Starting /dee2/code/volunteer_pipeline.sh SRR7169866 current disk space = 3052248903680 free memory = 1472756912 SRR7169866 SRAfilesize 95843d0ba8670ae3a79a2e6030cd5f5d SRR7169866.sra SRR7169866.sra file validated SRR7169866 is paired end SRR7169866 is conventional basespace SRR7169866 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169866_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.57725 32.0 18.0 33.0 18.0 33.0 2 25.6365 27.0 18.0 31.0 18.0 33.0 3 29.4535 31.0 29.0 33.0 25.0 33.0 4 31.99925 33.0 31.0 33.0 30.0 33.0 5 32.628 33.0 33.0 33.0 32.0 33.0 6 36.7935 38.0 37.0 38.0 34.0 38.0 7 37.28925 38.0 38.0 38.0 36.0 38.0 8 37.5795 38.0 38.0 38.0 37.0 38.0 9 37.65025 38.0 38.0 38.0 38.0 38.0 10-14 37.55485 38.0 38.0 38.0 37.6 38.0 15-19 37.394000000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.649 38.0 38.0 38.0 38.0 38.0 25-29 37.67094999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.48565 38.0 38.0 38.0 37.6 38.0 35-39 37.47265 38.0 38.0 38.0 37.6 38.0 40-44 37.41234999999999 38.0 38.0 38.0 37.2 38.0 45-49 37.3565 38.0 38.0 38.0 37.0 38.0 50-54 37.19015 38.0 38.0 38.0 36.6 38.0 55-59 36.94165 38.0 38.0 38.0 35.4 38.0 60-64 37.067099999999996 38.0 38.0 38.0 35.8 38.0 65-69 37.163199999999996 38.0 38.0 38.0 36.2 38.0 70-74 36.81125000000001 38.0 38.0 38.0 35.2 38.0 75-79 36.9359 38.0 38.0 38.0 35.6 38.0 80-84 36.8815 38.0 38.0 38.0 35.4 38.0 85-89 36.81015 38.0 38.0 38.0 35.2 38.0 90-94 36.54765 38.0 38.0 38.0 34.2 38.0 95-99 36.4427 38.0 38.0 38.0 34.0 38.0 100-104 36.2769 38.0 37.6 38.0 33.8 38.0 105-109 35.712849999999996 38.0 36.6 38.0 31.2 38.0 110-114 35.93945 38.0 37.0 38.0 32.6 38.0 115-119 35.7812 38.0 36.8 38.0 31.4 38.0 120-124 35.63735 38.0 36.2 38.0 31.2 38.0 125-129 35.33195 38.0 35.8 38.0 30.4 38.0 130-134 34.7899 38.0 35.0 38.0 27.6 38.0 135-139 34.59595 38.0 35.0 38.0 27.0 38.0 140-144 33.384299999999996 37.6 33.6 38.0 20.0 38.0 145-149 32.851 38.0 33.0 38.0 19.4 38.0 150-151 28.542 34.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 2.0 14 4.0 15 2.0 16 0.0 17 2.0 18 2.0 19 1.0 20 3.0 21 5.0 22 5.0 23 6.0 24 9.0 25 12.0 26 14.0 27 18.0 28 17.0 29 26.0 30 30.0 31 55.0 32 70.0 33 117.0 34 183.0 35 445.0 36 1202.0 37 1768.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.599999999999994 12.3 8.9 31.2 2 23.025000000000002 13.775 35.3 27.900000000000002 3 20.8 20.95 27.125 31.125000000000004 4 23.95 27.800000000000004 23.35 24.9 5 22.650000000000002 33.800000000000004 24.474999999999998 19.075 6 20.125 37.45 24.349999999999998 18.075 7 15.725 26.825 39.574999999999996 17.875 8 18.625 26.700000000000003 30.15 24.525 9 16.400000000000002 24.9 33.95 24.75 10-14 20.3 29.435 27.755000000000003 22.509999999999998 15-19 20.355 29.154999999999998 27.48 23.01 20-24 20.44 29.18 27.33 23.05 25-29 20.485 28.970000000000002 27.42 23.125 30-34 20.75 28.860000000000003 27.68 22.71 35-39 20.41 29.165000000000003 27.515 22.91 40-44 20.585 28.835 27.750000000000004 22.830000000000002 45-49 20.285 29.125 27.595 22.994999999999997 50-54 20.424999999999997 28.815 27.725 23.035 55-59 20.79 28.33 27.62 23.26 60-64 20.41 29.110000000000003 27.529999999999998 22.95 65-69 20.43 28.74 27.43 23.400000000000002 70-74 20.87 28.64 27.195000000000004 23.294999999999998 75-79 20.91 28.09 27.96 23.04 80-84 21.224999999999998 28.935 26.66 23.18 85-89 20.985 28.349999999999998 27.46 23.205000000000002 90-94 21.11 28.749999999999996 27.650000000000002 22.49 95-99 20.724999999999998 28.884999999999998 27.445000000000004 22.945 100-104 21.265 28.544999999999998 27.155 23.035 105-109 21.265 28.285 27.58 22.869999999999997 110-114 21.09 28.43 27.32 23.16 115-119 22.195 27.855 27.450000000000003 22.5 120-124 21.38 27.665 27.58 23.375 125-129 21.66 28.470000000000002 27.61 22.259999999999998 130-134 21.529999999999998 28.205000000000002 27.284999999999997 22.98 135-139 21.27 27.400000000000002 27.815 23.515 140-144 20.7 28.27 27.445000000000004 23.585 145-149 20.77 28.410000000000004 27.345000000000002 23.474999999999998 150-151 20.962500000000002 28.212500000000002 26.9125 23.9125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 2.5 23 2.0 24 1.5 25 4.5 26 8.0 27 7.5 28 11.0 29 15.0 30 17.5 31 26.5 32 33.5 33 39.5 34 53.5 35 70.0 36 92.0 37 117.5 38 140.5 39 154.0 40 168.0 41 215.5 42 253.5 43 269.0 44 280.0 45 275.0 46 248.5 47 240.5 48 232.0 49 204.5 50 179.5 51 145.0 52 114.0 53 89.5 54 79.0 55 64.5 56 42.5 57 26.5 58 17.5 59 13.5 60 11.5 61 8.0 62 3.0 63 2.0 64 4.5 65 5.0 66 2.5 67 0.5 68 0.5 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.425 0.0 0.0 0.0 0.0 120-121 1.65 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 1.8625 0.0 0.0 0.0 0.0 126-127 1.975 0.0 0.0 0.0 0.0 128-129 2.1375 0.0 0.0 0.0 0.0 130-131 2.3 0.0 0.0 0.0 0.0 132-133 2.5875 0.0 0.0 0.0 0.0 134-135 2.6875 0.0 0.0 0.0 0.0 136-137 2.8375 0.0 0.0 0.0 0.0 138-139 3.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATAT 10 0.006830828 145.0 5 TTCAAAG 10 0.006830828 145.0 7 >>END_MODULE SRR7169866 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169866_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.29275 34.0 33.0 34.0 33.0 34.0 2 33.3935 34.0 33.0 34.0 33.0 34.0 3 33.409 34.0 33.0 34.0 33.0 34.0 4 33.3815 34.0 33.0 34.0 33.0 34.0 5 33.37175 34.0 33.0 34.0 33.0 34.0 6 37.51025 38.0 38.0 38.0 38.0 38.0 7 37.55625 38.0 38.0 38.0 38.0 38.0 8 37.53775 38.0 38.0 38.0 38.0 38.0 9 37.14425 38.0 38.0 38.0 37.0 38.0 10-14 37.430099999999996 38.0 38.0 38.0 37.8 38.0 15-19 37.41295 38.0 38.0 38.0 38.0 38.0 20-24 37.3426 38.0 38.0 38.0 37.6 38.0 25-29 37.1419 38.0 38.0 38.0 36.8 38.0 30-34 37.310950000000005 38.0 38.0 38.0 37.2 38.0 35-39 37.25475 38.0 38.0 38.0 36.8 38.0 40-44 37.262350000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.2577 38.0 38.0 38.0 36.8 38.0 50-54 36.9267 38.0 38.0 38.0 36.0 38.0 55-59 37.192350000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.2157 38.0 38.0 38.0 37.0 38.0 65-69 36.92295 38.0 38.0 38.0 36.2 38.0 70-74 36.42465 38.0 38.0 38.0 33.8 38.0 75-79 36.67675 38.0 38.0 38.0 35.0 38.0 80-84 36.27085 38.0 37.4 38.0 33.8 38.0 85-89 36.81115 38.0 38.0 38.0 35.8 38.0 90-94 36.919050000000006 38.0 38.0 38.0 36.0 38.0 95-99 36.79335 38.0 38.0 38.0 35.8 38.0 100-104 36.3972 38.0 38.0 38.0 34.2 38.0 105-109 36.40525 38.0 38.0 38.0 34.2 38.0 110-114 36.48365 38.0 38.0 38.0 34.4 38.0 115-119 36.263549999999995 38.0 37.8 38.0 33.8 38.0 120-124 35.9214 38.0 37.0 38.0 32.8 38.0 125-129 35.810300000000005 38.0 36.8 38.0 32.8 38.0 130-134 35.47255 38.0 36.0 38.0 31.2 38.0 135-139 35.20715 38.0 36.0 38.0 30.4 38.0 140-144 34.8708 38.0 35.6 38.0 29.2 38.0 145-149 34.4199 38.0 35.0 38.0 27.2 38.0 150-151 30.179625 35.5 28.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 0.0 5 2.0 6 1.0 7 0.0 8 2.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 2.0 15 2.0 16 3.0 17 6.0 18 4.0 19 2.0 20 4.0 21 5.0 22 2.0 23 8.0 24 12.0 25 11.0 26 14.0 27 19.0 28 14.0 29 23.0 30 29.0 31 42.0 32 58.0 33 90.0 34 101.0 35 255.0 36 629.0 37 2652.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.050000000000004 22.475 12.35 25.124999999999996 2 26.424999999999997 26.150000000000002 30.275000000000002 17.150000000000002 3 20.599999999999998 28.849999999999998 30.925000000000004 19.625 4 22.400000000000002 34.625 24.2 18.775 5 23.875 36.875 21.875 17.375 6 21.575 37.325 23.35 17.75 7 19.325 23.075000000000003 36.75 20.849999999999998 8 22.075 25.05 27.500000000000004 25.374999999999996 9 20.5 27.825 28.599999999999998 23.075000000000003 10-14 23.05 28.77 26.369999999999997 21.81 15-19 22.720000000000002 28.49 27.455000000000002 21.335 20-24 22.49 28.18 27.584999999999997 21.745 25-29 22.814999999999998 28.105000000000004 27.405 21.675 30-34 22.335 28.494999999999997 27.6 21.57 35-39 22.73 27.975 28.4 20.895 40-44 23.119999999999997 28.02 27.855 21.005 45-49 23.064999999999998 27.925 27.93 21.08 50-54 23.07 28.21 27.52 21.2 55-59 23.185 28.225 28.144999999999996 20.445 60-64 22.79 28.43 27.860000000000003 20.919999999999998 65-69 22.95 28.07 27.900000000000002 21.08 70-74 23.035 28.92 26.919999999999998 21.125 75-79 23.095 27.439999999999998 28.65 20.815 80-84 23.23 28.349999999999998 27.860000000000003 20.560000000000002 85-89 23.29 27.715 27.860000000000003 21.135 90-94 22.994999999999997 27.755000000000003 28.215 21.035 95-99 22.84 28.115000000000002 28.044999999999998 21.0 100-104 23.555 27.875 27.439999999999998 21.13 105-109 23.294999999999998 26.86 28.645 21.2 110-114 22.81 27.925 27.939999999999998 21.325 115-119 23.775 28.275 27.595 20.355 120-124 23.0 27.505000000000003 28.575 20.919999999999998 125-129 24.16 28.194999999999997 26.919999999999998 20.724999999999998 130-134 23.91 27.43 27.544999999999998 21.115000000000002 135-139 23.505000000000003 28.000000000000004 27.650000000000002 20.845 140-144 23.87 28.050000000000004 27.32 20.76 145-149 23.794999999999998 27.450000000000003 27.965 20.79 150-151 23.4625 27.0125 28.5625 20.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 1.0 23 1.0 24 0.5 25 1.0 26 2.0 27 3.0 28 3.5 29 8.5 30 13.0 31 11.5 32 20.0 33 32.5 34 41.0 35 59.0 36 84.0 37 100.0 38 119.0 39 168.5 40 221.0 41 245.0 42 271.5 43 281.0 44 281.0 45 290.5 46 280.0 47 264.0 48 250.0 49 216.5 50 168.5 51 138.5 52 116.0 53 87.5 54 58.0 55 40.5 56 32.5 57 24.0 58 19.5 59 14.5 60 8.5 61 5.0 62 2.5 63 1.0 64 1.0 65 3.0 66 2.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.425 0.0 0.0 0.0 0.0 120-121 1.65 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 1.8875 0.0 0.0 0.0 0.0 126-127 2.0 0.0 0.0 0.0 0.0 128-129 2.15 0.0 0.0 0.0 0.0 130-131 2.325 0.0 0.0 0.0 0.0 132-133 2.6125 0.0 0.0 0.0 0.0 134-135 2.7125000000000004 0.0 0.0 0.0 0.0 136-137 2.8625 0.0 0.0 0.0 0.0 138-139 3.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGATGTT 10 0.006830828 145.0 4 >>END_MODULE Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540992 spots for SRR7169866.sra Written 540992 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra Read 540980 spots for SRR7169866.sra Written 540980 spots for SRR7169866.sra SRR ids: ['SRR7169866.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__ii_89j8 SRR7169866.sra spots: 10819612 blocks: [[1, 540980], [540981, 1081960], [1081961, 1622940], [1622941, 2163920], [2163921, 2704900], [2704901, 3245880], [3245881, 3786860], [3786861, 4327840], [4327841, 4868820], [4868821, 5409800], [5409801, 5950780], [5950781, 6491760], [6491761, 7032740], [7032741, 7573720], [7573721, 8114700], [8114701, 8655680], [8655681, 9196660], [9196661, 9737640], [9737641, 10278620], [10278621, 10819612]] SRR7169866 file size 3644711 SRR7169866 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169866 SRR7169866_1.fastq SRR7169866_2.fastq Input file: SRR7169866_1.fastq Paired file: SRR7169866_2.fastq trimmed: SRR7169866-trimmed-pair1.fastq, SRR7169866-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:32:46 2025 >> started Tue Feb 11 23:32:58 2025 >> done (12.416s) 10819612 read pairs processed; of these: 8606 ( 0.08%) short read pairs filtered out after trimming by size control 6526 ( 0.06%) empty read pairs filtered out after trimming by size control 10804480 (99.86%) read pairs available; of these: 4493401 (41.59%) trimmed read pairs available after processing 6311079 (58.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 0 0.00% 21 2 0.00% 22 2 0.00% 23 0 0.00% 24 3 0.00% 25 2 0.00% 26 4 0.00% 27 3 0.00% 28 3 0.00% 29 5 0.00% 30 3 0.00% 31 1 0.00% 32 5 0.00% 33 5 0.00% 34 2 0.00% 35 4 0.00% 36 4 0.00% 37 6 0.00% 38 3 0.00% 39 7 0.00% 40 8 0.00% 41 8 0.00% 42 13 0.00% 43 9 0.00% 44 12 0.00% 45 13 0.00% 46 11 0.00% 47 22 0.00% 48 21 0.00% 49 30 0.00% 50 33 0.00% 51 35 0.00% 52 43 0.00% 53 36 0.00% 54 40 0.00% 55 62 0.00% 56 59 0.00% 57 84 0.00% 58 83 0.00% 59 89 0.00% 60 108 0.00% 61 132 0.00% 62 180 0.00% 63 205 0.00% 64 225 0.00% 65 247 0.00% 66 250 0.00% 67 308 0.00% 68 315 0.00% 69 354 0.00% 70 442 0.00% 71 531 0.00% 72 573 0.01% 73 631 0.01% 74 727 0.01% 75 748 0.01% 76 824 0.01% 77 952 0.01% 78 1038 0.01% 79 1049 0.01% 80 1305 0.01% 81 1474 0.01% 82 1681 0.02% 83 1865 0.02% 84 2389 0.02% 85 2735 0.03% 86 2962 0.03% 87 3066 0.03% 88 3396 0.03% 89 3320 0.03% 90 3648 0.03% 91 3876 0.04% 92 4298 0.04% 93 4602 0.04% 94 4579 0.04% 95 4880 0.05% 96 5180 0.05% 97 5174 0.05% 98 5434 0.05% 99 5654 0.05% 100 5884 0.05% 101 6137 0.06% 102 6645 0.06% 103 6932 0.06% 104 7291 0.07% 105 7398 0.07% 106 7832 0.07% 107 8140 0.08% 108 8285 0.08% 109 8325 0.08% 110 8614 0.08% 111 9172 0.08% 112 9745 0.09% 113 10073 0.09% 114 10432 0.10% 115 10947 0.10% 116 11263 0.10% 117 11727 0.11% 118 11930 0.11% 119 11879 0.11% 120 12184 0.11% 121 12356 0.11% 122 13016 0.12% 123 13872 0.13% 124 14539 0.13% 125 15423 0.14% 126 15807 0.15% 127 16760 0.16% 128 17195 0.16% 129 18253 0.17% 130 18964 0.18% 131 19843 0.18% 132 21173 0.20% 133 22337 0.21% 134 24034 0.22% 135 25368 0.23% 136 27266 0.25% 137 29776 0.28% 138 31900 0.30% 139 34791 0.32% 140 38263 0.35% 141 43132 0.40% 142 47557 0.44% 143 55775 0.52% 144 66618 0.62% 145 84873 0.79% 146 109159 1.01% 147 148872 1.38% 148 234129 2.17% 149 478290 4.43% 150 2521089 23.33% 151 6311079 58.41% 10804480 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=33 prefix-density=0.26 prefix-fanout=2.6 sequence=AAAGAAGTCAAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=256.32 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=17.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=34 prefix-density=0.28 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.04 sequence-density-rank=40 fanout-score=87.00 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=10.5 sequence=TCTCTTCTCTCGGAAAATGGCCGGTTTAATTTCAAGATCAGTTCCTTGTGCAATCCTAGTAGTCTTGTGCACGGTGGTGCCCATTTTGGCTAAAGATCACACTGTAGGAGATAGTTCAGGCTGGGCAATTGGTATGGATTATAGCACCTGGACTAGTGGCAAGACCTTTTCAGTTGGCGACAGCCTTGTGTTTAACTACGGAGGAGGCCACACGGTGGATGAAGTGAGAGCCAGTGACTACAGCACATGCACTACAGGCAATGCAATCACTTCAGATAGCAGTGGTGCTACCACAATAGCCCTCAAGACTGCCGGAACTCATTATTTCATTTGTGGTGTTCCTGGCCACTGTGGGAGTGGCATGAAGGTTGCAGTCACTGTTGCAGCAGCAGGATCGAGCACAAGTCCCTCCTCC SRR7169866 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:33:44 Started mapping on | Feb 11 23:33:44 Finished on | Feb 11 23:34:37 Mapping speed, Million of reads per hour | 733.89 Number of input reads | 10804480 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10171748 Uniquely mapped reads % | 94.14% Average mapped length | 296.08 Number of splices: Total | 9589777 Number of splices: Annotated (sjdb) | 9430174 Number of splices: GT/AG | 9454218 Number of splices: GC/AG | 107303 Number of splices: AT/AC | 6915 Number of splices: Non-canonical | 21341 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 190180 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 26246 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.81% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 452659 452659 452659 N_multimapping 190180 190180 190180 N_noFeature 235458 10053215 277019 N_ambiguous 123833 571 46470 UnstrandedReadsAssigned:9812457 PositiveStrandReadsAssigned:117962 NegativeStrandReadsAssigned:9848259 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169866 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169866-trimmed-pair1.fastq SRR7169866-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,804,480 reads, 9,776,020 reads pseudoaligned [quant] estimated average fragment length: 298.77 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR7169866.ke.tsv 34699 SRR7169866.se.tsv 87100 total ==> SRR7169866.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1720.23 199 11.9268 Potri.005G024800.1.v4.1 1035 737.23 15 2.09771 Potri.004G059700.1.v4.1 961 663.317 2 0.310861 Potri.007G009000.2.v4.1 1416 1118.23 0 0 Potri.003G141000.2.v4.1 2943 2645.23 130.021 5.06766 Potri.016G087400.1.v4.1 270 71.8999 633 907.68 Potri.015G069301.1.v4.1 564 276.654 0 0 Potri.010G195200.1.v4.1 1773 1475.23 11 0.768759 Potri.012G127500.1.v4.1 977 679.288 2769 420.268 ==> SRR7169866.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1275 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 120 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169866 completed mapping pipeline successfully