Starting /dee2/code/volunteer_pipeline.sh SRR7169868 current disk space = 3051962081280 free memory = 1401304512 SRR7169868 SRAfilesize 650fd49df5de4b29d03e03e06cb9e290 SRR7169868.sra SRR7169868.sra file validated SRR7169868 is paired end SRR7169868 is conventional basespace SRR7169868 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169868_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.2665 30.0 18.0 33.0 18.0 34.0 2 29.96425 31.0 29.0 33.0 25.0 33.0 3 32.36325 33.0 33.0 33.0 31.0 34.0 4 32.94125 33.0 33.0 34.0 33.0 34.0 5 33.32625 33.0 33.0 34.0 33.0 34.0 6 37.3925 38.0 38.0 38.0 36.0 38.0 7 37.69025 38.0 38.0 38.0 38.0 38.0 8 37.709 38.0 38.0 38.0 38.0 38.0 9 37.7705 38.0 38.0 38.0 38.0 38.0 10-14 37.66945 38.0 38.0 38.0 37.8 38.0 15-19 37.4071 38.0 38.0 38.0 37.2 38.0 20-24 37.692949999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.705799999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.49715 38.0 38.0 38.0 37.6 38.0 35-39 37.557550000000006 38.0 38.0 38.0 37.8 38.0 40-44 37.417100000000005 38.0 38.0 38.0 37.2 38.0 45-49 37.3722 38.0 38.0 38.0 37.2 38.0 50-54 37.22935 38.0 38.0 38.0 36.4 38.0 55-59 36.986749999999994 38.0 38.0 38.0 35.6 38.0 60-64 37.1413 38.0 38.0 38.0 36.4 38.0 65-69 37.228750000000005 38.0 38.0 38.0 36.4 38.0 70-74 36.927949999999996 38.0 38.0 38.0 35.6 38.0 75-79 37.03320000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.99325 38.0 38.0 38.0 36.0 38.0 85-89 36.92635 38.0 38.0 38.0 35.6 38.0 90-94 36.735749999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.6214 38.0 38.0 38.0 34.2 38.0 100-104 36.470949999999995 38.0 37.8 38.0 34.0 38.0 105-109 35.767999999999994 38.0 36.6 38.0 31.2 38.0 110-114 36.13985 38.0 37.0 38.0 33.6 38.0 115-119 35.98515 38.0 37.0 38.0 33.0 38.0 120-124 35.87335 38.0 36.6 38.0 32.2 38.0 125-129 35.486450000000005 38.0 36.2 38.0 30.8 38.0 130-134 35.071000000000005 38.0 35.4 38.0 28.4 38.0 135-139 34.95035 38.0 35.4 38.0 28.0 38.0 140-144 33.8719 38.0 34.0 38.0 22.4 38.0 145-149 33.0595 38.0 33.2 38.0 18.6 38.0 150-151 28.891 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 3.0 13 1.0 14 0.0 15 0.0 16 3.0 17 3.0 18 1.0 19 3.0 20 1.0 21 5.0 22 1.0 23 6.0 24 6.0 25 7.0 26 11.0 27 18.0 28 14.0 29 22.0 30 33.0 31 37.0 32 79.0 33 89.0 34 158.0 35 367.0 36 1082.0 37 2048.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.775 11.525 11.025 33.675 2 22.6 14.174999999999999 33.800000000000004 29.425 3 19.975 18.775 27.175 34.075 4 24.349999999999998 27.275 21.7 26.674999999999997 5 22.475 30.7 25.474999999999998 21.349999999999998 6 20.525 34.225 24.825 20.424999999999997 7 15.8 26.375 41.175 16.650000000000002 8 19.525000000000002 25.324999999999996 30.2 24.95 9 17.75 24.2 34.699999999999996 23.35 10-14 19.875 29.915000000000003 27.02 23.189999999999998 15-19 20.355 28.985 27.55 23.11 20-24 20.76 28.62 27.495000000000005 23.125 25-29 20.78 28.535 27.615000000000002 23.07 30-34 20.275000000000002 29.020000000000003 27.279999999999998 23.425 35-39 20.865000000000002 28.970000000000002 27.125 23.04 40-44 20.435 29.09 27.145000000000003 23.330000000000002 45-49 20.580000000000002 28.825 27.465 23.13 50-54 19.98 28.33 28.345 23.345 55-59 20.544999999999998 28.910000000000004 26.955000000000002 23.59 60-64 20.385 28.955 27.345000000000002 23.315 65-69 20.465 29.005 27.169999999999998 23.36 70-74 20.599999999999998 28.82 27.595 22.985 75-79 21.175 28.57 27.26 22.994999999999997 80-84 20.68 28.51 27.339999999999996 23.47 85-89 20.064999999999998 27.800000000000004 27.944999999999997 24.19 90-94 20.73 28.17 27.77 23.330000000000002 95-99 20.19 27.755000000000003 28.105000000000004 23.95 100-104 21.195 28.055000000000003 27.265 23.485 105-109 20.615 28.935 27.575 22.875 110-114 21.48 28.325 27.339999999999996 22.855 115-119 21.865000000000002 28.96 27.279999999999998 21.895 120-124 20.965 28.235 27.029999999999998 23.77 125-129 20.544999999999998 28.49 27.655 23.31 130-134 21.09 28.025 27.79 23.095 135-139 20.880000000000003 28.205000000000002 27.665 23.25 140-144 20.325 27.944999999999997 27.96 23.77 145-149 20.89 28.134999999999998 27.025 23.95 150-151 20.3625 28.037499999999998 27.575 24.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 2.0 25 5.0 26 7.0 27 6.0 28 6.5 29 11.0 30 18.0 31 25.5 32 31.0 33 36.5 34 50.5 35 68.5 36 83.0 37 96.5 38 120.5 39 159.0 40 180.0 41 195.5 42 236.5 43 275.0 44 283.0 45 272.0 46 277.5 47 272.5 48 242.5 49 220.0 50 190.5 51 136.5 52 111.0 53 103.0 54 69.5 55 46.5 56 42.5 57 37.5 58 21.0 59 12.0 60 12.5 61 9.5 62 5.5 63 3.0 64 2.5 65 2.5 66 2.0 67 3.0 68 2.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 0.9875 0.0 0.0 0.0 0.0 114-115 1.1375 0.0 0.0 0.0 0.0 116-117 1.2625 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.55 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 1.925 0.0 0.0 0.0 0.0 126-127 2.1624999999999996 0.0 0.0 0.0 0.0 128-129 2.325 0.0 0.0 0.0 0.0 130-131 2.55 0.0 0.0 0.0 0.0 132-133 2.7625 0.0 0.0 0.0 0.0 134-135 2.9375 0.0 0.0 0.0 0.0 136-137 3.15 0.0 0.0 0.0 0.0 138-139 3.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169868 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169868_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3315 34.0 33.0 34.0 33.0 34.0 2 33.43325 34.0 33.0 34.0 33.0 34.0 3 33.44275 34.0 33.0 34.0 33.0 34.0 4 33.37575 34.0 33.0 34.0 33.0 34.0 5 33.3935 34.0 33.0 34.0 33.0 34.0 6 37.57125 38.0 38.0 38.0 38.0 38.0 7 37.572 38.0 38.0 38.0 38.0 38.0 8 37.52675 38.0 38.0 38.0 38.0 38.0 9 37.061 38.0 38.0 38.0 37.0 38.0 10-14 37.440099999999994 38.0 38.0 38.0 37.8 38.0 15-19 37.513850000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.393299999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.179500000000004 38.0 38.0 38.0 36.8 38.0 30-34 37.432900000000004 38.0 38.0 38.0 37.8 38.0 35-39 37.258950000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.31105 38.0 38.0 38.0 37.2 38.0 45-49 37.29885 38.0 38.0 38.0 37.6 38.0 50-54 36.8637 38.0 38.0 38.0 35.6 38.0 55-59 37.30499999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.30105 38.0 38.0 38.0 37.0 38.0 65-69 36.95125 38.0 38.0 38.0 35.8 38.0 70-74 36.4019 38.0 38.0 38.0 33.6 38.0 75-79 36.785149999999994 38.0 38.0 38.0 35.2 38.0 80-84 36.35029999999999 38.0 37.4 38.0 33.4 38.0 85-89 36.946600000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.96795 38.0 38.0 38.0 36.0 38.0 95-99 36.8652 38.0 38.0 38.0 35.8 38.0 100-104 36.46545 38.0 38.0 38.0 34.4 38.0 105-109 36.460300000000004 38.0 38.0 38.0 34.2 38.0 110-114 36.4834 38.0 38.0 38.0 34.4 38.0 115-119 36.31875 38.0 38.0 38.0 34.2 38.0 120-124 35.9912 38.0 37.6 38.0 33.2 38.0 125-129 35.85245 38.0 37.2 38.0 33.0 38.0 130-134 35.655449999999995 38.0 36.6 38.0 32.0 38.0 135-139 35.38845 38.0 36.2 38.0 31.4 38.0 140-144 34.9563 38.0 36.0 38.0 28.8 38.0 145-149 34.486599999999996 38.0 35.4 38.0 28.0 38.0 150-151 30.513875 35.5 28.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 1.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 2.0 11 1.0 12 2.0 13 1.0 14 3.0 15 4.0 16 1.0 17 1.0 18 3.0 19 2.0 20 6.0 21 6.0 22 4.0 23 10.0 24 6.0 25 12.0 26 9.0 27 12.0 28 20.0 29 22.0 30 31.0 31 34.0 32 58.0 33 74.0 34 147.0 35 206.0 36 610.0 37 2705.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.199999999999996 20.65 15.925 28.225 2 25.374999999999996 28.725 28.775000000000002 17.125 3 21.175 29.875 29.925 19.025 4 22.45 33.775 23.724999999999998 20.05 5 23.375 36.5 22.35 17.775 6 21.099999999999998 37.625 23.400000000000002 17.875 7 20.424999999999997 21.975 37.974999999999994 19.625 8 22.85 23.925 27.700000000000003 25.525 9 21.575 25.35 30.0 23.075000000000003 10-14 23.1 28.455000000000002 26.645000000000003 21.8 15-19 22.46 28.185 27.889999999999997 21.465 20-24 22.59 28.475 27.134999999999998 21.8 25-29 22.825 28.535 27.625 21.015 30-34 22.8 27.985 27.825 21.39 35-39 22.735 28.060000000000002 27.725 21.48 40-44 23.145 27.525 27.805000000000003 21.525 45-49 22.805 27.544999999999998 28.249999999999996 21.4 50-54 22.86 28.22 27.944999999999997 20.974999999999998 55-59 23.375 28.37 27.46 20.794999999999998 60-64 23.275000000000002 28.050000000000004 27.810000000000002 20.865000000000002 65-69 23.155 28.03 27.994999999999997 20.82 70-74 23.169999999999998 28.134999999999998 27.544999999999998 21.15 75-79 23.345 27.860000000000003 27.839999999999996 20.955 80-84 23.655 27.639999999999997 27.435 21.27 85-89 23.47 27.150000000000002 28.115000000000002 21.265 90-94 23.025000000000002 28.13 27.99 20.855 95-99 22.985 27.794999999999998 27.99 21.23 100-104 23.189999999999998 28.32 27.51 20.979999999999997 105-109 23.25 27.944999999999997 27.584999999999997 21.22 110-114 23.985 27.400000000000002 27.965 20.65 115-119 23.599999999999998 28.199999999999996 27.37 20.830000000000002 120-124 23.68 27.779999999999998 27.800000000000004 20.74 125-129 23.96 27.944999999999997 27.200000000000003 20.895 130-134 24.45 27.544999999999998 27.834999999999997 20.169999999999998 135-139 23.59 27.88 27.450000000000003 21.08 140-144 24.490000000000002 27.200000000000003 27.82 20.49 145-149 23.685000000000002 27.115000000000002 27.985 21.215 150-151 23.3875 27.437499999999996 27.525 21.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 2.0 25 1.0 26 1.0 27 2.0 28 4.5 29 5.0 30 9.0 31 12.0 32 14.5 33 28.5 34 41.0 35 51.0 36 76.5 37 108.5 38 139.0 39 164.0 40 200.0 41 238.0 42 275.0 43 292.5 44 276.0 45 285.0 46 287.0 47 263.5 48 241.5 49 215.5 50 178.5 51 139.5 52 109.0 53 87.0 54 65.5 55 48.0 56 36.5 57 27.0 58 21.0 59 14.5 60 9.5 61 6.0 62 5.0 63 4.0 64 3.5 65 2.5 66 1.5 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.65 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.8999999999999999 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.2999999999999998 0.0 0.0 0.0 0.0 120-121 1.45 0.0 0.0 0.0 0.0 122-123 1.5625 0.0 0.0 0.0 0.0 124-125 1.825 0.0 0.0 0.0 0.0 126-127 2.075 0.0 0.0 0.0 0.0 128-129 2.25 0.0 0.0 0.0 0.0 130-131 2.5 0.0 0.0 0.0 0.0 132-133 2.7125 0.0 0.0 0.0 0.0 134-135 2.9000000000000004 0.0 0.0 0.0 0.0 136-137 3.125 0.0 0.0 0.0 0.0 138-139 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGTGG 10 0.006830828 145.0 9 >>END_MODULE Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570712 spots for SRR7169868.sra Written 570712 spots for SRR7169868.sra Read 570713 spots for SRR7169868.sra Written 570713 spots for SRR7169868.sra SRR ids: ['SRR7169868.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ygtlvbgw SRR7169868.sra spots: 11414241 blocks: [[1, 570712], [570713, 1141424], [1141425, 1712136], [1712137, 2282848], [2282849, 2853560], [2853561, 3424272], [3424273, 3994984], [3994985, 4565696], [4565697, 5136408], [5136409, 5707120], [5707121, 6277832], [6277833, 6848544], [6848545, 7419256], [7419257, 7989968], [7989969, 8560680], [8560681, 9131392], [9131393, 9702104], [9702105, 10272816], [10272817, 10843528], [10843529, 11414241]] SRR7169868 file size 3846211 SRR7169868 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169868 SRR7169868_1.fastq SRR7169868_2.fastq Input file: SRR7169868_1.fastq Paired file: SRR7169868_2.fastq trimmed: SRR7169868-trimmed-pair1.fastq, SRR7169868-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:53:54 2025 >> started Tue Feb 11 23:54:06 2025 >> done (11.949s) 11414241 read pairs processed; of these: 10834 ( 0.09%) short read pairs filtered out after trimming by size control 9617 ( 0.08%) empty read pairs filtered out after trimming by size control 11393790 (99.82%) read pairs available; of these: 4645987 (40.78%) trimmed read pairs available after processing 6747803 (59.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 0 0.00% 21 1 0.00% 22 3 0.00% 23 2 0.00% 24 1 0.00% 25 4 0.00% 26 5 0.00% 27 2 0.00% 28 5 0.00% 29 1 0.00% 30 2 0.00% 31 2 0.00% 32 2 0.00% 33 2 0.00% 34 5 0.00% 35 2 0.00% 36 3 0.00% 37 3 0.00% 38 3 0.00% 39 7 0.00% 40 12 0.00% 41 12 0.00% 42 9 0.00% 43 15 0.00% 44 12 0.00% 45 14 0.00% 46 21 0.00% 47 21 0.00% 48 26 0.00% 49 35 0.00% 50 33 0.00% 51 42 0.00% 52 35 0.00% 53 44 0.00% 54 65 0.00% 55 71 0.00% 56 64 0.00% 57 82 0.00% 58 67 0.00% 59 80 0.00% 60 122 0.00% 61 160 0.00% 62 165 0.00% 63 177 0.00% 64 218 0.00% 65 214 0.00% 66 223 0.00% 67 272 0.00% 68 277 0.00% 69 362 0.00% 70 398 0.00% 71 458 0.00% 72 501 0.00% 73 626 0.01% 74 689 0.01% 75 792 0.01% 76 840 0.01% 77 924 0.01% 78 969 0.01% 79 1121 0.01% 80 1236 0.01% 81 1338 0.01% 82 1607 0.01% 83 1812 0.02% 84 2369 0.02% 85 2906 0.03% 86 3011 0.03% 87 3238 0.03% 88 3489 0.03% 89 3613 0.03% 90 3784 0.03% 91 4032 0.04% 92 4308 0.04% 93 4626 0.04% 94 4951 0.04% 95 5267 0.05% 96 5628 0.05% 97 5656 0.05% 98 5929 0.05% 99 6136 0.05% 100 6396 0.06% 101 6965 0.06% 102 7167 0.06% 103 7667 0.07% 104 7934 0.07% 105 8459 0.07% 106 8716 0.08% 107 9000 0.08% 108 9294 0.08% 109 9356 0.08% 110 9847 0.09% 111 10417 0.09% 112 10769 0.09% 113 10845 0.10% 114 11752 0.10% 115 12090 0.11% 116 12757 0.11% 117 12736 0.11% 118 13106 0.12% 119 13405 0.12% 120 13645 0.12% 121 14124 0.12% 122 14516 0.13% 123 15355 0.13% 124 16058 0.14% 125 17126 0.15% 126 17573 0.15% 127 17940 0.16% 128 18995 0.17% 129 19655 0.17% 130 20257 0.18% 131 21229 0.19% 132 22142 0.19% 133 23744 0.21% 134 25012 0.22% 135 26714 0.23% 136 28933 0.25% 137 31148 0.27% 138 33614 0.30% 139 36158 0.32% 140 39141 0.34% 141 43426 0.38% 142 48386 0.42% 143 55746 0.49% 144 66944 0.59% 145 84045 0.74% 146 108337 0.95% 147 146477 1.29% 148 230530 2.02% 149 474461 4.16% 150 2630615 23.09% 151 6747803 59.22% 11393790 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=38 prefix-density=0.22 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=332.92 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=20.6 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=41 prefix-density=0.26 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.12 sequence-density-rank=15 fanout-score=49.28 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=12.3 sequence=TGTTGGTGGTGG SRR7169868 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:54:55 Started mapping on | Feb 11 23:54:55 Finished on | Feb 11 23:55:55 Mapping speed, Million of reads per hour | 683.63 Number of input reads | 11393790 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10776423 Uniquely mapped reads % | 94.58% Average mapped length | 296.12 Number of splices: Total | 10343422 Number of splices: Annotated (sjdb) | 10179041 Number of splices: GT/AG | 10196050 Number of splices: GC/AG | 118418 Number of splices: AT/AC | 7675 Number of splices: Non-canonical | 21279 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 202356 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 14605 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.49% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 425502 425502 425502 N_multimapping 202356 202356 202356 N_noFeature 218031 10657923 258783 N_ambiguous 125264 600 47136 UnstrandedReadsAssigned:10433128 PositiveStrandReadsAssigned:117900 NegativeStrandReadsAssigned:10470504 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169868 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169868-trimmed-pair1.fastq SRR7169868-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,393,790 reads, 10,376,993 reads pseudoaligned [quant] estimated average fragment length: 289.722 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,024 rounds 52401 SRR7169868.ke.tsv 34699 SRR7169868.se.tsv 87100 total ==> SRR7169868.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1729.28 185 10.5139 Potri.005G024800.1.v4.1 1035 746.278 26 3.42397 Potri.004G059700.1.v4.1 961 672.284 3 0.438556 Potri.007G009000.2.v4.1 1416 1127.28 0 0 Potri.003G141000.2.v4.1 2943 2654.28 184.03 6.81394 Potri.016G087400.1.v4.1 270 73.0022 782 1052.76 Potri.015G069301.1.v4.1 564 283.224 0 0 Potri.010G195200.1.v4.1 1773 1484.28 10 0.662128 Potri.012G127500.1.v4.1 977 688.284 3942 562.867 ==> SRR7169868.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 995 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 158 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169868 completed mapping pipeline successfully