Starting /dee2/code/volunteer_pipeline.sh SRR7169869 current disk space = 3051515985920 free memory = 1447687184 SRR7169869 SRAfilesize 5b67c5d2b0be46bfc38926a2b6759922 SRR7169869.sra SRR7169869.sra file validated SRR7169869 is paired end SRR7169869 is conventional basespace SRR7169869 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169869_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.72975 18.0 18.0 18.0 18.0 32.0 2 28.859 29.0 27.0 31.0 27.0 33.0 3 31.156 31.0 30.0 33.0 29.0 33.0 4 32.5045 33.0 33.0 33.0 31.0 33.0 5 32.98475 33.0 33.0 34.0 33.0 34.0 6 36.86075 38.0 37.0 38.0 35.0 38.0 7 35.50825 38.0 37.0 38.0 29.0 38.0 8 36.919 38.0 37.0 38.0 35.0 38.0 9 37.42925 38.0 38.0 38.0 37.0 38.0 10-14 37.55645 38.0 38.0 38.0 37.4 38.0 15-19 37.56375 38.0 38.0 38.0 37.8 38.0 20-24 37.62435 38.0 38.0 38.0 38.0 38.0 25-29 37.6118 38.0 38.0 38.0 38.0 38.0 30-34 37.53655 38.0 38.0 38.0 37.8 38.0 35-39 37.49445 38.0 38.0 38.0 37.0 38.0 40-44 37.45195 38.0 38.0 38.0 37.2 38.0 45-49 37.49945 38.0 38.0 38.0 37.2 38.0 50-54 37.28920000000001 38.0 38.0 38.0 36.6 38.0 55-59 36.9872 38.0 38.0 38.0 35.4 38.0 60-64 37.1167 38.0 38.0 38.0 36.0 38.0 65-69 36.528600000000004 38.0 37.4 38.0 33.6 38.0 70-74 37.02884999999999 38.0 38.0 38.0 35.6 38.0 75-79 37.096050000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.92655 38.0 38.0 38.0 35.6 38.0 85-89 36.7952 38.0 38.0 38.0 35.0 38.0 90-94 35.442499999999995 38.0 36.2 38.0 28.0 38.0 95-99 36.2063 38.0 36.8 38.0 32.8 38.0 100-104 35.560199999999995 38.0 36.4 38.0 29.8 38.0 105-109 35.970000000000006 38.0 36.6 38.0 32.0 38.0 110-114 35.184099999999994 38.0 35.8 38.0 27.8 38.0 115-119 34.869600000000005 38.0 35.2 38.0 25.6 38.0 120-124 34.10025 37.6 33.2 38.0 25.2 38.0 125-129 34.38655 38.0 34.8 38.0 24.0 38.0 130-134 34.823750000000004 38.0 34.8 38.0 27.2 38.0 135-139 34.57015 38.0 34.6 38.0 24.6 38.0 140-144 33.5067 37.6 33.0 38.0 21.8 38.0 145-149 32.99175 37.4 33.4 38.0 18.6 38.0 150-151 30.0665 36.5 28.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 4.0 19 3.0 20 1.0 21 6.0 22 5.0 23 9.0 24 7.0 25 11.0 26 10.0 27 13.0 28 20.0 29 29.0 30 49.0 31 61.0 32 92.0 33 154.0 34 257.0 35 490.0 36 1325.0 37 1450.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.5 16.825000000000003 7.199999999999999 34.475 2 22.225 13.5 34.449999999999996 29.825000000000003 3 19.15 19.25 26.5 35.099999999999994 4 23.275000000000002 26.55 24.25 25.924999999999997 5 22.400000000000002 32.800000000000004 22.900000000000002 21.9 6 20.825 34.25 25.05 19.875 7 15.75 27.325 39.6 17.325 8 17.150000000000002 26.25 31.075000000000003 25.525 9 18.05 24.675 33.85 23.425 10-14 19.689999999999998 30.365 26.83 23.115 15-19 19.900000000000002 29.099999999999998 26.83 24.169999999999998 20-24 19.925 28.59 27.41 24.075 25-29 19.634999999999998 29.98 26.88 23.505000000000003 30-34 20.244999999999997 29.154999999999998 26.99 23.61 35-39 19.73 29.104999999999997 27.435 23.73 40-44 20.155 28.73 27.639999999999997 23.474999999999998 45-49 20.215 29.005 26.99 23.79 50-54 20.22 28.925 26.815 24.04 55-59 20.28 28.82 27.334999999999997 23.565 60-64 19.845 29.035 27.07 24.05 65-69 19.994999999999997 28.59 27.815 23.599999999999998 70-74 20.66 29.185 26.805 23.35 75-79 21.025 28.485 27.405 23.085 80-84 20.79 28.34 27.125 23.745 85-89 20.025000000000002 28.42 27.565 23.990000000000002 90-94 20.169999999999998 28.884999999999998 26.965 23.98 95-99 20.575 27.800000000000004 27.55 24.075 100-104 20.325 28.854999999999997 27.235 23.585 105-109 20.4 28.455000000000002 27.71 23.435 110-114 20.355 28.58 27.089999999999996 23.974999999999998 115-119 21.000701192026444 28.473404788139838 27.291395372132627 23.23449864770109 120-124 20.72969320854812 27.846454131424853 27.56618787848456 23.857664781542464 125-129 21.25 27.98 27.495000000000005 23.275000000000002 130-134 21.16 28.03 26.669999999999998 24.14 135-139 20.705000000000002 28.294999999999998 27.12 23.880000000000003 140-144 21.010505252626313 27.848924462231118 26.803401700850426 24.337168584292147 145-149 21.125 27.35 27.67 23.855 150-151 20.200000000000003 28.299999999999997 27.1375 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 2.5 23 2.5 24 1.0 25 2.0 26 4.5 27 6.5 28 5.5 29 12.0 30 22.0 31 24.5 32 28.5 33 38.0 34 47.5 35 67.0 36 86.5 37 103.0 38 135.0 39 162.0 40 184.0 41 208.5 42 238.0 43 263.5 44 281.0 45 274.0 46 265.0 47 258.0 48 235.5 49 207.5 50 172.0 51 147.0 52 120.5 53 89.0 54 65.5 55 50.5 56 40.0 57 36.5 58 29.0 59 17.5 60 12.0 61 11.5 62 8.5 63 5.5 64 5.0 65 3.5 66 3.0 67 4.5 68 4.0 69 2.0 70 2.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.16999999999999998 120-124 0.095 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.05 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.2508780732563974 0.5 3 0.050175614651279475 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.6125 0.0 0.0 0.0 0.0 116-117 1.7374999999999998 0.0 0.0 0.0 0.0 118-119 1.9125 0.0 0.0 0.0 0.0 120-121 2.0875000000000004 0.0 0.0 0.0 0.0 122-123 2.2750000000000004 0.0 0.0 0.0 0.0 124-125 2.425 0.0 0.0 0.0 0.0 126-127 2.6125 0.0 0.0 0.0 0.0 128-129 2.875 0.0 0.0 0.0 0.0 130-131 3.15 0.0 0.0 0.0 0.0 132-133 3.5125 0.0 0.0 0.0 0.0 134-135 3.8 0.0 0.0 0.0 0.0 136-137 4.1625 0.0 0.0 0.0 0.0 138-139 4.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCCT 10 0.006846698 144.88751 4 TTGAAAG 10 0.006846698 144.88751 9 >>END_MODULE SRR7169869 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169869_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1165 34.0 33.0 34.0 32.0 34.0 2 33.25675 34.0 33.0 34.0 33.0 34.0 3 33.3175 34.0 33.0 34.0 33.0 34.0 4 33.182 34.0 33.0 34.0 33.0 34.0 5 33.22875 34.0 33.0 34.0 33.0 34.0 6 37.3625 38.0 38.0 38.0 38.0 38.0 7 37.435 38.0 38.0 38.0 38.0 38.0 8 37.37675 38.0 38.0 38.0 38.0 38.0 9 37.391 38.0 38.0 38.0 38.0 38.0 10-14 37.35080000000001 38.0 38.0 38.0 37.4 38.0 15-19 37.373450000000005 38.0 38.0 38.0 37.4 38.0 20-24 37.0185 38.0 37.8 38.0 35.6 38.0 25-29 35.756249999999994 38.0 36.8 38.0 29.0 38.0 30-34 37.04275 38.0 37.8 38.0 35.6 38.0 35-39 37.28315 38.0 38.0 38.0 37.0 38.0 40-44 37.083549999999995 38.0 38.0 38.0 36.4 38.0 45-49 37.182300000000005 38.0 38.0 38.0 36.8 38.0 50-54 37.0422 38.0 38.0 38.0 36.2 38.0 55-59 37.1634 38.0 38.0 38.0 36.6 38.0 60-64 37.026650000000004 38.0 38.0 38.0 36.2 38.0 65-69 37.0385 38.0 38.0 38.0 36.0 38.0 70-74 37.12075 38.0 38.0 38.0 36.4 38.0 75-79 37.077200000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.95525 38.0 38.0 38.0 36.0 38.0 85-89 36.6006 38.0 38.0 38.0 34.4 38.0 90-94 36.925 38.0 38.0 38.0 36.0 38.0 95-99 36.78725000000001 38.0 38.0 38.0 35.2 38.0 100-104 36.56875 38.0 38.0 38.0 34.4 38.0 105-109 36.50045 38.0 38.0 38.0 34.0 38.0 110-114 36.449349999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.295300000000005 38.0 38.0 38.0 34.0 38.0 120-124 36.055400000000006 38.0 37.2 38.0 33.2 38.0 125-129 35.80825 38.0 36.8 38.0 32.6 38.0 130-134 35.60705 38.0 36.2 38.0 31.2 38.0 135-139 34.9111 38.0 35.6 38.0 27.6 38.0 140-144 34.788199999999996 38.0 35.2 38.0 27.8 38.0 145-149 33.83075 38.0 34.8 38.0 23.2 38.0 150-151 30.428875 36.5 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 1.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 3.0 15 1.0 16 3.0 17 1.0 18 1.0 19 3.0 20 8.0 21 3.0 22 5.0 23 4.0 24 10.0 25 11.0 26 18.0 27 20.0 28 20.0 29 23.0 30 31.0 31 39.0 32 74.0 33 104.0 34 140.0 35 251.0 36 705.0 37 2514.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.875 22.900000000000002 11.85 24.375 2 27.224999999999998 25.874999999999996 29.675 17.224999999999998 3 21.675 28.025 30.425 19.875 4 24.575 33.15 22.8 19.475 5 24.25 35.85 21.625 18.275 6 20.4 37.45 22.900000000000002 19.25 7 20.65 22.7 37.05 19.6 8 21.0 25.575 28.349999999999998 25.074999999999996 9 21.224999999999998 25.074999999999996 29.9 23.799999999999997 10-14 22.895 29.080000000000002 26.290000000000003 21.735 15-19 23.01 27.455000000000002 27.894999999999996 21.64 20-24 23.39 27.889999999999997 27.49 21.23 25-29 22.869999999999997 28.015 27.71 21.404999999999998 30-34 22.735 28.000000000000004 28.075 21.19 35-39 22.7 27.575 27.93 21.795 40-44 22.915 28.345 27.750000000000004 20.990000000000002 45-49 22.855 28.51 27.750000000000004 20.885 50-54 22.795 28.449999999999996 27.675 21.08 55-59 23.044999999999998 27.685 27.685 21.584999999999997 60-64 23.1 28.175 27.944999999999997 20.78 65-69 23.26 28.13 28.15 20.46 70-74 23.119999999999997 27.834999999999997 27.77 21.275 75-79 23.805 27.985 27.32 20.89 80-84 23.22 27.99 27.88 20.91 85-89 24.060000000000002 27.965 27.694999999999997 20.28 90-94 23.845 27.215 27.935 21.005 95-99 23.36 28.09 27.905 20.645 100-104 24.224999999999998 27.744999999999997 27.85 20.18 105-109 23.880000000000003 28.04 27.685 20.395 110-114 23.27 28.000000000000004 27.815 20.915 115-119 24.165 28.110000000000003 27.025 20.7 120-124 24.335 28.000000000000004 27.29 20.375 125-129 23.96 27.634999999999998 28.095 20.31 130-134 23.799999999999997 27.145000000000003 28.044999999999998 21.01 135-139 24.582040244268697 27.655420963059363 27.365101611772953 20.39743718089899 140-144 24.395 27.705000000000002 27.46 20.44 145-149 24.279999999999998 27.925 27.279999999999998 20.515 150-151 25.124999999999996 26.724999999999998 28.0875 20.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 3.5 28 6.0 29 5.5 30 11.5 31 19.0 32 26.5 33 30.0 34 35.5 35 55.0 36 84.0 37 110.0 38 125.5 39 148.0 40 200.5 41 238.5 42 252.0 43 273.5 44 279.5 45 286.0 46 292.0 47 272.0 48 239.0 49 204.0 50 170.5 51 145.0 52 128.0 53 102.0 54 64.0 55 48.5 56 39.5 57 28.0 58 17.5 59 11.0 60 10.5 61 8.0 62 8.5 63 5.0 64 3.0 65 3.0 66 2.5 67 1.5 68 0.5 69 0.5 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.11 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69879518072288 99.3 2 0.25100401606425704 0.5 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0251004016064257 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAAGCATCCTTCTCTTGTGCCTACACCAACCCTCCTTCCTCCTTTTCTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.1124999999999998 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.1875 0.0 0.0 0.0 0.0 122-123 2.375 0.0 0.0 0.0 0.0 124-125 2.5250000000000004 0.0 0.0 0.0 0.0 126-127 2.7125000000000004 0.0 0.0 0.0 0.0 128-129 2.9749999999999996 0.0 0.0 0.0 0.0 130-131 3.25 0.0 0.0 0.0 0.0 132-133 3.5875 0.0 0.0 0.0 0.0 134-135 3.9000000000000004 0.0 0.0 0.0 0.0 136-137 4.2875 0.0 0.0 0.0 0.0 138-139 4.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716988 spots for SRR7169869.sra Written 716988 spots for SRR7169869.sra Read 716997 spots for SRR7169869.sra Written 716997 spots for SRR7169869.sra SRR ids: ['SRR7169869.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b91hryph SRR7169869.sra spots: 14339769 blocks: [[1, 716988], [716989, 1433976], [1433977, 2150964], [2150965, 2867952], [2867953, 3584940], [3584941, 4301928], [4301929, 5018916], [5018917, 5735904], [5735905, 6452892], [6452893, 7169880], [7169881, 7886868], [7886869, 8603856], [8603857, 9320844], [9320845, 10037832], [10037833, 10754820], [10754821, 11471808], [11471809, 12188796], [12188797, 12905784], [12905785, 13622772], [13622773, 14339769]] SRR7169869 file size 4837576 SRR7169869 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169869 SRR7169869_1.fastq SRR7169869_2.fastq Input file: SRR7169869_1.fastq Paired file: SRR7169869_2.fastq trimmed: SRR7169869-trimmed-pair1.fastq, SRR7169869-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:23:01 2025 >> started Wed Feb 12 00:23:23 2025 >> done (21.951s) 14339769 read pairs processed; of these: 8800 ( 0.06%) short read pairs filtered out after trimming by size control 7682 ( 0.05%) empty read pairs filtered out after trimming by size control 14323287 (99.89%) read pairs available; of these: 6226346 (43.47%) trimmed read pairs available after processing 8096941 (56.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 3 0.00% 21 1 0.00% 22 5 0.00% 23 0 0.00% 24 2 0.00% 25 4 0.00% 26 2 0.00% 27 8 0.00% 28 8 0.00% 29 3 0.00% 30 6 0.00% 31 7 0.00% 32 8 0.00% 33 4 0.00% 34 6 0.00% 35 10 0.00% 36 8 0.00% 37 14 0.00% 38 21 0.00% 39 11 0.00% 40 22 0.00% 41 27 0.00% 42 32 0.00% 43 30 0.00% 44 43 0.00% 45 44 0.00% 46 41 0.00% 47 52 0.00% 48 51 0.00% 49 71 0.00% 50 93 0.00% 51 89 0.00% 52 83 0.00% 53 120 0.00% 54 119 0.00% 55 144 0.00% 56 172 0.00% 57 180 0.00% 58 211 0.00% 59 232 0.00% 60 275 0.00% 61 336 0.00% 62 337 0.00% 63 444 0.00% 64 472 0.00% 65 537 0.00% 66 518 0.00% 67 652 0.00% 68 743 0.01% 69 824 0.01% 70 915 0.01% 71 1145 0.01% 72 1283 0.01% 73 1431 0.01% 74 1543 0.01% 75 1733 0.01% 76 1983 0.01% 77 2067 0.01% 78 2223 0.02% 79 2584 0.02% 80 2837 0.02% 81 3153 0.02% 82 3390 0.02% 83 3910 0.03% 84 4723 0.03% 85 5480 0.04% 86 5769 0.04% 87 6163 0.04% 88 6516 0.05% 89 6792 0.05% 90 7218 0.05% 91 7677 0.05% 92 8182 0.06% 93 8746 0.06% 94 9371 0.07% 95 9696 0.07% 96 10119 0.07% 97 10619 0.07% 98 10781 0.08% 99 11239 0.08% 100 11895 0.08% 101 12253 0.09% 102 12776 0.09% 103 13362 0.09% 104 13978 0.10% 105 14781 0.10% 106 15063 0.11% 107 15238 0.11% 108 15571 0.11% 109 16035 0.11% 110 16253 0.11% 111 17109 0.12% 112 17733 0.12% 113 18532 0.13% 114 19092 0.13% 115 19789 0.14% 116 20215 0.14% 117 20739 0.14% 118 21056 0.15% 119 21056 0.15% 120 22040 0.15% 121 21920 0.15% 122 22742 0.16% 123 23922 0.17% 124 24522 0.17% 125 25395 0.18% 126 26945 0.19% 127 27672 0.19% 128 28082 0.20% 129 29100 0.20% 130 30205 0.21% 131 31201 0.22% 132 32698 0.23% 133 34857 0.24% 134 36694 0.26% 135 38354 0.27% 136 40443 0.28% 137 43627 0.30% 138 46324 0.32% 139 49228 0.34% 140 53684 0.37% 141 59234 0.41% 142 66658 0.47% 143 76551 0.53% 144 90682 0.63% 145 111759 0.78% 146 143812 1.00% 147 200493 1.40% 148 311867 2.18% 149 644006 4.50% 150 3332686 23.27% 151 8096941 56.53% 14323287 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=28 prefix-density=0.24 prefix-fanout=2.8 sequence=AAAGAAGTCAAC criterion=fanout-score sequence-density=0.12 sequence-density-rank=10 fanout-score=90.29 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=18.5 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=32 prefix-density=0.32 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=119.50 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=8.3 sequence=CTCTTCCTCTTCACAATTAGCAAACAGTAAGTTTGAACACACTCAAGATTTGAAATATCCTACAACGATGAGAAAGCAACTCCTCTCCCCATTCGTTCCTTTCTTGATGTTCTTCCTCTACAGCTCCACCACTTTTGCTCAAACCCCATCTCCAGCACCTTCAGGTCCAACCAACATAACGGCGATCCTTGCGAAAGCTGGTCAGTTCACAACCTTAATTCGGTTGTTGAAAAGCACCCAAGAGGCTGACCAAATCAACACACAACTCAACAATTCAAACCAAGGCCTAACAGTCTTTGC SRR7169869 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:24:06 Started mapping on | Feb 12 00:24:06 Finished on | Feb 12 00:25:38 Mapping speed, Million of reads per hour | 560.48 Number of input reads | 14323287 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13136023 Uniquely mapped reads % | 91.71% Average mapped length | 294.73 Number of splices: Total | 12670248 Number of splices: Annotated (sjdb) | 12466536 Number of splices: GT/AG | 12487967 Number of splices: GC/AG | 146556 Number of splices: AT/AC | 10244 Number of splices: Non-canonical | 25481 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 258627 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 339894 % of reads mapped to too many loci | 2.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.69% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 938774 938774 938774 N_multimapping 258627 258627 258627 N_noFeature 299588 13000365 356513 N_ambiguous 136366 810 57107 UnstrandedReadsAssigned:12700069 PositiveStrandReadsAssigned:134848 NegativeStrandReadsAssigned:12722403 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169869 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169869-trimmed-pair1.fastq SRR7169869-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,323,287 reads, 12,844,052 reads pseudoaligned [quant] estimated average fragment length: 278.729 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,015 rounds 52401 SRR7169869.ke.tsv 34699 SRR7169869.se.tsv 87100 total ==> SRR7169869.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.27 181 8.13818 Potri.005G024800.1.v4.1 1035 757.271 40 4.13308 Potri.004G059700.1.v4.1 961 683.277 2 0.229033 Potri.007G009000.2.v4.1 1416 1138.27 0 0 Potri.003G141000.2.v4.1 2943 2665.27 245.063 7.19452 Potri.016G087400.1.v4.1 270 78.0904 1024 1026.05 Potri.015G069301.1.v4.1 564 294.328 0 0 Potri.010G195200.1.v4.1 1773 1495.27 21 1.09892 Potri.012G127500.1.v4.1 977 699.277 4359 487.756 ==> SRR7169869.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1087 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 193 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7169869 completed mapping pipeline successfully