Starting /dee2/code/volunteer_pipeline.sh SRR7169870 current disk space = 3051678253056 free memory = 1484723032 SRR7169870 SRAfilesize 7b7f9a8af45c8c8014356521db1fed1b SRR7169870.sra SRR7169870.sra file validated SRR7169870 is paired end SRR7169870 is conventional basespace SRR7169870 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169870_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.47325 18.0 18.0 18.0 18.0 32.0 2 27.726 28.0 27.0 30.0 25.0 33.0 3 29.60025 31.0 29.0 33.0 25.0 33.0 4 31.8335 33.0 31.0 33.0 29.0 33.0 5 32.645 33.0 33.0 33.0 32.0 34.0 6 36.5675 38.0 37.0 38.0 34.0 38.0 7 37.29325 38.0 38.0 38.0 36.0 38.0 8 37.46875 38.0 38.0 38.0 37.0 38.0 9 37.6555 38.0 38.0 38.0 38.0 38.0 10-14 37.61775 38.0 38.0 38.0 38.0 38.0 15-19 37.64305 38.0 38.0 38.0 38.0 38.0 20-24 37.65405 38.0 38.0 38.0 38.0 38.0 25-29 37.661649999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.624199999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.6144 38.0 38.0 38.0 38.0 38.0 40-44 37.5704 38.0 38.0 38.0 37.8 38.0 45-49 37.562799999999996 38.0 38.0 38.0 38.0 38.0 50-54 37.4771 38.0 38.0 38.0 37.0 38.0 55-59 37.4005 38.0 38.0 38.0 37.0 38.0 60-64 37.372499999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.3404 38.0 38.0 38.0 36.8 38.0 70-74 37.20890000000001 38.0 38.0 38.0 36.2 38.0 75-79 37.21905 38.0 38.0 38.0 36.0 38.0 80-84 37.08895 38.0 38.0 38.0 36.0 38.0 85-89 37.00755 38.0 38.0 38.0 36.0 38.0 90-94 36.94414999999999 38.0 38.0 38.0 35.8 38.0 95-99 36.8115 38.0 38.0 38.0 35.2 38.0 100-104 36.6283 38.0 38.0 38.0 34.4 38.0 105-109 36.4564 38.0 38.0 38.0 34.0 38.0 110-114 36.3341 38.0 38.0 38.0 34.0 38.0 115-119 36.2154 38.0 37.6 38.0 33.8 38.0 120-124 35.84695000000001 38.0 37.0 38.0 31.8 38.0 125-129 35.529250000000005 38.0 36.4 38.0 31.0 38.0 130-134 35.38005 38.0 36.0 38.0 30.6 38.0 135-139 35.272349999999996 38.0 35.8 38.0 30.4 38.0 140-144 34.775549999999996 38.0 35.0 38.0 28.0 38.0 145-149 34.388549999999995 38.0 35.0 38.0 27.4 38.0 150-151 31.1025 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 3.0 18 2.0 19 1.0 20 3.0 21 2.0 22 5.0 23 7.0 24 7.0 25 13.0 26 12.0 27 16.0 28 18.0 29 25.0 30 34.0 31 40.0 32 72.0 33 80.0 34 151.0 35 250.0 36 773.0 37 2484.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.224604389994894 15.109749872383867 8.039816232771821 36.62582950484941 2 22.85 13.200000000000001 32.2 31.75 3 18.575 17.349999999999998 27.075 37.0 4 22.775000000000002 24.95 23.400000000000002 28.875 5 23.400000000000002 30.275000000000002 23.599999999999998 22.725 6 20.025000000000002 34.75 23.775 21.45 7 15.975 26.575 40.849999999999994 16.6 8 18.325 25.724999999999998 31.775 24.175 9 17.575 24.425 34.475 23.525 10-14 19.865 30.075000000000003 27.37 22.689999999999998 15-19 20.215 28.59 28.095 23.1 20-24 19.67 28.345 27.839999999999996 24.145 25-29 20.265 28.470000000000002 27.72 23.544999999999998 30-34 20.415 28.615000000000002 27.474999999999998 23.494999999999997 35-39 19.869999999999997 28.634999999999998 28.155 23.34 40-44 20.185 28.499999999999996 27.544999999999998 23.77 45-49 20.150000000000002 28.455000000000002 27.400000000000002 23.995 50-54 20.200000000000003 28.605000000000004 27.74 23.455000000000002 55-59 20.035 29.03 27.275 23.66 60-64 20.135 28.884999999999998 27.05 23.93 65-69 20.32 28.360000000000003 27.26 24.060000000000002 70-74 20.005 28.505000000000003 27.48 24.01 75-79 20.61 27.41 27.595 24.385 80-84 19.869999999999997 27.900000000000002 28.000000000000004 24.23 85-89 20.865000000000002 28.46 27.24 23.435 90-94 20.015 28.68 27.58 23.724999999999998 95-99 20.71 28.315 27.22 23.755000000000003 100-104 20.7 28.09 27.145000000000003 24.065 105-109 20.145 28.285 27.534999999999997 24.035 110-114 20.68 27.77 27.395000000000003 24.154999999999998 115-119 21.115000000000002 28.675 26.895000000000003 23.315 120-124 20.78 28.305000000000003 26.884999999999998 24.03 125-129 20.57 28.194999999999997 27.01 24.224999999999998 130-134 21.23 28.13 27.029999999999998 23.61 135-139 20.915 28.1 27.16 23.825 140-144 20.880000000000003 27.994999999999997 27.455000000000002 23.669999999999998 145-149 20.990000000000002 28.194999999999997 26.665 24.15 150-151 21.6875 27.762500000000003 27.55 23.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 2.0 25 1.5 26 3.0 27 4.5 28 8.0 29 11.0 30 14.5 31 22.5 32 27.0 33 36.5 34 49.5 35 63.5 36 80.5 37 99.0 38 124.0 39 153.5 40 190.5 41 213.5 42 230.0 43 258.5 44 285.0 45 283.5 46 277.0 47 267.5 48 238.5 49 225.0 50 197.0 51 152.0 52 109.0 53 83.0 54 71.5 55 54.0 56 43.5 57 33.5 58 20.0 59 16.5 60 17.0 61 9.0 62 3.5 63 3.5 64 5.0 65 4.0 66 2.0 67 1.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.175 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.5125 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.4000000000000004 0.0 0.0 0.0 0.0 114-115 2.5999999999999996 0.0 0.0 0.0 0.0 116-117 2.8 0.0 0.0 0.0 0.0 118-119 3.0250000000000004 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.675 0.0 0.0 0.0 0.0 124-125 4.0125 0.0 0.0 0.0 0.0 126-127 4.4125 0.0 0.0 0.0 0.0 128-129 4.737500000000001 0.0 0.0 0.0 0.0 130-131 5.175000000000001 0.0 0.0 0.0 0.0 132-133 5.574999999999999 0.0 0.0 0.0 0.0 134-135 5.975 0.0 0.0 0.0 0.0 136-137 6.325 0.0 0.0 0.0 0.0 138-139 6.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 35 0.003538379 20.7125 10-14 >>END_MODULE SRR7169870 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169870_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85925 33.0 33.0 34.0 32.0 34.0 2 32.987 34.0 33.0 34.0 33.0 34.0 3 32.97425 34.0 33.0 34.0 33.0 34.0 4 32.93825 34.0 33.0 34.0 33.0 34.0 5 32.93475 34.0 33.0 34.0 33.0 34.0 6 37.12125 38.0 38.0 38.0 37.0 38.0 7 37.19975 38.0 38.0 38.0 37.0 38.0 8 37.21825 38.0 38.0 38.0 38.0 38.0 9 37.21275 38.0 38.0 38.0 37.0 38.0 10-14 37.2259 38.0 38.0 38.0 37.6 38.0 15-19 37.15305 38.0 38.0 38.0 37.4 38.0 20-24 37.16315 38.0 38.0 38.0 37.0 38.0 25-29 37.135850000000005 38.0 38.0 38.0 37.2 38.0 30-34 37.07045 38.0 38.0 38.0 37.0 38.0 35-39 37.0813 38.0 38.0 38.0 37.0 38.0 40-44 37.034000000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.04975 38.0 38.0 38.0 37.0 38.0 50-54 37.0043 38.0 38.0 38.0 37.0 38.0 55-59 36.95035 38.0 38.0 38.0 36.8 38.0 60-64 36.90755 38.0 38.0 38.0 36.2 38.0 65-69 36.776250000000005 38.0 38.0 38.0 35.8 38.0 70-74 36.72025000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.6537 38.0 38.0 38.0 36.0 38.0 80-84 36.6603 38.0 38.0 38.0 35.6 38.0 85-89 36.593900000000005 38.0 38.0 38.0 35.4 38.0 90-94 36.51975 38.0 38.0 38.0 35.4 38.0 95-99 36.46505 38.0 38.0 38.0 34.6 38.0 100-104 36.37 38.0 38.0 38.0 34.4 38.0 105-109 36.198 38.0 38.0 38.0 34.0 38.0 110-114 36.1062 38.0 38.0 38.0 34.0 38.0 115-119 35.857949999999995 38.0 38.0 38.0 33.0 38.0 120-124 35.7202 38.0 37.2 38.0 32.0 38.0 125-129 35.49849999999999 38.0 37.2 38.0 31.4 38.0 130-134 35.15555 38.0 36.2 38.0 30.0 38.0 135-139 34.81365 38.0 35.6 38.0 28.4 38.0 140-144 34.517799999999994 38.0 35.4 38.0 27.6 38.0 145-149 33.7588 38.0 35.0 38.0 21.2 38.0 150-151 29.58075 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 1.0 4 1.0 5 2.0 6 0.0 7 3.0 8 0.0 9 1.0 10 1.0 11 0.0 12 2.0 13 3.0 14 3.0 15 2.0 16 4.0 17 5.0 18 3.0 19 4.0 20 3.0 21 5.0 22 3.0 23 10.0 24 19.0 25 14.0 26 16.0 27 25.0 28 19.0 29 20.0 30 30.0 31 54.0 32 60.0 33 98.0 34 104.0 35 210.0 36 475.0 37 2776.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.7518138603953 21.591193395046286 15.211408556417313 27.445584188141105 2 27.688442211055275 26.884422110552762 28.165829145728644 17.26130653266332 3 21.663734606685097 27.64513696908771 31.314400603166625 19.37672782106057 4 24.227192762000502 31.64111585825584 24.17692887660216 19.95476250314149 5 26.011560693641616 34.35536566976627 22.392560944961044 17.240512691631064 6 20.050251256281406 37.462311557788944 23.668341708542716 18.819095477386934 7 19.939728779507785 22.601707684580614 38.77448518332496 18.68407835258664 8 23.148380617624905 24.50414260607582 27.29098669344715 25.05649008285212 9 22.8391959798995 26.532663316582916 28.5678391959799 22.060301507537687 10-14 23.189715777844732 29.03987144722306 26.63955006528071 21.130862709651502 15-19 22.778642824853083 28.133005173539605 27.560399819177256 21.527952182430056 20-24 23.613901165126556 28.12876657292085 27.20470068300522 21.052631578947366 25-29 23.50075339025615 28.849824208940234 27.101958814666 20.547463586137617 30-34 23.361293887186697 27.731176854688833 27.25902858003918 21.648500678085288 35-39 23.447860156720914 28.094233473980307 27.64215390797669 20.81575246132208 40-44 23.555421565671793 28.14792483167521 27.384182494221687 20.912471108431312 45-49 22.98879453293804 28.234762072257674 27.77749861815989 20.99894477664439 50-54 23.066485753052916 28.006432484044424 27.624503743906732 21.30257801899593 55-59 23.781529494523163 27.81127524871872 27.59019194050849 20.817003316249625 60-64 23.250791099502738 27.806519664473356 28.057662363755085 20.88502687226882 65-69 23.42093362142606 27.923219938696548 28.028742274257574 20.627104165619816 70-74 23.174347891641954 28.31080062320953 27.642358144443886 20.87249334070463 75-79 23.722169171231844 27.8333417098055 27.843393476403477 20.60109564255918 80-84 23.838962605548854 27.744270205066346 27.900080418174504 20.516686771210292 85-89 23.935662226690123 27.986931389796432 27.75571751696406 20.321688866549383 90-94 23.929433051869722 26.759147567350222 28.508242862887013 20.803176517893043 95-99 24.13671776828349 27.670268911786884 27.474239758733347 20.71877356119628 100-104 24.202060819301334 27.604925860769036 27.685348077406385 20.507665242523245 105-109 23.880371952751947 27.625031414928376 27.72053279718522 20.774063835134456 110-114 24.146770545363154 28.05730082935411 27.29328977129932 20.502638853983413 115-119 24.042424851714085 27.772192620890724 27.61134010254348 20.57404242485171 120-124 24.423105927303805 28.188628022723844 27.152983761500177 20.235282288472174 125-129 23.96440780213151 28.312889603860846 26.88517997184798 20.837522622159664 130-134 24.822766353260597 27.970234803157524 26.869123636180802 20.337875207401076 135-139 24.58521870286576 28.09451985922574 27.17948717948718 20.140774258421317 140-144 24.720909182339334 27.974454390023133 27.089409634919036 20.215226792718497 145-149 25.028922086414163 28.006639505055077 26.884965544992706 20.07947286353805 150-151 25.26395173453997 28.28054298642534 26.96078431372549 19.494720965309202 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 7.0 1 8.0 2 4.5 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 2.0 25 1.5 26 0.5 27 2.5 28 4.0 29 5.5 30 7.5 31 10.5 32 19.0 33 31.0 34 45.5 35 50.0 36 65.0 37 101.5 38 125.0 39 159.5 40 194.0 41 226.0 42 264.0 43 289.0 44 288.0 45 268.0 46 276.0 47 273.5 48 252.5 49 221.0 50 180.0 51 146.5 52 120.5 53 102.0 54 70.0 55 49.0 56 36.5 57 26.5 58 22.0 59 11.5 60 8.5 61 6.5 62 4.5 63 4.0 64 2.0 65 3.0 66 2.0 67 0.0 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.5 3 0.525 4 0.525 5 0.525 6 0.5 7 0.44999999999999996 8 0.42500000000000004 9 0.5 10-14 0.43 15-19 0.455 20-24 0.44 25-29 0.44999999999999996 30-34 0.455 35-39 0.45999999999999996 40-44 0.49 45-49 0.49500000000000005 50-54 0.505 55-59 0.49 60-64 0.455 65-69 0.49500000000000005 70-74 0.515 75-79 0.515 80-84 0.52 85-89 0.525 90-94 0.52 95-99 0.525 100-104 0.525 105-109 0.525 110-114 0.525 115-119 0.53 120-124 0.545 125-129 0.54 130-134 0.555 135-139 0.5499999999999999 140-144 0.5700000000000001 145-149 0.5950000000000001 150-151 0.5499999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2687846696924 98.425 2 0.6555723651033787 1.3 3 0.05042864346949068 0.15 4 0.0 0.0 5 0.02521432173474534 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.5125 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.4000000000000004 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.8375 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.3375 0.0 0.0 0.0 0.0 122-123 3.675 0.0 0.0 0.0 0.0 124-125 4.0125 0.0 0.0 0.0 0.0 126-127 4.4125 0.0 0.0 0.0 0.0 128-129 4.737500000000001 0.0 0.0 0.0 0.0 130-131 5.1875 0.0 0.0 0.0 0.0 132-133 5.6 0.0 0.0 0.0 0.0 134-135 6.0 0.0 0.0 0.0 0.0 136-137 6.3375 0.0 0.0 0.0 0.0 138-139 6.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCAGAG 10 0.006824188 145.0 5 CTGCCAT 10 0.006824188 145.0 145 >>END_MODULE Read 774091 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Read 774093 spots for SRR7169870.sra Written 774093 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra Read 774091 spots for SRR7169870.sra Written 774091 spots for SRR7169870.sra SRR ids: ['SRR7169870.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8l2db0lz SRR7169870.sra spots: 15481822 blocks: [[1, 774091], [774092, 1548182], [1548183, 2322273], [2322274, 3096364], [3096365, 3870455], [3870456, 4644546], [4644547, 5418637], [5418638, 6192728], [6192729, 6966819], [6966820, 7740910], [7740911, 8515001], [8515002, 9289092], [9289093, 10063183], [10063184, 10837274], [10837275, 11611365], [11611366, 12385456], [12385457, 13159547], [13159548, 13933638], [13933639, 14707729], [14707730, 15481822]] SRR7169870 file size 5224581 SRR7169870 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169870 SRR7169870_1.fastq SRR7169870_2.fastq Input file: SRR7169870_1.fastq Paired file: SRR7169870_2.fastq trimmed: SRR7169870-trimmed-pair1.fastq, SRR7169870-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:15:16 2025 >> started Wed Feb 12 00:15:33 2025 >> done (17.080s) 15481822 read pairs processed; of these: 28614 ( 0.18%) short read pairs filtered out after trimming by size control 60080 ( 0.39%) empty read pairs filtered out after trimming by size control 15393128 (99.43%) read pairs available; of these: 6491802 (42.17%) trimmed read pairs available after processing 8901326 (57.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 0 0.00% 22 2 0.00% 23 4 0.00% 24 5 0.00% 25 3 0.00% 26 2 0.00% 27 2 0.00% 28 2 0.00% 29 2 0.00% 30 2 0.00% 31 5 0.00% 32 2 0.00% 33 3 0.00% 34 7 0.00% 35 8 0.00% 36 11 0.00% 37 6 0.00% 38 13 0.00% 39 10 0.00% 40 22 0.00% 41 25 0.00% 42 30 0.00% 43 25 0.00% 44 11 0.00% 45 35 0.00% 46 15 0.00% 47 46 0.00% 48 43 0.00% 49 50 0.00% 50 56 0.00% 51 61 0.00% 52 93 0.00% 53 107 0.00% 54 92 0.00% 55 107 0.00% 56 140 0.00% 57 171 0.00% 58 192 0.00% 59 203 0.00% 60 240 0.00% 61 292 0.00% 62 334 0.00% 63 330 0.00% 64 427 0.00% 65 479 0.00% 66 524 0.00% 67 535 0.00% 68 660 0.00% 69 746 0.00% 70 857 0.01% 71 1009 0.01% 72 1178 0.01% 73 1261 0.01% 74 1524 0.01% 75 1730 0.01% 76 1898 0.01% 77 2181 0.01% 78 2278 0.01% 79 2639 0.02% 80 2912 0.02% 81 3312 0.02% 82 3624 0.02% 83 4122 0.03% 84 5275 0.03% 85 6142 0.04% 86 6326 0.04% 87 6983 0.05% 88 7401 0.05% 89 7831 0.05% 90 8146 0.05% 91 8961 0.06% 92 9665 0.06% 93 10188 0.07% 94 11266 0.07% 95 11814 0.08% 96 12554 0.08% 97 13060 0.08% 98 13574 0.09% 99 14273 0.09% 100 14565 0.09% 101 15444 0.10% 102 16363 0.11% 103 17239 0.11% 104 18228 0.12% 105 19149 0.12% 106 20399 0.13% 107 20754 0.13% 108 21398 0.14% 109 22045 0.14% 110 22387 0.15% 111 23122 0.15% 112 24260 0.16% 113 24916 0.16% 114 26338 0.17% 115 27513 0.18% 116 28478 0.19% 117 29493 0.19% 118 30033 0.20% 119 30583 0.20% 120 31448 0.20% 121 32194 0.21% 122 32766 0.21% 123 34079 0.22% 124 35809 0.23% 125 37474 0.24% 126 38753 0.25% 127 40221 0.26% 128 40893 0.27% 129 42285 0.27% 130 44192 0.29% 131 45299 0.29% 132 46876 0.30% 133 49042 0.32% 134 50612 0.33% 135 53130 0.35% 136 55700 0.36% 137 58814 0.38% 138 62139 0.40% 139 66683 0.43% 140 70572 0.46% 141 74727 0.49% 142 81810 0.53% 143 90279 0.59% 144 102493 0.67% 145 119477 0.78% 146 145118 0.94% 147 191575 1.24% 148 283342 1.84% 149 604289 3.93% 150 3186838 20.70% 151 8901326 57.83% 15393128 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=42 prefix-density=0.22 prefix-fanout=1.9 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=48.45 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=10.1 sequence=CACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAAGACCTTGTTGAATCTTGGATCCGTGCCATGATATTCAAATGCAGTCATCCCATAGGCCTTGTTAAATGGAATTCCTCCATCAAGAATTGCATCTTTCAAATAATACCAGCTTTCCATGAGGACCTTGTCCTGGTTCATGAGA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=36 prefix-density=0.27 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.12 sequence-density-rank=25 fanout-score=47.19 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=12.0 sequence=TCAAGGAAGCTTTCAG SRR7169870 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:16:14 Started mapping on | Feb 12 00:16:15 Finished on | Feb 12 00:17:29 Mapping speed, Million of reads per hour | 748.85 Number of input reads | 15393128 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14792758 Uniquely mapped reads % | 96.10% Average mapped length | 293.80 Number of splices: Total | 13728514 Number of splices: Annotated (sjdb) | 13507778 Number of splices: GT/AG | 13537817 Number of splices: GC/AG | 153530 Number of splices: AT/AC | 10743 Number of splices: Non-canonical | 26424 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 261626 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 25472 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.00% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 351191 351191 351191 N_multimapping 261626 261626 261626 N_noFeature 279626 14624017 343261 N_ambiguous 165137 977 59317 UnstrandedReadsAssigned:14347995 PositiveStrandReadsAssigned:167764 NegativeStrandReadsAssigned:14390180 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169870 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169870-trimmed-pair1.fastq SRR7169870-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,393,128 reads, 14,289,248 reads pseudoaligned [quant] estimated average fragment length: 237.925 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52401 SRR7169870.ke.tsv 34699 SRR7169870.se.tsv 87100 total ==> SRR7169870.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.08 339 13.6377 Potri.005G024800.1.v4.1 1035 798.075 29 2.60362 Potri.004G059700.1.v4.1 961 724.083 3 0.296863 Potri.007G009000.2.v4.1 1416 1179.08 0 0 Potri.003G141000.2.v4.1 2943 2706.08 222 5.87809 Potri.016G087400.1.v4.1 270 81.9098 1320 1154.68 Potri.015G069301.1.v4.1 564 330.727 0 0 Potri.010G195200.1.v4.1 1773 1536.08 31 1.44601 Potri.012G127500.1.v4.1 977 740.083 5728 554.557 ==> SRR7169870.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1887 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 248 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169870 completed mapping pipeline successfully