Starting /dee2/code/volunteer_pipeline.sh SRR7169871 current disk space = 3051513438208 free memory = 1288438416 SRR7169871 SRAfilesize d06b68a8696969468e5c25f807af16ae SRR7169871.sra SRR7169871.sra file validated SRR7169871 is paired end SRR7169871 is conventional basespace SRR7169871 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169871_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.96825 18.0 18.0 18.0 18.0 32.0 2 27.08375 27.0 27.0 29.0 25.0 30.0 3 28.44525 29.0 27.0 31.0 25.0 33.0 4 31.6625 33.0 31.0 33.0 29.0 33.0 5 32.34 33.0 33.0 33.0 31.0 33.0 6 35.953 37.0 36.0 38.0 33.0 38.0 7 36.97825 38.0 37.0 38.0 35.0 38.0 8 37.44125 38.0 38.0 38.0 37.0 38.0 9 37.6465 38.0 38.0 38.0 37.0 38.0 10-14 37.666000000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.635400000000004 38.0 38.0 38.0 37.8 38.0 20-24 37.70665 38.0 38.0 38.0 38.0 38.0 25-29 37.6906 38.0 38.0 38.0 38.0 38.0 30-34 37.64205 38.0 38.0 38.0 38.0 38.0 35-39 37.481700000000004 38.0 38.0 38.0 37.6 38.0 40-44 37.60510000000001 38.0 38.0 38.0 37.8 38.0 45-49 37.59095 38.0 38.0 38.0 38.0 38.0 50-54 37.50405 38.0 38.0 38.0 37.4 38.0 55-59 37.3532 38.0 38.0 38.0 36.8 38.0 60-64 37.27375 38.0 38.0 38.0 36.8 38.0 65-69 37.16865 38.0 38.0 38.0 36.0 38.0 70-74 36.8735 38.0 38.0 38.0 35.4 38.0 75-79 36.710300000000004 38.0 38.0 38.0 34.8 38.0 80-84 36.920550000000006 38.0 38.0 38.0 35.4 38.0 85-89 36.84035 38.0 38.0 38.0 35.4 38.0 90-94 36.73575000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.663199999999996 38.0 38.0 38.0 34.6 38.0 100-104 36.27575 38.0 37.4 38.0 33.8 38.0 105-109 34.98785 38.0 35.4 38.0 25.8 38.0 110-114 35.233349999999994 38.0 35.6 38.0 27.6 38.0 115-119 35.67965 38.0 36.8 38.0 31.0 38.0 120-124 35.635200000000005 38.0 36.0 38.0 31.0 38.0 125-129 34.971900000000005 38.0 35.4 38.0 28.8 38.0 130-134 34.654999999999994 38.0 34.6 38.0 27.6 38.0 135-139 33.5854 37.8 33.4 38.0 22.0 38.0 140-144 33.28375 38.0 33.2 38.0 20.2 38.0 145-149 32.1502 37.6 31.6 38.0 15.0 38.0 150-151 27.285 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 0.0 16 3.0 17 0.0 18 3.0 19 4.0 20 3.0 21 3.0 22 7.0 23 6.0 24 7.0 25 9.0 26 9.0 27 21.0 28 21.0 29 22.0 30 40.0 31 58.0 32 73.0 33 138.0 34 234.0 35 502.0 36 1338.0 37 1495.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.9672254190643 33.049787340505375 9.206905178884163 34.77608206154616 2 21.65 13.05 34.225 31.075000000000003 3 18.875 18.15 26.3 36.675000000000004 4 22.925 25.474999999999998 22.775000000000002 28.825 5 22.725 30.7 23.225 23.35 6 18.875 35.375 25.174999999999997 20.575 7 14.224999999999998 28.7 40.35 16.725 8 17.474999999999998 27.800000000000004 30.75 23.974999999999998 9 17.162872154115586 26.019514635976982 34.2006504878659 22.61696272204153 10-14 19.09 30.545 27.74 22.625 15-19 20.044999999999998 28.93 27.775 23.25 20-24 19.505 29.67 27.839999999999996 22.985 25-29 19.53 29.235 27.725 23.51 30-34 19.545 29.665000000000003 27.495000000000005 23.294999999999998 35-39 19.775000000000002 29.275000000000002 28.08 22.869999999999997 40-44 19.59 29.134999999999998 27.66 23.615 45-49 20.044999999999998 29.044999999999998 27.860000000000003 23.05 50-54 19.855 29.270000000000003 27.415 23.46 55-59 19.725 29.555 27.11 23.61 60-64 19.15 28.68 27.889999999999997 24.279999999999998 65-69 19.84 28.999999999999996 27.474999999999998 23.685000000000002 70-74 19.34 29.080000000000002 27.92 23.66 75-79 19.645000000000003 29.185 27.744999999999997 23.425 80-84 20.18 29.23 27.439999999999998 23.150000000000002 85-89 20.080000000000002 29.01 27.61 23.3 90-94 20.625 28.255000000000003 28.055000000000003 23.064999999999998 95-99 19.895 28.694999999999997 27.77 23.64 100-104 20.43 28.815 27.735 23.02 105-109 20.135 28.865000000000002 27.800000000000004 23.200000000000003 110-114 20.155 28.660000000000004 27.48 23.705000000000002 115-119 20.3 28.59 27.825 23.285 120-124 20.88604430221511 28.826441322066103 26.88134406720336 23.406170308515424 125-129 20.466256441042574 28.065435989794384 27.530141577867827 23.938165991295214 130-134 20.549999999999997 28.060000000000002 27.900000000000002 23.49 135-139 20.44 28.15 27.845 23.565 140-144 21.145 28.189999999999998 26.435 24.23 145-149 20.755000000000003 28.694999999999997 26.52 24.03 150-151 20.5625 28.7 27.125 23.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 2.0 24 3.0 25 4.5 26 5.0 27 6.0 28 13.0 29 18.5 30 20.0 31 31.0 32 43.0 33 55.5 34 68.0 35 75.5 36 96.5 37 128.0 38 156.5 39 178.0 40 201.5 41 226.5 42 257.5 43 274.5 44 271.5 45 266.5 46 263.5 47 252.5 48 229.0 49 189.0 50 149.0 51 121.5 52 94.5 53 75.0 54 56.0 55 42.5 56 36.0 57 23.0 58 14.5 59 13.5 60 7.0 61 4.5 62 5.0 63 3.5 64 3.5 65 4.0 66 2.5 67 1.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.075 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.055 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.7749999999999999 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.45 0.0 0.0 0.0 0.0 102-103 1.575 0.0 0.0 0.0 0.0 104-105 1.725 0.0 0.0 0.0 0.0 106-107 1.8375 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.4 0.0 0.0 0.0 0.0 112-113 2.7 0.0 0.0 0.0 0.0 114-115 3.025 0.0 0.0 0.0 0.0 116-117 3.3375 0.0 0.0 0.0 0.0 118-119 3.5875 0.0 0.0 0.0 0.0 120-121 3.9375 0.0 0.0 0.0 0.0 122-123 4.2125 0.0 0.0 0.0 0.0 124-125 4.625 0.0 0.0 0.0 0.0 126-127 5.1 0.0 0.0 0.0 0.0 128-129 5.487500000000001 0.0 0.0 0.0 0.0 130-131 5.9125 0.0 0.0 0.0 0.0 132-133 6.45 0.0 0.0 0.0 0.0 134-135 7.025 0.0 0.0 0.0 0.0 136-137 7.6 0.0 0.0 0.0 0.0 138-139 8.274999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCAAG 10 0.006609538 146.58228 9 >>END_MODULE SRR7169871 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169871_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.179 34.0 33.0 34.0 33.0 34.0 2 33.321 34.0 33.0 34.0 33.0 34.0 3 33.3785 34.0 33.0 34.0 33.0 34.0 4 33.4065 34.0 33.0 34.0 33.0 34.0 5 33.409 34.0 33.0 34.0 33.0 34.0 6 37.631 38.0 38.0 38.0 38.0 38.0 7 37.5385 38.0 38.0 38.0 38.0 38.0 8 37.53775 38.0 38.0 38.0 38.0 38.0 9 37.5235 38.0 38.0 38.0 38.0 38.0 10-14 37.488749999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.4632 38.0 38.0 38.0 38.0 38.0 20-24 37.16345 38.0 38.0 38.0 37.0 38.0 25-29 37.3531 38.0 38.0 38.0 37.6 38.0 30-34 37.155 38.0 38.0 38.0 37.0 38.0 35-39 37.4126 38.0 38.0 38.0 38.0 38.0 40-44 37.36735 38.0 38.0 38.0 37.8 38.0 45-49 37.24845 38.0 38.0 38.0 37.4 38.0 50-54 37.33655 38.0 38.0 38.0 38.0 38.0 55-59 37.42184999999999 38.0 38.0 38.0 38.0 38.0 60-64 37.22795 38.0 38.0 38.0 37.2 38.0 65-69 37.2224 38.0 38.0 38.0 37.2 38.0 70-74 36.5248 38.0 37.8 38.0 33.6 38.0 75-79 36.693900000000006 38.0 38.0 38.0 35.2 38.0 80-84 37.1167 38.0 38.0 38.0 37.0 38.0 85-89 37.03075 38.0 38.0 38.0 37.0 38.0 90-94 37.0823 38.0 38.0 38.0 36.8 38.0 95-99 37.01175 38.0 38.0 38.0 36.4 38.0 100-104 36.819900000000004 38.0 38.0 38.0 36.0 38.0 105-109 36.63504999999999 38.0 38.0 38.0 35.0 38.0 110-114 36.09735 38.0 37.2 38.0 33.2 38.0 115-119 36.5058 38.0 38.0 38.0 34.8 38.0 120-124 36.37055 38.0 38.0 38.0 34.2 38.0 125-129 36.1278 38.0 38.0 38.0 33.8 38.0 130-134 35.8189 38.0 37.0 38.0 32.0 38.0 135-139 35.46875 38.0 36.4 38.0 31.2 38.0 140-144 31.645099999999996 37.0 28.4 38.0 14.8 38.0 145-149 34.017 38.0 34.6 38.0 25.8 38.0 150-151 29.42575 35.5 19.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 3.0 4 0.0 5 2.0 6 1.0 7 1.0 8 0.0 9 2.0 10 0.0 11 0.0 12 4.0 13 1.0 14 1.0 15 2.0 16 1.0 17 2.0 18 2.0 19 2.0 20 1.0 21 2.0 22 7.0 23 5.0 24 14.0 25 7.0 26 5.0 27 17.0 28 13.0 29 23.0 30 23.0 31 33.0 32 40.0 33 69.0 34 114.0 35 236.0 36 791.0 37 2567.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.4 20.0 16.025 27.575 2 26.125 27.1 29.775000000000002 17.0 3 21.2 28.199999999999996 31.55 19.05 4 24.425 31.874999999999996 23.7 20.0 5 24.0 36.1 22.075 17.825 6 21.349999999999998 37.175000000000004 24.55 16.925 7 19.45 23.7 38.2 18.65 8 23.005751437859466 25.506376594148538 27.206801700425103 24.281070267566893 9 21.85 26.174999999999997 28.849999999999998 23.125 10-14 23.3 30.3 25.22 21.18 15-19 23.745 28.294999999999998 27.36 20.599999999999998 20-24 23.04 28.42 27.395000000000003 21.145 25-29 23.369999999999997 28.689999999999998 27.37 20.57 30-34 23.39 28.694999999999997 27.339999999999996 20.575 35-39 23.39 27.805000000000003 28.01 20.794999999999998 40-44 23.275000000000002 28.244999999999997 27.675 20.805 45-49 23.805 28.34 27.875 19.98 50-54 23.44617230861543 28.41142057102855 27.701385069253465 20.441022051102557 55-59 23.585 28.449999999999996 27.445000000000004 20.52 60-64 23.674999999999997 27.735 28.065 20.525 65-69 23.810000000000002 28.16 27.700000000000003 20.330000000000002 70-74 23.5 28.535 27.800000000000004 20.165 75-79 23.76 28.000000000000004 28.134999999999998 20.105 80-84 23.71 28.27 27.655 20.365 85-89 23.68 27.85 27.74 20.73 90-94 23.799999999999997 28.03 28.185 19.985 95-99 24.04 27.884999999999998 27.900000000000002 20.175 100-104 23.51 28.525 28.38 19.585 105-109 24.506225311265563 27.896394819740987 28.041402070103505 19.555977798889945 110-114 23.945 28.305000000000003 28.015 19.735 115-119 24.355 27.860000000000003 28.105000000000004 19.68 120-124 23.715 28.525 27.794999999999998 19.965 125-129 24.6 27.33 27.965 20.105 130-134 24.38 28.345 27.425 19.85 135-139 24.5 28.139999999999997 27.345000000000002 20.015 140-144 24.995 27.845 27.46 19.7 145-149 24.81 28.025 27.465 19.7 150-151 25.275 27.3375 27.962500000000002 19.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 2.0 23 2.0 24 1.5 25 1.5 26 1.0 27 3.5 28 8.5 29 10.5 30 9.5 31 12.0 32 13.0 33 20.0 34 38.0 35 55.5 36 73.0 37 101.5 38 145.0 39 177.0 40 214.5 41 259.5 42 273.0 43 282.5 44 291.5 45 289.5 46 277.0 47 261.0 48 238.5 49 202.5 50 167.5 51 129.5 52 108.0 53 91.0 54 59.5 55 44.5 56 37.5 57 25.5 58 18.5 59 15.5 60 11.5 61 4.5 62 3.0 63 4.0 64 4.0 65 2.0 66 1.0 67 1.0 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.3375 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.7625000000000002 0.0 0.0 0.0 0.0 106-107 1.8875000000000002 0.0 0.0 0.0 0.0 108-109 2.2125 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.8 0.0 0.0 0.0 0.0 114-115 3.125 0.0 0.0 0.0 0.0 116-117 3.4125 0.0 0.0 0.0 0.0 118-119 3.6875 0.0 0.0 0.0 0.0 120-121 4.025 0.0 0.0 0.0 0.0 122-123 4.2875 0.0 0.0 0.0 0.0 124-125 4.7 0.0 0.0 0.0 0.0 126-127 5.15 0.0 0.0 0.0 0.0 128-129 5.5 0.0 0.0 0.0 0.0 130-131 5.9625 0.0 0.0 0.0 0.0 132-133 6.5125 0.0 0.0 0.0 0.0 134-135 7.074999999999999 0.0 0.0 0.0 0.0 136-137 7.5875 0.0 0.0 0.0 0.0 138-139 8.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAGAGA 10 0.006830828 145.0 4 GTTTTAA 10 0.006830828 145.0 4 AAGGTGG 10 0.006830828 145.0 3 >>END_MODULE Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618108 spots for SRR7169871.sra Written 618108 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra Read 618094 spots for SRR7169871.sra Written 618094 spots for SRR7169871.sra SRR ids: ['SRR7169871.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xne14nr_ SRR7169871.sra spots: 12361894 blocks: [[1, 618094], [618095, 1236188], [1236189, 1854282], [1854283, 2472376], [2472377, 3090470], [3090471, 3708564], [3708565, 4326658], [4326659, 4944752], [4944753, 5562846], [5562847, 6180940], [6180941, 6799034], [6799035, 7417128], [7417129, 8035222], [8035223, 8653316], [8653317, 9271410], [9271411, 9889504], [9889505, 10507598], [10507599, 11125692], [11125693, 11743786], [11743787, 12361894]] SRR7169871 file size 4167339 SRR7169871 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169871 SRR7169871_1.fastq SRR7169871_2.fastq Input file: SRR7169871_1.fastq Paired file: SRR7169871_2.fastq trimmed: SRR7169871-trimmed-pair1.fastq, SRR7169871-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:22:04 2025 >> started Wed Feb 12 00:22:18 2025 >> done (13.401s) 12361894 read pairs processed; of these: 12051 ( 0.10%) short read pairs filtered out after trimming by size control 19713 ( 0.16%) empty read pairs filtered out after trimming by size control 12330130 (99.74%) read pairs available; of these: 5942702 (48.20%) trimmed read pairs available after processing 6387428 (51.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 4 0.00% 23 1 0.00% 24 4 0.00% 25 2 0.00% 26 1 0.00% 27 1 0.00% 28 2 0.00% 29 2 0.00% 30 2 0.00% 31 0 0.00% 32 6 0.00% 33 3 0.00% 34 4 0.00% 35 3 0.00% 36 5 0.00% 37 3 0.00% 38 8 0.00% 39 5 0.00% 40 7 0.00% 41 10 0.00% 42 3 0.00% 43 11 0.00% 44 12 0.00% 45 19 0.00% 46 17 0.00% 47 18 0.00% 48 21 0.00% 49 27 0.00% 50 50 0.00% 51 34 0.00% 52 61 0.00% 53 61 0.00% 54 64 0.00% 55 78 0.00% 56 75 0.00% 57 79 0.00% 58 120 0.00% 59 123 0.00% 60 168 0.00% 61 206 0.00% 62 254 0.00% 63 269 0.00% 64 267 0.00% 65 358 0.00% 66 405 0.00% 67 418 0.00% 68 551 0.00% 69 632 0.01% 70 703 0.01% 71 819 0.01% 72 1001 0.01% 73 1108 0.01% 74 1203 0.01% 75 1511 0.01% 76 1755 0.01% 77 2000 0.02% 78 2092 0.02% 79 2218 0.02% 80 2520 0.02% 81 2921 0.02% 82 3411 0.03% 83 3830 0.03% 84 4547 0.04% 85 5227 0.04% 86 5606 0.05% 87 6275 0.05% 88 6639 0.05% 89 7155 0.06% 90 7441 0.06% 91 7907 0.06% 92 8786 0.07% 93 9258 0.08% 94 10270 0.08% 95 11001 0.09% 96 11574 0.09% 97 11920 0.10% 98 12501 0.10% 99 13054 0.11% 100 13744 0.11% 101 14420 0.12% 102 15409 0.12% 103 16133 0.13% 104 16913 0.14% 105 18202 0.15% 106 18958 0.15% 107 19500 0.16% 108 20105 0.16% 109 20803 0.17% 110 21286 0.17% 111 21766 0.18% 112 22738 0.18% 113 23995 0.19% 114 24805 0.20% 115 26319 0.21% 116 26844 0.22% 117 27642 0.22% 118 28472 0.23% 119 28646 0.23% 120 28923 0.23% 121 29924 0.24% 122 30643 0.25% 123 31924 0.26% 124 33156 0.27% 125 34573 0.28% 126 35196 0.29% 127 36295 0.29% 128 37464 0.30% 129 37989 0.31% 130 39302 0.32% 131 39822 0.32% 132 40994 0.33% 133 42891 0.35% 134 44104 0.36% 135 46614 0.38% 136 48480 0.39% 137 51283 0.42% 138 54194 0.44% 139 56913 0.46% 140 60658 0.49% 141 65349 0.53% 142 72238 0.59% 143 83980 0.68% 144 91752 0.74% 145 111982 0.91% 146 133094 1.08% 147 180867 1.47% 148 290684 2.36% 149 588245 4.77% 150 2865737 23.24% 151 6387428 51.80% 12330130 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.26 fanout-score-rank=36 prefix-density=0.15 prefix-fanout=3.1 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=249.55 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=17.0 sequence=CTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTCTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.50 fanout-score-rank=31 prefix-density=0.22 prefix-fanout=3.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=294.49 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=30.9 sequence=AAGAAGAAGAAA SRR7169871 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:23:09 Started mapping on | Feb 12 00:23:10 Finished on | Feb 12 00:24:41 Mapping speed, Million of reads per hour | 487.79 Number of input reads | 12330130 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 11630320 Uniquely mapped reads % | 94.32% Average mapped length | 292.72 Number of splices: Total | 10212046 Number of splices: Annotated (sjdb) | 9995561 Number of splices: GT/AG | 10041036 Number of splices: GC/AG | 134076 Number of splices: AT/AC | 9777 Number of splices: Non-canonical | 27157 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 218429 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 19191 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.69% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 490435 490435 490435 N_multimapping 218429 218429 218429 N_noFeature 361244 11488736 427446 N_ambiguous 126477 1148 50284 UnstrandedReadsAssigned:11142599 PositiveStrandReadsAssigned:140436 NegativeStrandReadsAssigned:11152590 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169871 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169871-trimmed-pair1.fastq SRR7169871-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,330,130 reads, 11,090,610 reads pseudoaligned [quant] estimated average fragment length: 225.767 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,269 rounds 52401 SRR7169871.ke.tsv 34699 SRR7169871.se.tsv 87100 total ==> SRR7169871.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.23 283 14.6912 Potri.005G024800.1.v4.1 1035 810.233 96 11.0298 Potri.004G059700.1.v4.1 961 736.254 3 0.379315 Potri.007G009000.2.v4.1 1416 1191.23 0 0 Potri.003G141000.2.v4.1 2943 2718.23 265 9.0754 Potri.016G087400.1.v4.1 270 85.0622 1227 1342.81 Potri.015G069301.1.v4.1 564 341.691 0 0 Potri.010G195200.1.v4.1 1773 1548.23 126 7.57602 Potri.012G127500.1.v4.1 977 752.238 8091 1001.28 ==> SRR7169871.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2207 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 351 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7169871 completed mapping pipeline successfully