Starting /dee2/code/volunteer_pipeline.sh SRR7169865 current disk space = 3052069613568 free memory = 1479856312 SRR7169865 SRAfilesize 7e05cf139df80fbfefcd9aba5a14e2fd SRR7169865.sra SRR7169865.sra file validated SRR7169865 is paired end SRR7169865 is conventional basespace SRR7169865 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169865_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.20375 28.0 18.0 33.0 18.0 33.0 2 24.082 25.0 18.0 30.0 18.0 33.0 3 28.4385 29.0 27.0 31.0 25.0 33.0 4 31.40875 33.0 31.0 33.0 29.0 33.0 5 32.1905 33.0 33.0 33.0 31.0 33.0 6 36.48675 38.0 36.0 38.0 34.0 38.0 7 37.114 38.0 37.0 38.0 35.0 38.0 8 37.53825 38.0 38.0 38.0 37.0 38.0 9 36.543 38.0 38.0 38.0 34.0 38.0 10-14 37.548899999999996 38.0 38.0 38.0 37.2 38.0 15-19 37.48365 38.0 38.0 38.0 37.6 38.0 20-24 37.4996 38.0 38.0 38.0 37.2 38.0 25-29 37.6146 38.0 38.0 38.0 38.0 38.0 30-34 37.57 38.0 38.0 38.0 38.0 38.0 35-39 37.49915 38.0 38.0 38.0 37.8 38.0 40-44 37.4191 38.0 38.0 38.0 37.0 38.0 45-49 37.509550000000004 38.0 38.0 38.0 37.4 38.0 50-54 37.458600000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.355050000000006 38.0 38.0 38.0 36.8 38.0 60-64 37.29110000000001 38.0 38.0 38.0 36.4 38.0 65-69 37.1646 38.0 38.0 38.0 36.0 38.0 70-74 37.11535 38.0 38.0 38.0 36.0 38.0 75-79 36.96235 38.0 38.0 38.0 36.0 38.0 80-84 36.7049 38.0 37.8 38.0 35.0 38.0 85-89 36.19945 38.0 37.0 38.0 32.8 38.0 90-94 36.6308 38.0 38.0 38.0 34.2 38.0 95-99 36.57090000000001 38.0 38.0 38.0 34.0 38.0 100-104 36.272200000000005 38.0 37.4 38.0 33.6 38.0 105-109 35.2606 38.0 35.8 38.0 27.6 38.0 110-114 35.26945 38.0 35.8 38.0 27.8 38.0 115-119 35.4637 38.0 35.8 38.0 30.0 38.0 120-124 35.44305 38.0 36.0 38.0 30.2 38.0 125-129 33.8506 37.4 33.0 38.0 23.6 38.0 130-134 34.12165 37.8 34.0 38.0 24.6 38.0 135-139 34.41915 38.0 33.8 38.0 26.6 38.0 140-144 33.52075 38.0 33.0 38.0 21.6 38.0 145-149 31.986349999999998 36.4 31.4 38.0 14.4 38.0 150-151 27.748625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 1.0 16 2.0 17 5.0 18 3.0 19 6.0 20 2.0 21 2.0 22 4.0 23 2.0 24 7.0 25 6.0 26 10.0 27 15.0 28 19.0 29 27.0 30 41.0 31 54.0 32 93.0 33 152.0 34 267.0 35 518.0 36 1437.0 37 1325.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.074999999999996 12.3 10.174999999999999 33.45 2 24.05 14.524999999999999 33.074999999999996 28.349999999999998 3 19.900000000000002 20.5 26.6 33.0 4 21.675 29.325000000000003 23.625 25.374999999999996 5 23.35 30.599999999999998 23.225 22.825 6 20.325 35.375 25.275 19.025 7 14.7 26.724999999999998 41.65 16.925 8 18.725 25.2 30.099999999999998 25.974999999999998 9 17.849999999999998 26.1 33.25 22.8 10-14 19.445 29.64 27.825 23.09 15-19 20.075000000000003 28.384999999999998 28.199999999999996 23.34 20-24 19.814999999999998 29.535 27.485 23.165 25-29 19.485 29.84 27.375 23.3 30-34 19.86 29.74 27.705000000000002 22.695 35-39 19.744999999999997 29.24 27.650000000000002 23.365 40-44 20.325 29.659999999999997 26.790000000000003 23.225 45-49 20.345 28.689999999999998 27.97 22.994999999999997 50-54 19.965 29.37 27.575 23.09 55-59 20.669999999999998 29.330000000000002 27.07 22.93 60-64 20.115 29.459999999999997 27.250000000000004 23.175 65-69 20.305 29.044999999999998 27.439999999999998 23.21 70-74 20.18 28.895 28.01 22.915 75-79 19.99 29.299999999999997 27.04 23.669999999999998 80-84 20.215 28.98 27.165 23.64 85-89 20.26 28.749999999999996 27.355 23.635 90-94 20.22 28.925 27.265 23.59 95-99 20.555 28.83 27.245 23.369999999999997 100-104 20.8 28.67 27.250000000000004 23.28 105-109 20.25 28.71 27.700000000000003 23.34 110-114 20.669999999999998 28.63 27.644999999999996 23.055 115-119 21.105 28.410000000000004 27.63 22.855 120-124 20.655 28.67 27.045 23.630000000000003 125-129 20.375 27.845 27.915 23.865 130-134 20.62 28.595 27.529999999999998 23.255 135-139 20.805 28.125 27.084999999999997 23.985 140-144 20.865000000000002 27.865000000000002 27.54 23.73 145-149 20.085 28.194999999999997 27.694999999999997 24.025 150-151 20.575 28.012500000000003 26.974999999999998 24.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 3.0 21 3.5 22 1.0 23 1.0 24 4.0 25 3.0 26 2.5 27 8.0 28 15.5 29 18.0 30 16.5 31 24.0 32 34.5 33 44.5 34 65.5 35 90.5 36 98.5 37 107.0 38 132.5 39 158.5 40 189.5 41 210.0 42 241.5 43 271.5 44 259.5 45 256.5 46 273.0 47 272.0 48 240.0 49 202.0 50 167.0 51 123.5 52 111.0 53 103.0 54 72.5 55 48.5 56 31.0 57 24.0 58 20.0 59 15.0 60 9.0 61 7.0 62 5.0 63 2.0 64 4.0 65 3.5 66 0.5 67 1.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.4500000000000002 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.625 0.0 0.0 0.0 0.0 124-125 2.7875 0.0 0.0 0.0 0.0 126-127 3.0125 0.0 0.0 0.0 0.0 128-129 3.2 0.0 0.0 0.0 0.0 130-131 3.3375 0.0 0.0 0.0 0.0 132-133 3.6125 0.0 0.0 0.0 0.0 134-135 3.7874999999999996 0.0 0.0 0.0 0.0 136-137 3.875 0.0 0.0 0.0 0.0 138-139 4.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTCGA 10 0.006830828 145.0 4 >>END_MODULE SRR7169865 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169865_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.159 34.0 33.0 34.0 33.0 34.0 2 33.22575 34.0 33.0 34.0 33.0 34.0 3 33.26625 34.0 33.0 34.0 33.0 34.0 4 33.24425 34.0 33.0 34.0 33.0 34.0 5 33.27075 34.0 33.0 34.0 33.0 34.0 6 37.4475 38.0 38.0 38.0 38.0 38.0 7 37.4915 38.0 38.0 38.0 38.0 38.0 8 37.33925 38.0 38.0 38.0 38.0 38.0 9 37.36975 38.0 38.0 38.0 38.0 38.0 10-14 37.350750000000005 38.0 38.0 38.0 37.4 38.0 15-19 37.377250000000004 38.0 38.0 38.0 37.6 38.0 20-24 37.35594999999999 38.0 38.0 38.0 37.2 38.0 25-29 37.0497 38.0 38.0 38.0 36.2 38.0 30-34 37.3013 38.0 38.0 38.0 37.2 38.0 35-39 37.05805 38.0 38.0 38.0 36.2 38.0 40-44 37.3138 38.0 38.0 38.0 37.0 38.0 45-49 36.9426 38.0 38.0 38.0 36.0 38.0 50-54 37.149449999999995 38.0 38.0 38.0 36.6 38.0 55-59 37.16465 38.0 38.0 38.0 36.8 38.0 60-64 37.05175 38.0 38.0 38.0 36.2 38.0 65-69 37.1111 38.0 38.0 38.0 36.0 38.0 70-74 37.088100000000004 38.0 38.0 38.0 36.4 38.0 75-79 37.053999999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.89614999999999 38.0 38.0 38.0 35.8 38.0 85-89 36.7832 38.0 38.0 38.0 35.4 38.0 90-94 36.80635 38.0 38.0 38.0 35.6 38.0 95-99 36.638549999999995 38.0 38.0 38.0 35.0 38.0 100-104 36.44155 38.0 38.0 38.0 34.2 38.0 105-109 36.385000000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.2781 38.0 38.0 38.0 34.0 38.0 115-119 36.2045 38.0 38.0 38.0 33.6 38.0 120-124 35.8133 38.0 36.8 38.0 32.6 38.0 125-129 35.14985 38.0 35.6 38.0 28.6 38.0 130-134 35.358050000000006 38.0 36.0 38.0 30.0 38.0 135-139 33.987550000000006 38.0 34.4 38.0 23.4 38.0 140-144 33.49204999999999 38.0 33.0 38.0 21.8 38.0 145-149 32.69 38.0 32.6 38.0 17.8 38.0 150-151 28.872625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 1.0 13 0.0 14 3.0 15 1.0 16 1.0 17 3.0 18 1.0 19 6.0 20 8.0 21 7.0 22 7.0 23 7.0 24 13.0 25 10.0 26 14.0 27 13.0 28 14.0 29 27.0 30 47.0 31 39.0 32 80.0 33 101.0 34 151.0 35 276.0 36 789.0 37 2371.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.025 18.825 14.875 27.275 2 26.25 25.575 29.5 18.675 3 19.825 28.075 32.2 19.900000000000002 4 23.45 33.675 23.375 19.5 5 24.15 35.449999999999996 22.725 17.675 6 21.25 36.7 23.35 18.7 7 20.625 21.0 38.925 19.45 8 23.125 25.374999999999996 25.75 25.75 9 21.6 25.575 30.099999999999998 22.725 10-14 22.405 28.92 26.915 21.759999999999998 15-19 23.380000000000003 27.834999999999997 27.76 21.025 20-24 22.869999999999997 28.255000000000003 27.555000000000003 21.32 25-29 23.365 28.345 27.589999999999996 20.7 30-34 23.04 27.725 28.02 21.215 35-39 22.689999999999998 28.025 28.34 20.945 40-44 23.145 28.225 27.865000000000002 20.765 45-49 23.01 27.62 28.360000000000003 21.01 50-54 22.865 27.889999999999997 28.335 20.91 55-59 23.47 28.470000000000002 27.529999999999998 20.53 60-64 22.59 28.51 28.28 20.62 65-69 22.814999999999998 27.794999999999998 28.21 21.18 70-74 23.169999999999998 27.85 28.084999999999997 20.895 75-79 23.064999999999998 27.639999999999997 28.935 20.36 80-84 22.855 28.565 27.07 21.51 85-89 23.419999999999998 26.905 28.84 20.835 90-94 23.22 27.485 27.96 21.335 95-99 23.195 27.35 28.144999999999996 21.310000000000002 100-104 23.24 27.839999999999996 28.015 20.905 105-109 23.57 27.915 28.189999999999998 20.325 110-114 23.52 27.665 27.905 20.91 115-119 23.13 27.975 28.050000000000004 20.845 120-124 24.169999999999998 27.71 27.77 20.349999999999998 125-129 23.465 28.384999999999998 27.595 20.555 130-134 23.775 27.075 28.244999999999997 20.905 135-139 23.69 28.215 27.505000000000003 20.59 140-144 24.03 28.055000000000003 27.165 20.75 145-149 23.799999999999997 27.529999999999998 28.18 20.49 150-151 23.4625 27.3125 28.549999999999997 20.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.0 24 0.5 25 1.5 26 3.0 27 5.0 28 8.0 29 9.5 30 14.0 31 22.0 32 22.0 33 31.5 34 47.0 35 61.5 36 74.0 37 89.0 38 124.5 39 151.0 40 183.5 41 219.0 42 254.0 43 305.0 44 317.5 45 303.0 46 294.0 47 260.5 48 223.5 49 218.5 50 200.5 51 154.0 52 116.5 53 85.0 54 54.0 55 33.5 56 28.0 57 25.5 58 16.0 59 10.5 60 7.0 61 4.5 62 4.5 63 4.5 64 3.0 65 2.0 66 1.5 67 0.0 68 1.0 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.4500000000000002 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.7374999999999998 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 1.95 0.0 0.0 0.0 0.0 118-119 2.0625 0.0 0.0 0.0 0.0 120-121 2.3625 0.0 0.0 0.0 0.0 122-123 2.5875 0.0 0.0 0.0 0.0 124-125 2.7625 0.0 0.0 0.0 0.0 126-127 2.975 0.0 0.0 0.0 0.0 128-129 3.1500000000000004 0.0 0.0 0.0 0.0 130-131 3.275 0.0 0.0 0.0 0.0 132-133 3.55 0.0 0.0 0.0 0.0 134-135 3.7375 0.0 0.0 0.0 0.0 136-137 3.825 0.0 0.0 0.0 0.0 138-139 4.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659810 spots for SRR7169865.sra Written 659810 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra Read 659808 spots for SRR7169865.sra Written 659808 spots for SRR7169865.sra SRR ids: ['SRR7169865.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_49pz3z51 SRR7169865.sra spots: 13196162 blocks: [[1, 659808], [659809, 1319616], [1319617, 1979424], [1979425, 2639232], [2639233, 3299040], [3299041, 3958848], [3958849, 4618656], [4618657, 5278464], [5278465, 5938272], [5938273, 6598080], [6598081, 7257888], [7257889, 7917696], [7917697, 8577504], [8577505, 9237312], [9237313, 9897120], [9897121, 10556928], [10556929, 11216736], [11216737, 11876544], [11876545, 12536352], [12536353, 13196162]] SRR7169865 file size 4450045 SRR7169865 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169865 SRR7169865_1.fastq SRR7169865_2.fastq Input file: SRR7169865_1.fastq Paired file: SRR7169865_2.fastq trimmed: SRR7169865-trimmed-pair1.fastq, SRR7169865-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:49:34 2025 >> started Tue Feb 11 23:49:52 2025 >> done (17.932s) 13196162 read pairs processed; of these: 9838 ( 0.07%) short read pairs filtered out after trimming by size control 9969 ( 0.08%) empty read pairs filtered out after trimming by size control 13176355 (99.85%) read pairs available; of these: 6117412 (46.43%) trimmed read pairs available after processing 7058943 (53.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 2 0.00% 22 6 0.00% 23 3 0.00% 24 4 0.00% 25 2 0.00% 26 8 0.00% 27 8 0.00% 28 5 0.00% 29 1 0.00% 30 7 0.00% 31 2 0.00% 32 2 0.00% 33 7 0.00% 34 9 0.00% 35 7 0.00% 36 6 0.00% 37 8 0.00% 38 11 0.00% 39 12 0.00% 40 17 0.00% 41 17 0.00% 42 21 0.00% 43 26 0.00% 44 21 0.00% 45 25 0.00% 46 31 0.00% 47 30 0.00% 48 48 0.00% 49 38 0.00% 50 68 0.00% 51 65 0.00% 52 76 0.00% 53 91 0.00% 54 95 0.00% 55 108 0.00% 56 123 0.00% 57 174 0.00% 58 157 0.00% 59 185 0.00% 60 234 0.00% 61 259 0.00% 62 336 0.00% 63 341 0.00% 64 410 0.00% 65 474 0.00% 66 470 0.00% 67 521 0.00% 68 626 0.00% 69 685 0.01% 70 832 0.01% 71 876 0.01% 72 1027 0.01% 73 1269 0.01% 74 1274 0.01% 75 1428 0.01% 76 1550 0.01% 77 1748 0.01% 78 1860 0.01% 79 2102 0.02% 80 2284 0.02% 81 2603 0.02% 82 2976 0.02% 83 3395 0.03% 84 4067 0.03% 85 4723 0.04% 86 4921 0.04% 87 5208 0.04% 88 5424 0.04% 89 5784 0.04% 90 6108 0.05% 91 6503 0.05% 92 6936 0.05% 93 7293 0.06% 94 7867 0.06% 95 8155 0.06% 96 8394 0.06% 97 8421 0.06% 98 8670 0.07% 99 9277 0.07% 100 9504 0.07% 101 9928 0.08% 102 10633 0.08% 103 11208 0.09% 104 11642 0.09% 105 12297 0.09% 106 12611 0.10% 107 12550 0.10% 108 12667 0.10% 109 13183 0.10% 110 13494 0.10% 111 14115 0.11% 112 14816 0.11% 113 15289 0.12% 114 16173 0.12% 115 16485 0.13% 116 17011 0.13% 117 17480 0.13% 118 17542 0.13% 119 17877 0.14% 120 18036 0.14% 121 18665 0.14% 122 19437 0.15% 123 20225 0.15% 124 21467 0.16% 125 21840 0.17% 126 23205 0.18% 127 24124 0.18% 128 24615 0.19% 129 25589 0.19% 130 26927 0.20% 131 27985 0.21% 132 29441 0.22% 133 31719 0.24% 134 33569 0.25% 135 35975 0.27% 136 38729 0.29% 137 41902 0.32% 138 44895 0.34% 139 48748 0.37% 140 53777 0.41% 141 59975 0.46% 142 68015 0.52% 143 78970 0.60% 144 94967 0.72% 145 119229 0.90% 146 154959 1.18% 147 219078 1.66% 148 346662 2.63% 149 695936 5.28% 150 3233383 24.54% 151 7058943 53.57% 13176355 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=39 prefix-density=0.23 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.12 sequence-density-rank=23 fanout-score=26.96 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=10.2 sequence=ATTTCTTCTTCTGAGGGGATCCTAGGAGAGTGAAT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.93 fanout-score-rank=12 prefix-density=0.33 prefix-fanout=4.2 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCAT criterion=fanout-score sequence-density=0.11 sequence-density-rank=28 fanout-score=46.44 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=11.0 sequence=TCAAGGAAGCTTTCAG SRR7169865 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:50:49 Started mapping on | Feb 11 23:50:49 Finished on | Feb 11 23:52:11 Mapping speed, Million of reads per hour | 578.47 Number of input reads | 13176355 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12457768 Uniquely mapped reads % | 94.55% Average mapped length | 294.98 Number of splices: Total | 11462730 Number of splices: Annotated (sjdb) | 11272336 Number of splices: GT/AG | 11302114 Number of splices: GC/AG | 127627 Number of splices: AT/AC | 8422 Number of splices: Non-canonical | 24567 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 213162 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 20605 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.65% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 517459 517459 517459 N_multimapping 213162 213162 213162 N_noFeature 328572 12299484 386072 N_ambiguous 157590 872 56157 UnstrandedReadsAssigned:11971606 PositiveStrandReadsAssigned:157412 NegativeStrandReadsAssigned:12015539 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169865 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169865-trimmed-pair1.fastq SRR7169865-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,176,355 reads, 11,912,178 reads pseudoaligned [quant] estimated average fragment length: 282.745 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR7169865.ke.tsv 34699 SRR7169865.se.tsv 87100 total ==> SRR7169865.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.25 207 10.5259 Potri.005G024800.1.v4.1 1035 753.255 30 3.51626 Potri.004G059700.1.v4.1 961 679.305 1 0.129968 Potri.007G009000.2.v4.1 1416 1134.25 0 0 Potri.003G141000.2.v4.1 2943 2661.25 209.063 6.93574 Potri.016G087400.1.v4.1 270 75.5064 734.992 859.41 Potri.015G069301.1.v4.1 564 289.657 0 0 Potri.010G195200.1.v4.1 1773 1491.25 5 0.296019 Potri.012G127500.1.v4.1 977 695.266 3311 420.446 ==> SRR7169865.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1260 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 210 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169865 completed mapping pipeline successfully