% 26 2 0.00% 27 5 0.00% 28 3 0.00% 29 2 0.00% 30 4 0.00% 31 4 0.00% 32 5 0.00% 33 3 0.00% 34 6 0.00% 35 7 0.00% 36 5 0.00% 37 12 0.00% 38 6 0.00% 39 5 0.00% 40 17 0.00% 41 21 0.00% 42 15 0.00% 43 17 0.00% 44 18 0.00% 45 18 0.00% 46 25 0.00% 47 37 0.00% 48 35 0.00% 49 42 0.00% 50 52 0.00% 51 64 0.00% 52 62 0.00% 53 69 0.00% 54 63 0.00% 55 82 0.00% 56 105 0.00% 57 95 0.00% 58 118 0.00% 59 158 0.00% 60 155 0.00% 61 226 0.00% 62 226 0.00% 63 265 0.00% 64 322 0.00% 65 309 0.00% 66 335 0.00% 67 400 0.00% 68 446 0.00% 69 533 0.00% 70 598 0.00% 71 633 0.01% 72 818 0.01% 73 883 0.01% 74 981 0.01% 75 1076 0.01% 76 1214 0.01% 77 1308 0.01% 78 1412 0.01% 79 1605 0.01% 80 1767 0.01% 81 1981 0.02% 82 2328 0.02% 83 2646 0.02% 84 3195 0.03% 85 3674 0.03% 86 3835 0.03% 87 4273 0.04% 88 4520 0.04% 89 4641 0.04% 90 4875 0.04% 91 5231 0.04% 92 5736 0.05% 93 6012 0.05% 94 6439 0.05% 95 6983 0.06% 96 7125 0.06% 97 7263 0.06% 98 7411 0.06% 99 7895 0.06% 100 8410 0.07% 101 8646 0.07% 102 9291 0.08% 103 9812 0.08% 104 10199 0.08% 105 10583 0.09% 106 11091 0.09% 107 11143 0.09% 108 11456 0.09% 109 11691 0.10% 110 11978 0.10% 111 12551 0.10% 112 13158 0.11% 113 14039 0.12% 114 14491 0.12% 115 15092 0.12% 116 15543 0.13% 117 15800 0.13% 118 15904 0.13% 119 16340 0.13% 120 16768 0.14% 121 17178 0.14% 122 17916 0.15% 123 19069 0.16% 124 19687 0.16% 125 20566 0.17% 126 21736 0.18% 127 22185 0.18% 128 23126 0.19% 129 23671 0.19% 130 24936 0.20% 131 25703 0.21% 132 27243 0.22% 133 29108 0.24% 134 30553 0.25% 135 33318 0.27% 136 35251 0.29% 137 38281 0.31% 138 41512 0.34% 139 44647 0.37% 140 48472 0.40% 141 53838 0.44% 142 60954 0.50% 143 69937 0.57% 144 83990 0.69% 145 104311 0.86% 146 133446 1.09% 147 184676 1.52% 148 291925 2.39% 149 594654 4.88% 150 2875780 23.59% 151 6795023 55.75% 12189461 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=39 prefix-density=0.23 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.15 sequence-density-rank=9 fanout-score=77.35 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=16.6 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=5.34 fanout-score-rank=21 prefix-density=0.38 prefix-fanout=3.6 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=45 fanout-score=125.91 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=14.3 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169863 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:53:12 Started mapping on | Feb 11 23:53:13 Finished on | Feb 11 23:54:18 Mapping speed, Million of reads per hour | 675.11 Number of input reads | 12189461 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11520400 Uniquely mapped reads % | 94.51% Average mapped length | 295.28 Number of splices: Total | 10869626 Number of splices: Annotated (sjdb) | 10698973 Number of splices: GT/AG | 10718459 Number of splices: GC/AG | 121425 Number of splices: AT/AC | 8257 Number of splices: Non-canonical | 21485 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 197618 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 40558 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.48% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 481052 481052 481052 N_multimapping 197618 197618 197618 N_noFeature 239692 11388687 287781 N_ambiguous 132677 912 48326 UnstrandedReadsAssigned:11148031 PositiveStrandReadsAssigned:130801 NegativeStrandReadsAssigned:11184293 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169863 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169863-trimmed-pair1.fastq SRR7169863-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,189,461 reads, 11,095,534 reads pseudoaligned [quant] estimated average fragment length: 281.365 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,012 rounds 52401 SRR7169863.ke.tsv 34699 SRR7169863.se.tsv 87100 total ==> SRR7169863.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.63 236 12.1971 Potri.005G024800.1.v4.1 1035 754.635 26 3.09413 Potri.004G059700.1.v4.1 961 680.663 0 0 Potri.007G009000.2.v4.1 1416 1135.63 0 0 Potri.003G141000.2.v4.1 2943 2662.63 177.083 5.97266 Potri.016G087400.1.v4.1 270 74.7499 1209 1452.51 Potri.015G069301.1.v4.1 564 292.147 0 0 Potri.010G195200.1.v4.1 1773 1492.63 9 0.54149 Potri.012G127500.1.v4.1 977 696.652 3006 387.503 ==> SRR7169863.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1115 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 203 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169863 completed mapping pipeline successfully