Starting /dee2/code/volunteer_pipeline.sh SRR7169867 current disk space = 3052100763648 free memory = 1252531396 SRR7169867 SRAfilesize 7badd78de4d0864a60f1d26536b5fbc7 SRR7169867.sra SRR7169867.sra file validated SRR7169867 is paired end SRR7169867 is conventional basespace SRR7169867 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169867_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.87625 18.0 18.0 30.0 18.0 32.0 2 30.812 31.0 30.0 33.0 27.0 33.0 3 32.3635 33.0 33.0 33.0 31.0 33.0 4 32.787 33.0 33.0 33.0 33.0 34.0 5 32.979 33.0 33.0 34.0 33.0 34.0 6 37.081 38.0 37.0 38.0 36.0 38.0 7 37.48675 38.0 38.0 38.0 37.0 38.0 8 37.59975 38.0 38.0 38.0 38.0 38.0 9 37.674 38.0 38.0 38.0 38.0 38.0 10-14 37.6979 38.0 38.0 38.0 38.0 38.0 15-19 37.6737 38.0 38.0 38.0 38.0 38.0 20-24 37.5905 38.0 38.0 38.0 37.8 38.0 25-29 37.673899999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.6498 38.0 38.0 38.0 38.0 38.0 35-39 37.586749999999995 38.0 38.0 38.0 37.8 38.0 40-44 37.6359 38.0 38.0 38.0 38.0 38.0 45-49 37.60555000000001 38.0 38.0 38.0 38.0 38.0 50-54 37.57735 38.0 38.0 38.0 38.0 38.0 55-59 37.42745 38.0 38.0 38.0 37.2 38.0 60-64 37.42955 38.0 38.0 38.0 37.0 38.0 65-69 37.3675 38.0 38.0 38.0 37.0 38.0 70-74 37.3517 38.0 38.0 38.0 37.0 38.0 75-79 37.26065 38.0 38.0 38.0 36.8 38.0 80-84 37.009949999999996 38.0 38.0 38.0 35.8 38.0 85-89 37.040749999999996 38.0 38.0 38.0 35.8 38.0 90-94 36.66369999999999 38.0 37.8 38.0 34.2 38.0 95-99 36.861399999999996 38.0 38.0 38.0 35.6 38.0 100-104 36.6577 38.0 38.0 38.0 34.8 38.0 105-109 36.0613 38.0 37.2 38.0 30.8 38.0 110-114 35.8833 38.0 36.8 38.0 31.8 38.0 115-119 35.457550000000005 38.0 36.2 38.0 28.8 38.0 120-124 36.10595000000001 38.0 37.2 38.0 33.6 38.0 125-129 35.15215 38.0 35.6 38.0 27.8 38.0 130-134 35.585950000000004 38.0 36.0 38.0 31.2 38.0 135-139 35.63115 38.0 36.0 38.0 31.4 38.0 140-144 35.01965 38.0 35.4 38.0 28.8 38.0 145-149 32.73555 38.0 32.8 38.0 19.2 38.0 150-151 29.11075 35.5 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 1.0 19 3.0 20 3.0 21 2.0 22 2.0 23 2.0 24 9.0 25 11.0 26 7.0 27 18.0 28 15.0 29 18.0 30 29.0 31 45.0 32 57.0 33 84.0 34 161.0 35 302.0 36 1044.0 37 2183.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.725 14.224999999999998 7.249999999999999 28.799999999999997 2 22.336168084042022 13.806903451725864 34.61730865432716 29.239619809904955 3 17.424999999999997 20.225 29.225 33.125 4 21.275 29.075 25.15 24.5 5 21.525 33.125 24.45 20.9 6 19.900000000000002 36.325 24.175 19.6 7 13.825000000000001 29.2 40.1 16.875 8 17.224999999999998 28.199999999999996 31.3 23.275000000000002 9 17.675 25.124999999999996 33.25 23.95 10-14 19.17 31.480000000000004 25.935000000000002 23.415 15-19 19.665 29.24 28.015 23.080000000000002 20-24 19.555 29.520000000000003 27.735 23.189999999999998 25-29 19.950000000000003 29.720000000000002 27.155 23.175 30-34 19.62 29.09 27.455000000000002 23.835 35-39 19.88 28.915000000000003 27.96 23.244999999999997 40-44 20.235 29.435 27.150000000000002 23.18 45-49 20.01 29.609999999999996 27.115000000000002 23.265 50-54 20.315 29.04 27.145000000000003 23.5 55-59 19.98 29.62 27.26 23.14 60-64 19.93 29.485 26.905 23.68 65-69 20.27 29.225 26.905 23.599999999999998 70-74 19.91 29.92 27.075 23.095 75-79 19.925 29.439999999999998 27.169999999999998 23.465 80-84 20.095 29.01 27.095000000000002 23.799999999999997 85-89 20.150000000000002 28.7 27.33 23.82 90-94 20.745 28.389999999999997 27.195000000000004 23.669999999999998 95-99 20.57 28.910000000000004 27.37 23.150000000000002 100-104 20.775 28.384999999999998 27.365000000000002 23.474999999999998 105-109 20.925 28.549999999999997 26.855 23.669999999999998 110-114 20.544999999999998 29.065 26.974999999999998 23.415 115-119 20.708283313325328 28.876550620248096 27.02581032412965 23.389355742296917 120-124 20.78 29.360000000000003 26.369999999999997 23.49 125-129 21.07 28.645 26.58 23.705000000000002 130-134 20.830000000000002 28.485 26.52 24.165 135-139 21.55 28.310000000000002 26.490000000000002 23.65 140-144 20.885 28.28 26.590000000000003 24.245 145-149 21.08 28.79 26.655 23.474999999999998 150-151 21.475 28.575 26.375 23.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.5 21 2.0 22 1.5 23 1.5 24 2.5 25 6.5 26 7.0 27 10.0 28 13.5 29 11.5 30 19.0 31 32.5 32 41.0 33 48.5 34 61.5 35 85.0 36 98.0 37 114.5 38 140.0 39 174.5 40 194.0 41 199.5 42 237.0 43 257.0 44 262.5 45 265.0 46 259.5 47 246.5 48 224.5 49 200.5 50 166.0 51 140.0 52 123.0 53 97.5 54 72.0 55 52.5 56 36.5 57 31.0 58 24.0 59 14.0 60 7.0 61 3.5 62 2.5 63 1.5 64 1.0 65 0.5 66 1.5 67 1.5 68 1.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.04 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.5874999999999999 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 0.9875 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.625 0.0 0.0 0.0 0.0 102-103 1.85 0.0 0.0 0.0 0.0 104-105 2.0875 0.0 0.0 0.0 0.0 106-107 2.3375 0.0 0.0 0.0 0.0 108-109 2.6624999999999996 0.0 0.0 0.0 0.0 110-111 2.8625 0.0 0.0 0.0 0.0 112-113 3.2375 0.0 0.0 0.0 0.0 114-115 3.65 0.0 0.0 0.0 0.0 116-117 4.125 0.0 0.0 0.0 0.0 118-119 4.574999999999999 0.0 0.0 0.0 0.0 120-121 5.050000000000001 0.0 0.0 0.0 0.0 122-123 5.45 0.0 0.0 0.0 0.0 124-125 5.8875 0.0 0.0 0.0 0.0 126-127 6.4625 0.0 0.0 0.0 0.0 128-129 7.1 0.0 0.0 0.0 0.0 130-131 7.612500000000001 0.0 0.0 0.0 0.0 132-133 8.2625 0.0 0.0 0.0 0.0 134-135 8.825 0.0 0.0 0.0 0.0 136-137 9.425 0.0 0.0 0.0 0.0 138-139 9.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCTTA 10 0.006830828 145.0 1 GAACCTA 10 0.006830828 145.0 145 ATGCCAA 10 0.006830828 145.0 5 >>END_MODULE SRR7169867 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169867_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3535 34.0 33.0 34.0 33.0 34.0 2 33.42225 34.0 33.0 34.0 33.0 34.0 3 33.45325 34.0 33.0 34.0 33.0 34.0 4 33.463 34.0 33.0 34.0 33.0 34.0 5 33.40075 34.0 33.0 34.0 33.0 34.0 6 37.5435 38.0 38.0 38.0 38.0 38.0 7 37.58125 38.0 38.0 38.0 38.0 38.0 8 37.6485 38.0 38.0 38.0 38.0 38.0 9 37.596 38.0 38.0 38.0 38.0 38.0 10-14 37.589999999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.52735 38.0 38.0 38.0 38.0 38.0 20-24 37.5202 38.0 38.0 38.0 38.0 38.0 25-29 37.48455 38.0 38.0 38.0 38.0 38.0 30-34 37.35075 38.0 38.0 38.0 37.6 38.0 35-39 37.075599999999994 38.0 38.0 38.0 36.4 38.0 40-44 37.42835 38.0 38.0 38.0 38.0 38.0 45-49 37.510799999999996 38.0 38.0 38.0 38.0 38.0 50-54 37.49 38.0 38.0 38.0 38.0 38.0 55-59 37.4529 38.0 38.0 38.0 38.0 38.0 60-64 37.29709999999999 38.0 38.0 38.0 37.8 38.0 65-69 37.33630000000001 38.0 38.0 38.0 38.0 38.0 70-74 37.40075 38.0 38.0 38.0 38.0 38.0 75-79 37.3558 38.0 38.0 38.0 38.0 38.0 80-84 37.24365 38.0 38.0 38.0 37.6 38.0 85-89 36.84415 38.0 38.0 38.0 35.8 38.0 90-94 37.1176 38.0 38.0 38.0 36.8 38.0 95-99 37.153800000000004 38.0 38.0 38.0 37.0 38.0 100-104 37.02605 38.0 38.0 38.0 36.6 38.0 105-109 36.74105 38.0 38.0 38.0 35.2 38.0 110-114 36.5303 38.0 37.8 38.0 34.0 38.0 115-119 36.7636 38.0 38.0 38.0 35.6 38.0 120-124 36.63915 38.0 38.0 38.0 35.0 38.0 125-129 35.9352 38.0 37.0 38.0 31.6 38.0 130-134 36.37165 38.0 38.0 38.0 34.2 38.0 135-139 35.9514 38.0 38.0 38.0 33.0 38.0 140-144 35.4534 38.0 37.0 38.0 30.0 38.0 145-149 33.84035000000001 38.0 33.4 38.0 23.6 38.0 150-151 30.421875 35.5 28.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 0.0 5 0.0 6 2.0 7 0.0 8 0.0 9 2.0 10 0.0 11 1.0 12 1.0 13 3.0 14 1.0 15 0.0 16 1.0 17 0.0 18 2.0 19 2.0 20 2.0 21 4.0 22 2.0 23 4.0 24 4.0 25 5.0 26 12.0 27 7.0 28 20.0 29 13.0 30 24.0 31 25.0 32 45.0 33 39.0 34 88.0 35 167.0 36 525.0 37 2988.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.45 25.974999999999998 8.6 21.975 2 26.275 26.875 29.849999999999998 17.0 3 19.8 27.450000000000003 33.35 19.400000000000002 4 25.575 34.275 22.95 17.2 5 23.724999999999998 37.375 20.275000000000002 18.625 6 21.325 38.175 23.5 17.0 7 21.5 21.675 37.5 19.325 8 21.0 26.5 28.349999999999998 24.15 9 21.075 24.9 29.65 24.375 10-14 23.11 29.445 26.11 21.335 15-19 23.055 28.54 27.58 20.825 20-24 22.93 28.410000000000004 27.525 21.135 25-29 23.49 28.249999999999996 27.42 20.84 30-34 23.235 28.599999999999998 27.605 20.560000000000002 35-39 23.200000000000003 27.98 27.38 21.44 40-44 23.05 27.825 28.07 21.055 45-49 23.36 27.875 28.335 20.43 50-54 23.73 27.715 27.589999999999996 20.965 55-59 23.305 28.105000000000004 28.000000000000004 20.59 60-64 22.825 27.68 28.265 21.23 65-69 23.565 27.125 28.305000000000003 21.005 70-74 23.76 27.97 27.675 20.595 75-79 23.415 27.87 28.37 20.345 80-84 22.96 27.855 28.585 20.599999999999998 85-89 23.669999999999998 28.095 27.834999999999997 20.4 90-94 23.955000000000002 28.03 28.095 19.919999999999998 95-99 23.91 27.21 28.01 20.87 100-104 24.07 27.805000000000003 28.33 19.794999999999998 105-109 24.834999999999997 27.495000000000005 27.845 19.825 110-114 24.240000000000002 27.87 28.015 19.875 115-119 24.48 27.435 28.115000000000002 19.97 120-124 24.305 28.03 27.605 20.06 125-129 24.14 28.470000000000002 27.279999999999998 20.11 130-134 25.298794819222888 28.234235135270293 27.30409561434215 19.162874431164674 135-139 25.8 27.79 27.015 19.395 140-144 25.119999999999997 27.72 27.650000000000002 19.509999999999998 145-149 25.480000000000004 28.244999999999997 27.24 19.035 150-151 26.075 28.037499999999998 27.5625 18.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 2.0 26 2.5 27 4.5 28 6.5 29 7.0 30 8.5 31 13.0 32 20.5 33 32.5 34 47.5 35 60.0 36 77.5 37 104.0 38 124.0 39 161.5 40 201.5 41 231.5 42 269.5 43 277.5 44 281.5 45 300.0 46 292.0 47 261.5 48 232.0 49 200.0 50 175.0 51 154.5 52 127.5 53 97.5 54 66.5 55 48.0 56 34.0 57 23.0 58 16.0 59 10.0 60 6.5 61 5.0 62 3.5 63 1.0 64 1.5 65 1.5 66 1.0 67 1.5 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.015 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.5874999999999999 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.85 0.0 0.0 0.0 0.0 94-95 0.9750000000000001 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.6375000000000002 0.0 0.0 0.0 0.0 102-103 1.9 0.0 0.0 0.0 0.0 104-105 2.2249999999999996 0.0 0.0 0.0 0.0 106-107 2.5 0.0 0.0 0.0 0.0 108-109 2.7874999999999996 0.0 0.0 0.0 0.0 110-111 3.025 0.0 0.0 0.0 0.0 112-113 3.4375 0.0 0.0 0.0 0.0 114-115 3.85 0.0 0.0 0.0 0.0 116-117 4.3125 0.0 0.0 0.0 0.0 118-119 4.737500000000001 0.0 0.0 0.0 0.0 120-121 5.175 0.0 0.0 0.0 0.0 122-123 5.5375 0.0 0.0 0.0 0.0 124-125 5.949999999999999 0.0 0.0 0.0 0.0 126-127 6.6125 0.0 0.0 0.0 0.0 128-129 7.2875 0.0 0.0 0.0 0.0 130-131 7.7875 0.0 0.0 0.0 0.0 132-133 8.475000000000001 0.0 0.0 0.0 0.0 134-135 9.075 0.0 0.0 0.0 0.0 136-137 9.7 0.0 0.0 0.0 0.0 138-139 10.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762176 spots for SRR7169867.sra Written 762176 spots for SRR7169867.sra Read 762178 spots for SRR7169867.sra Written 762178 spots for SRR7169867.sra SRR ids: ['SRR7169867.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d5n0ryxv SRR7169867.sra spots: 15243522 blocks: [[1, 762176], [762177, 1524352], [1524353, 2286528], [2286529, 3048704], [3048705, 3810880], [3810881, 4573056], [4573057, 5335232], [5335233, 6097408], [6097409, 6859584], [6859585, 7621760], [7621761, 8383936], [8383937, 9146112], [9146113, 9908288], [9908289, 10670464], [10670465, 11432640], [11432641, 12194816], [12194817, 12956992], [12956993, 13719168], [13719169, 14481344], [14481345, 15243522]] SRR7169867 file size 5143829 SRR7169867 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169867 SRR7169867_1.fastq SRR7169867_2.fastq Input file: SRR7169867_1.fastq Paired file: SRR7169867_2.fastq trimmed: SRR7169867-trimmed-pair1.fastq, SRR7169867-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:46:49 2025 >> started Tue Feb 11 23:47:05 2025 >> done (16.660s) 15243522 read pairs processed; of these: 15471 ( 0.10%) short read pairs filtered out after trimming by size control 9272 ( 0.06%) empty read pairs filtered out after trimming by size control 15218779 (99.84%) read pairs available; of these: 7025473 (46.16%) trimmed read pairs available after processing 8193306 (53.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 7 0.00% 21 4 0.00% 22 8 0.00% 23 5 0.00% 24 5 0.00% 25 4 0.00% 26 6 0.00% 27 3 0.00% 28 3 0.00% 29 6 0.00% 30 11 0.00% 31 5 0.00% 32 10 0.00% 33 9 0.00% 34 11 0.00% 35 4 0.00% 36 10 0.00% 37 14 0.00% 38 17 0.00% 39 18 0.00% 40 24 0.00% 41 23 0.00% 42 25 0.00% 43 22 0.00% 44 25 0.00% 45 31 0.00% 46 27 0.00% 47 50 0.00% 48 49 0.00% 49 55 0.00% 50 73 0.00% 51 78 0.00% 52 71 0.00% 53 119 0.00% 54 128 0.00% 55 143 0.00% 56 146 0.00% 57 159 0.00% 58 192 0.00% 59 236 0.00% 60 289 0.00% 61 343 0.00% 62 344 0.00% 63 421 0.00% 64 472 0.00% 65 503 0.00% 66 604 0.00% 67 704 0.00% 68 794 0.01% 69 898 0.01% 70 1104 0.01% 71 1292 0.01% 72 1532 0.01% 73 1768 0.01% 74 1933 0.01% 75 2132 0.01% 76 2526 0.02% 77 2854 0.02% 78 2997 0.02% 79 3427 0.02% 80 3767 0.02% 81 4257 0.03% 82 4898 0.03% 83 5620 0.04% 84 6783 0.04% 85 7856 0.05% 86 8089 0.05% 87 8720 0.06% 88 9258 0.06% 89 9867 0.06% 90 10589 0.07% 91 11696 0.08% 92 12441 0.08% 93 13390 0.09% 94 14661 0.10% 95 15511 0.10% 96 16548 0.11% 97 16528 0.11% 98 17344 0.11% 99 18077 0.12% 100 19151 0.13% 101 20079 0.13% 102 21602 0.14% 103 22776 0.15% 104 24218 0.16% 105 25693 0.17% 106 26538 0.17% 107 27021 0.18% 108 27891 0.18% 109 28448 0.19% 110 29252 0.19% 111 30737 0.20% 112 31846 0.21% 113 33895 0.22% 114 34957 0.23% 115 36409 0.24% 116 37624 0.25% 117 38859 0.26% 118 38953 0.26% 119 39103 0.26% 120 39992 0.26% 121 41022 0.27% 122 42439 0.28% 123 43943 0.29% 124 46143 0.30% 125 47335 0.31% 126 49432 0.32% 127 49660 0.33% 128 51212 0.34% 129 51730 0.34% 130 53257 0.35% 131 53644 0.35% 132 55594 0.37% 133 57562 0.38% 134 60094 0.39% 135 62974 0.41% 136 65199 0.43% 137 67381 0.44% 138 70155 0.46% 139 73087 0.48% 140 75856 0.50% 141 80361 0.53% 142 85804 0.56% 143 93917 0.62% 144 107197 0.70% 145 123564 0.81% 146 147862 0.97% 147 193705 1.27% 148 285055 1.87% 149 580828 3.82% 150 3329737 21.88% 151 8193306 53.84% 15218779 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=34 prefix-density=0.24 prefix-fanout=2.3 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=257.95 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=17.6 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=34 prefix-density=0.24 prefix-fanout=2.3 sequence=ATTGAATGGCCAGTTCAGATGGATTTCTTCTCAGATGAACCGCGTGAGGAATGGAGAGCTCTACCGTTACATTTGTGATACCAAGGGAGCTTTCGTGCAGCCTGCTTTGTATGAGGCTTTTGGATTGACTGTTGTTGAGGCCATGACATGTGGTTTGCCAACCTTTGCTACTTGCAATGGTGGTCCTGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAG criterion=fanout-score sequence-density=0.12 sequence-density-rank=21 fanout-score=47.14 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=12.4 sequence=TGTTGGTGGTGG SRR7169867 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:48:19 Started mapping on | Feb 11 23:48:19 Finished on | Feb 11 23:49:58 Mapping speed, Million of reads per hour | 553.41 Number of input reads | 15218779 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 12955197 Uniquely mapped reads % | 85.13% Average mapped length | 289.96 Number of splices: Total | 11776255 Number of splices: Annotated (sjdb) | 11566942 Number of splices: GT/AG | 11605484 Number of splices: GC/AG | 132205 Number of splices: AT/AC | 9493 Number of splices: Non-canonical | 29073 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 218695 % of reads mapped to multiple loci | 1.44% Number of reads mapped to too many loci | 18147 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.29% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2056020 2056020 2056020 N_multimapping 218695 218695 218695 N_noFeature 300074 12794809 350591 N_ambiguous 197401 1023 86864 UnstrandedReadsAssigned:12457722 PositiveStrandReadsAssigned:159365 NegativeStrandReadsAssigned:12517742 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=145 echo kmer=141 SRR7169867 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169867-trimmed-pair1.fastq SRR7169867-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,218,779 reads, 13,845,558 reads pseudoaligned [quant] estimated average fragment length: 219.135 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR7169867.ke.tsv 34699 SRR7169867.se.tsv 87100 total ==> SRR7169867.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.87 229 9.0974 Potri.005G024800.1.v4.1 1035 816.865 36 3.15119 Potri.004G059700.1.v4.1 961 742.865 5 0.481262 Potri.007G009000.2.v4.1 1416 1197.87 0 0 Potri.003G141000.2.v4.1 2943 2724.87 256.065 6.71935 Potri.016G087400.1.v4.1 270 92.669 1473.51 1136.95 Potri.015G069301.1.v4.1 564 349.318 0 0 Potri.010G195200.1.v4.1 1773 1554.87 3 0.137959 Potri.012G127500.1.v4.1 977 758.865 5157 485.908 ==> SRR7169867.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1366 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 225 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169867 completed mapping pipeline successfully