Starting /dee2/code/volunteer_pipeline.sh SRR7169864 current disk space = 3051670310912 free memory = 1574598980 SRR7169864 SRAfilesize c659331a93bb10f1b7bef2f7a4e9e8f4 SRR7169864.sra SRR7169864.sra file validated SRR7169864 is paired end SRR7169864 is conventional basespace SRR7169864 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169864_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.15825 31.0 25.0 32.0 18.0 33.0 2 32.01875 33.0 31.0 33.0 29.0 33.0 3 32.252 33.0 33.0 33.0 31.0 34.0 4 32.69025 33.0 33.0 34.0 31.0 34.0 5 33.332 34.0 33.0 34.0 33.0 34.0 6 37.26775 38.0 38.0 38.0 36.0 38.0 7 37.514 38.0 38.0 38.0 37.0 38.0 8 37.582 38.0 38.0 38.0 38.0 38.0 9 37.64875 38.0 38.0 38.0 38.0 38.0 10-14 37.645399999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.65805 38.0 38.0 38.0 38.0 38.0 20-24 37.61195 38.0 38.0 38.0 38.0 38.0 25-29 37.5714 38.0 38.0 38.0 38.0 38.0 30-34 37.57635 38.0 38.0 38.0 38.0 38.0 35-39 37.56145 38.0 38.0 38.0 38.0 38.0 40-44 37.50875 38.0 38.0 38.0 37.8 38.0 45-49 37.49295 38.0 38.0 38.0 37.8 38.0 50-54 37.383849999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.28325 38.0 38.0 38.0 36.8 38.0 60-64 37.22275 38.0 38.0 38.0 36.8 38.0 65-69 37.188950000000006 38.0 38.0 38.0 36.8 38.0 70-74 37.1081 38.0 38.0 38.0 36.0 38.0 75-79 36.9944 38.0 38.0 38.0 36.0 38.0 80-84 36.934400000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.877500000000005 38.0 38.0 38.0 35.8 38.0 90-94 36.76435 38.0 38.0 38.0 35.2 38.0 95-99 36.58415 38.0 38.0 38.0 34.6 38.0 100-104 36.4587 38.0 38.0 38.0 34.2 38.0 105-109 36.20195 38.0 38.0 38.0 33.8 38.0 110-114 36.13905 38.0 37.8 38.0 33.8 38.0 115-119 35.9851 38.0 37.4 38.0 33.6 38.0 120-124 35.66155 38.0 37.0 38.0 31.6 38.0 125-129 35.24059999999999 38.0 36.2 38.0 29.6 38.0 130-134 35.1366 38.0 36.0 38.0 29.6 38.0 135-139 35.012100000000004 38.0 36.0 38.0 29.0 38.0 140-144 34.5237 38.0 35.0 38.0 27.4 38.0 145-149 34.155899999999995 38.0 35.0 38.0 25.2 38.0 150-151 30.731624999999998 36.5 31.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 4.0 16 3.0 17 1.0 18 5.0 19 11.0 20 5.0 21 2.0 22 5.0 23 10.0 24 5.0 25 19.0 26 12.0 27 16.0 28 24.0 29 21.0 30 39.0 31 42.0 32 59.0 33 97.0 34 145.0 35 229.0 36 617.0 37 2627.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.95943204868154 11.511156186612576 10.927991886409737 37.60141987829614 2 21.375 14.05 33.800000000000004 30.775000000000002 3 20.175 17.05 25.124999999999996 37.65 4 21.65 25.874999999999996 23.0 29.475 5 23.799999999999997 30.349999999999998 23.425 22.425 6 20.325 34.075 24.025 21.575 7 14.35 28.299999999999997 39.375 17.974999999999998 8 17.8 26.900000000000002 31.35 23.95 9 16.950000000000003 26.375 33.35 23.325000000000003 10-14 19.63 30.825000000000003 26.69 22.855 15-19 19.255 29.525000000000002 27.63 23.59 20-24 18.83 29.82 27.455000000000002 23.895 25-29 19.155 29.75 26.915 24.18 30-34 19.17 29.64 27.450000000000003 23.74 35-39 19.665 29.425 27.3 23.61 40-44 19.7 29.189999999999998 27.560000000000002 23.549999999999997 45-49 20.07 28.994999999999997 26.740000000000002 24.195 50-54 19.81 29.115000000000002 27.175 23.9 55-59 19.55 29.525000000000002 27.36 23.565 60-64 19.665 28.904999999999998 27.12 24.310000000000002 65-69 19.655 28.849999999999998 27.189999999999998 24.305 70-74 19.755 29.215000000000003 27.26 23.77 75-79 20.005 28.610000000000003 27.279999999999998 24.104999999999997 80-84 19.73 28.965000000000003 26.715 24.59 85-89 19.61 29.005 27.195000000000004 24.19 90-94 20.28 28.57 26.87 24.279999999999998 95-99 19.939999999999998 28.365000000000002 26.945000000000004 24.75 100-104 20.27 28.77 26.619999999999997 24.34 105-109 19.89 28.799999999999997 26.724999999999998 24.585 110-114 20.4 27.855 27.58 24.165 115-119 21.08 28.925 26.369999999999997 23.625 120-124 21.195 28.27 26.534999999999997 24.0 125-129 20.810000000000002 27.939999999999998 26.945000000000004 24.305 130-134 21.275 28.22 26.365 24.14 135-139 20.674999999999997 28.249999999999996 26.52 24.555 140-144 21.235 27.815 26.369999999999997 24.58 145-149 21.025 28.255000000000003 26.705000000000002 24.015 150-151 21.0125 28.349999999999998 25.025 25.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 2.5 24 3.5 25 3.5 26 3.5 27 10.5 28 15.5 29 16.5 30 22.5 31 29.5 32 38.5 33 49.5 34 70.5 35 83.5 36 88.0 37 95.5 38 117.0 39 154.5 40 188.5 41 209.5 42 234.0 43 252.0 44 266.5 45 282.5 46 255.5 47 234.5 48 222.5 49 187.5 50 161.0 51 145.0 52 119.5 53 99.0 54 81.5 55 58.5 56 43.0 57 35.0 58 31.5 59 25.0 60 14.5 61 9.0 62 7.5 63 7.0 64 6.0 65 2.5 66 1.5 67 1.5 68 1.0 69 1.5 70 1.5 71 2.0 72 1.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85844748858447 97.425 2 0.989345509893455 1.95 3 0.10147133434804667 0.3 4 0.025367833587011668 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025367833587011668 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 7 (97% over 38bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.6499999999999999 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 1.0625 0.0 0.0 0.0 0.0 94-95 1.2375 0.0 0.0 0.0 0.0 96-97 1.45 0.0 0.0 0.0 0.0 98-99 1.7374999999999998 0.0 0.0 0.0 0.0 100-101 1.9375 0.0 0.0 0.0 0.0 102-103 2.1625 0.0 0.0 0.0 0.0 104-105 2.5 0.0 0.0 0.0 0.0 106-107 2.8125 0.0 0.0 0.0 0.0 108-109 3.1624999999999996 0.0 0.0 0.0 0.0 110-111 3.625 0.0 0.0 0.0 0.0 112-113 4.0 0.0 0.0 0.0 0.0 114-115 4.45 0.0 0.0 0.0 0.0 116-117 4.8375 0.0 0.0 0.0 0.0 118-119 5.3 0.0 0.0 0.0 0.0 120-121 5.75 0.0 0.0 0.0 0.0 122-123 6.2125 0.0 0.0 0.0 0.0 124-125 6.8375 0.0 0.0 0.0 0.0 126-127 7.387499999999999 0.0 0.0 0.0 0.0 128-129 7.8 0.0 0.0 0.0 0.0 130-131 8.375 0.0 0.0 0.0 0.0 132-133 8.9875 0.0 0.0 0.0 0.0 134-135 9.65 0.0 0.0 0.0 0.0 136-137 10.325 0.0 0.0 0.0 0.0 138-139 11.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 40 0.0076550315 18.125 105-109 AAAAAAA 80 0.0020131238 12.6875 90-94 >>END_MODULE SRR7169864 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169864_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81125 33.0 33.0 34.0 32.0 34.0 2 32.94525 34.0 33.0 34.0 32.0 34.0 3 32.92225 34.0 33.0 34.0 33.0 34.0 4 32.8575 34.0 33.0 34.0 33.0 34.0 5 32.8705 34.0 33.0 34.0 33.0 34.0 6 37.0965 38.0 38.0 38.0 37.0 38.0 7 37.12725 38.0 38.0 38.0 37.0 38.0 8 37.10825 38.0 38.0 38.0 37.0 38.0 9 37.12525 38.0 38.0 38.0 38.0 38.0 10-14 37.07869999999999 38.0 38.0 38.0 37.2 38.0 15-19 37.0627 38.0 38.0 38.0 37.2 38.0 20-24 37.0634 38.0 38.0 38.0 37.4 38.0 25-29 37.05115 38.0 38.0 38.0 37.6 38.0 30-34 37.01285 38.0 38.0 38.0 37.0 38.0 35-39 36.98095 38.0 38.0 38.0 37.0 38.0 40-44 36.89919999999999 38.0 38.0 38.0 37.0 38.0 45-49 36.9146 38.0 38.0 38.0 37.0 38.0 50-54 36.9442 38.0 38.0 38.0 37.0 38.0 55-59 36.889599999999994 38.0 38.0 38.0 37.0 38.0 60-64 36.8175 38.0 38.0 38.0 36.8 38.0 65-69 36.676300000000005 38.0 38.0 38.0 36.2 38.0 70-74 36.6485 38.0 38.0 38.0 36.0 38.0 75-79 36.57695 38.0 38.0 38.0 36.0 38.0 80-84 36.527100000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.420300000000005 38.0 38.0 38.0 36.0 38.0 90-94 36.310950000000005 38.0 38.0 38.0 35.0 38.0 95-99 36.23905 38.0 38.0 38.0 35.0 38.0 100-104 36.1923 38.0 38.0 38.0 34.8 38.0 105-109 36.0292 38.0 38.0 38.0 34.2 38.0 110-114 35.925799999999995 38.0 38.0 38.0 34.0 38.0 115-119 35.74565 38.0 38.0 38.0 33.8 38.0 120-124 35.5519 38.0 38.0 38.0 33.0 38.0 125-129 35.3739 38.0 37.6 38.0 31.8 38.0 130-134 35.09765 38.0 37.0 38.0 31.0 38.0 135-139 34.8026 38.0 36.0 38.0 29.0 38.0 140-144 34.48005 38.0 36.0 38.0 27.8 38.0 145-149 33.76905000000001 38.0 35.2 38.0 21.6 38.0 150-151 29.764499999999998 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 9.0 4 6.0 5 1.0 6 1.0 7 1.0 8 1.0 9 0.0 10 2.0 11 4.0 12 1.0 13 7.0 14 5.0 15 3.0 16 2.0 17 5.0 18 8.0 19 8.0 20 10.0 21 6.0 22 4.0 23 8.0 24 6.0 25 16.0 26 11.0 27 18.0 28 21.0 29 25.0 30 32.0 31 41.0 32 41.0 33 65.0 34 99.0 35 181.0 36 425.0 37 2897.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.86286286286286 20.07007007007007 15.74074074074074 26.326326326326328 2 28.689967312044256 25.094292180035204 27.75961780236359 18.45612270555695 3 22.881569021875787 27.307015338194617 29.69575056575308 20.115665074176516 4 25.226586102719033 32.15005035246727 22.331319234642496 20.2920443101712 5 25.050352467270898 36.20342396777442 20.619335347432024 18.12688821752266 6 22.2473604826546 38.63750628456511 21.644042232277528 17.471091000502764 7 22.01005025125628 20.954773869346734 37.63819095477387 19.396984924623116 8 22.462311557788944 25.92964824120603 28.216080402010054 23.391959798994975 9 23.17747611865259 26.018099547511316 29.260935143288087 21.543489190548016 10-14 24.147113500477317 29.191579158920767 25.749886951715823 20.9114203888861 15-19 24.430818716389403 27.70266874403176 27.335779263205506 20.530733276373322 20-24 24.297703402181014 27.689833659982916 27.016432986582238 20.99602995125383 25-29 24.04382570236719 27.918781725888326 27.4865557621752 20.55083680956928 30-34 24.425792833090416 27.62728049454692 27.6825652108358 20.264361461526864 35-39 24.075190993164455 27.291917973462006 27.45275432247688 21.18013671089666 40-44 24.610435307127776 27.681713079320396 27.500753996179757 20.20709761737207 45-49 24.35272233673521 27.967422452365394 27.424463325121916 20.255391885777488 50-54 24.126489367050425 28.711477552662007 27.17812075813182 19.98391232215575 55-59 23.839927605449702 27.18314815745815 28.243929415313456 20.732994821778693 60-64 23.621651505252046 27.969040558878223 27.712720510629747 20.696587425239986 65-69 23.78199004474835 27.381969933128865 28.211574237015434 20.624465785107347 70-74 24.176597777442552 27.590888520138783 27.988132951174133 20.24438075124453 75-79 24.351237175618586 27.378797022731842 28.28404747535707 19.985918326292495 80-84 24.386441359887346 27.937034801850736 27.27821363910682 20.3983101991551 85-89 23.91249685692733 27.427709328639676 28.156902187578574 20.502891626854414 90-94 24.126137906754515 27.138761756274203 28.20499924558668 20.5301010913846 95-99 24.219103666817567 27.805442382173933 27.936220512046678 20.039233438961823 100-104 24.889358278012473 27.127338563669284 27.590022128344398 20.39328102997385 105-109 24.376257545271628 27.092555331991953 28.23943661971831 20.291750503018108 110-114 25.22137250955927 27.203662708794525 28.32058764338901 19.254377138257194 115-119 24.947167153064306 27.754855590218376 27.649189896346986 19.648787360370335 120-124 24.92699627429262 27.529956701238547 27.595408317389992 19.947638707078845 125-129 25.08684488747923 27.74505361727836 26.929466847908174 20.238634647334237 130-134 25.208983784872597 28.029005942189546 27.313928895155605 19.448081377782252 135-139 25.98690835850957 27.82477341389728 27.4773413897281 18.710976837865058 140-144 26.540785498489427 27.764350453172206 26.983887210473313 18.710976837865058 145-149 26.606567284448023 27.628928283642225 27.382151490733282 18.38235294117647 150-151 27.089627391742194 27.026686807653576 27.605740181268885 18.27794561933535 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 9.0 1 9.5 2 6.0 3 1.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.5 23 2.0 24 1.5 25 1.5 26 3.0 27 4.5 28 4.0 29 7.5 30 11.5 31 12.5 32 16.5 33 24.0 34 35.5 35 49.0 36 61.0 37 76.0 38 104.5 39 157.0 40 198.0 41 229.5 42 255.0 43 284.0 44 302.5 45 294.5 46 263.5 47 237.5 48 227.0 49 204.5 50 180.5 51 138.5 52 122.5 53 118.0 54 85.0 55 61.5 56 53.0 57 40.5 58 28.0 59 20.5 60 15.5 61 12.0 62 9.5 63 7.0 64 3.5 65 2.5 66 3.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.575 3 0.575 4 0.7000000000000001 5 0.7000000000000001 6 0.5499999999999999 7 0.5 8 0.5 9 0.5499999999999999 10-14 0.485 15-19 0.515 20-24 0.505 25-29 0.515 30-34 0.515 35-39 0.52 40-44 0.53 45-49 0.545 50-54 0.545 55-59 0.545 60-64 0.515 65-69 0.555 70-74 0.565 75-79 0.58 80-84 0.58 85-89 0.575 90-94 0.585 95-99 0.5950000000000001 100-104 0.58 105-109 0.6 110-114 0.62 115-119 0.63 120-124 0.69 125-129 0.685 130-134 0.7100000000000001 135-139 0.7000000000000001 140-144 0.7000000000000001 145-149 0.72 150-151 0.7000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21479229989868 97.925 2 0.5572441742654508 1.0999999999999999 3 0.07598784194528875 0.22499999999999998 4 0.10131712259371835 0.4 5 0.025329280648429587 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025329280648429587 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 9 0.22499999999999998 Illumina Single End PCR Primer 1 (97% over 34bp) GTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.8875 0.0 0.0 0.0 0.0 92-93 1.0875 0.0 0.0 0.0 0.0 94-95 1.2625 0.0 0.0 0.0 0.0 96-97 1.475 0.0 0.0 0.0 0.0 98-99 1.775 0.0 0.0 0.0 0.0 100-101 2.0125 0.0 0.0 0.0 0.0 102-103 2.2625 0.0 0.0 0.0 0.0 104-105 2.6125 0.0 0.0 0.0 0.0 106-107 2.9375 0.0 0.0 0.0 0.0 108-109 3.2874999999999996 0.0 0.0 0.0 0.0 110-111 3.75 0.0 0.0 0.0 0.0 112-113 4.125 0.0 0.0 0.0 0.0 114-115 4.55 0.0 0.0 0.0 0.0 116-117 4.9375 0.0 0.0 0.0 0.0 118-119 5.425 0.0 0.0 0.0 0.0 120-121 5.9 0.0 0.0 0.0 0.0 122-123 6.3625 0.0 0.0 0.0 0.0 124-125 7.012499999999999 0.0 0.0 0.0 0.0 126-127 7.5625 0.0 0.0 0.0 0.0 128-129 7.9625 0.0 0.0 0.0 0.0 130-131 8.575 0.0 0.0 0.0 0.0 132-133 9.175 0.0 0.0 0.0 0.0 134-135 9.8625 0.0 0.0 0.0 0.0 136-137 10.55 0.0 0.0 0.0 0.0 138-139 11.212499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAATA 10 0.006830828 145.0 2 TTAAGAA 10 0.006830828 145.0 8 ACAATAT 10 0.006830828 145.0 3 >>END_MODULE Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604439 spots for SRR7169864.sra Written 604439 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra Read 604429 spots for SRR7169864.sra Written 604429 spots for SRR7169864.sra SRR ids: ['SRR7169864.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yoecco2s SRR7169864.sra spots: 12088590 blocks: [[1, 604429], [604430, 1208858], [1208859, 1813287], [1813288, 2417716], [2417717, 3022145], [3022146, 3626574], [3626575, 4231003], [4231004, 4835432], [4835433, 5439861], [5439862, 6044290], [6044291, 6648719], [6648720, 7253148], [7253149, 7857577], [7857578, 8462006], [8462007, 9066435], [9066436, 9670864], [9670865, 10275293], [10275294, 10879722], [10879723, 11484151], [11484152, 12088590]] SRR7169864 file size 4074726 SRR7169864 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169864 SRR7169864_1.fastq SRR7169864_2.fastq Input file: SRR7169864_1.fastq Paired file: SRR7169864_2.fastq trimmed: SRR7169864-trimmed-pair1.fastq, SRR7169864-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:16:19 2025 >> started Wed Feb 12 00:16:33 2025 >> done (13.773s) 12088590 read pairs processed; of these: 31816 ( 0.26%) short read pairs filtered out after trimming by size control 78988 ( 0.65%) empty read pairs filtered out after trimming by size control 11977786 (99.08%) read pairs available; of these: 5375281 (44.88%) trimmed read pairs available after processing 6602505 (55.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 10 0.00% 20 6 0.00% 21 3 0.00% 22 6 0.00% 23 4 0.00% 24 8 0.00% 25 6 0.00% 26 6 0.00% 27 3 0.00% 28 7 0.00% 29 4 0.00% 30 4 0.00% 31 6 0.00% 32 9 0.00% 33 9 0.00% 34 5 0.00% 35 13 0.00% 36 13 0.00% 37 8 0.00% 38 8 0.00% 39 18 0.00% 40 20 0.00% 41 19 0.00% 42 21 0.00% 43 18 0.00% 44 31 0.00% 45 26 0.00% 46 36 0.00% 47 61 0.00% 48 67 0.00% 49 60 0.00% 50 79 0.00% 51 97 0.00% 52 123 0.00% 53 122 0.00% 54 137 0.00% 55 168 0.00% 56 174 0.00% 57 215 0.00% 58 226 0.00% 59 294 0.00% 60 372 0.00% 61 381 0.00% 62 498 0.00% 63 595 0.00% 64 648 0.01% 65 677 0.01% 66 776 0.01% 67 932 0.01% 68 1039 0.01% 69 1232 0.01% 70 1344 0.01% 71 1567 0.01% 72 1861 0.02% 73 2179 0.02% 74 2407 0.02% 75 2647 0.02% 76 3205 0.03% 77 3571 0.03% 78 3607 0.03% 79 4175 0.03% 80 4351 0.04% 81 5052 0.04% 82 5695 0.05% 83 6406 0.05% 84 7901 0.07% 85 9040 0.08% 86 9565 0.08% 87 10345 0.09% 88 11255 0.09% 89 11673 0.10% 90 12228 0.10% 91 12879 0.11% 92 13323 0.11% 93 14684 0.12% 94 15288 0.13% 95 16830 0.14% 96 17301 0.14% 97 18015 0.15% 98 18462 0.15% 99 18546 0.15% 100 19636 0.16% 101 20003 0.17% 102 21133 0.18% 103 22090 0.18% 104 23092 0.19% 105 24570 0.21% 106 25191 0.21% 107 25817 0.22% 108 26309 0.22% 109 26845 0.22% 110 27831 0.23% 111 28229 0.24% 112 28910 0.24% 113 30616 0.26% 114 31276 0.26% 115 32426 0.27% 116 33602 0.28% 117 34125 0.28% 118 35267 0.29% 119 35731 0.30% 120 36241 0.30% 121 36409 0.30% 122 37385 0.31% 123 38900 0.32% 124 40348 0.34% 125 41120 0.34% 126 42288 0.35% 127 43716 0.36% 128 44676 0.37% 129 45636 0.38% 130 46471 0.39% 131 47396 0.40% 132 48822 0.41% 133 50309 0.42% 134 51488 0.43% 135 53654 0.45% 136 55848 0.47% 137 57964 0.48% 138 59943 0.50% 139 62924 0.53% 140 64879 0.54% 141 68943 0.58% 142 73074 0.61% 143 78752 0.66% 144 86183 0.72% 145 97700 0.82% 146 113691 0.95% 147 143473 1.20% 148 202962 1.69% 149 413371 3.45% 150 2263313 18.90% 151 6602505 55.12% 11977786 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=35 prefix-density=0.18 prefix-fanout=2.6 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=65.63 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.9 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=4.24 fanout-score-rank=27 prefix-density=0.53 prefix-fanout=3.0 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=178.35 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.8 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7169864 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:17:16 Started mapping on | Feb 12 00:17:16 Finished on | Feb 12 00:18:39 Mapping speed, Million of reads per hour | 519.52 Number of input reads | 11977786 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 11201809 Uniquely mapped reads % | 93.52% Average mapped length | 290.69 Number of splices: Total | 9136256 Number of splices: Annotated (sjdb) | 8964528 Number of splices: GT/AG | 8999150 Number of splices: GC/AG | 105155 Number of splices: AT/AC | 8308 Number of splices: Non-canonical | 23643 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 199308 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 24573 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.54% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 591393 591393 591393 N_multimapping 199308 199308 199308 N_noFeature 265817 11056793 315167 N_ambiguous 139616 877 43351 UnstrandedReadsAssigned:10796376 PositiveStrandReadsAssigned:144139 NegativeStrandReadsAssigned:10843291 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169864 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169864-trimmed-pair1.fastq SRR7169864-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,977,786 reads, 10,818,506 reads pseudoaligned [quant] estimated average fragment length: 214.31 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52401 SRR7169864.ke.tsv 34699 SRR7169864.se.tsv 87100 total ==> SRR7169864.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.69 185 8.62862 Potri.005G024800.1.v4.1 1035 821.69 22 2.25365 Potri.004G059700.1.v4.1 961 747.695 3 0.33773 Potri.007G009000.2.v4.1 1416 1202.69 0 0 Potri.003G141000.2.v4.1 2943 2729.69 161 4.96461 Potri.016G087400.1.v4.1 270 89.6018 1178.47 1107.06 Potri.015G069301.1.v4.1 564 352.248 0 0 Potri.010G195200.1.v4.1 1773 1559.69 18 0.971419 Potri.012G127500.1.v4.1 977 763.69 3641 401.306 ==> SRR7169864.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 939 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 280 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7169864 completed mapping pipeline successfully