Starting /dee2/code/volunteer_pipeline.sh SRR7169872 current disk space = 3051772907520 free memory = 1005098584 SRR7169872 SRAfilesize 72523909f9576c691c9b4480d6c5f2d2 SRR7169872.sra SRR7169872.sra file validated SRR7169872 is paired end SRR7169872 is conventional basespace SRR7169872 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169872_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.78725 18.0 18.0 18.0 18.0 32.0 2 26.907 27.0 27.0 28.0 25.0 30.0 3 28.1005 29.0 27.0 31.0 25.0 31.0 4 31.5195 33.0 31.0 33.0 29.0 33.0 5 32.28575 33.0 33.0 33.0 31.0 33.0 6 35.86825 37.0 36.0 38.0 32.0 38.0 7 36.91725 38.0 37.0 38.0 35.0 38.0 8 37.382 38.0 38.0 38.0 37.0 38.0 9 37.5725 38.0 38.0 38.0 37.0 38.0 10-14 37.587199999999996 38.0 38.0 38.0 37.2 38.0 15-19 37.585699999999996 38.0 38.0 38.0 37.4 38.0 20-24 37.7153 38.0 38.0 38.0 38.0 38.0 25-29 37.6837 38.0 38.0 38.0 38.0 38.0 30-34 37.62245 38.0 38.0 38.0 38.0 38.0 35-39 37.476800000000004 38.0 38.0 38.0 37.4 38.0 40-44 37.57155 38.0 38.0 38.0 37.8 38.0 45-49 37.54855 38.0 38.0 38.0 37.6 38.0 50-54 37.4291 38.0 38.0 38.0 37.0 38.0 55-59 37.31965 38.0 38.0 38.0 36.8 38.0 60-64 37.16605 38.0 38.0 38.0 36.0 38.0 65-69 37.14325 38.0 38.0 38.0 36.0 38.0 70-74 36.7871 38.0 38.0 38.0 35.0 38.0 75-79 36.631550000000004 38.0 37.6 38.0 34.6 38.0 80-84 36.6885 38.0 37.8 38.0 34.8 38.0 85-89 36.68005 38.0 37.8 38.0 35.0 38.0 90-94 36.5642 38.0 38.0 38.0 34.0 38.0 95-99 36.48545 38.0 38.0 38.0 34.0 38.0 100-104 36.10369999999999 38.0 37.0 38.0 33.0 38.0 105-109 34.803349999999995 38.0 35.4 38.0 27.4 38.0 110-114 35.14695 38.0 35.6 38.0 27.4 38.0 115-119 35.6175 38.0 36.2 38.0 31.0 38.0 120-124 35.4957 38.0 36.0 38.0 30.2 38.0 125-129 34.9821 38.0 35.4 38.0 28.2 38.0 130-134 34.5406 38.0 34.6 38.0 26.4 38.0 135-139 33.60575 38.0 33.4 38.0 22.0 38.0 140-144 33.11395 38.0 33.0 38.0 19.8 38.0 145-149 31.9875 36.4 31.4 38.0 13.4 38.0 150-151 27.236125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 2.0 15 2.0 16 2.0 17 2.0 18 2.0 19 7.0 20 5.0 21 2.0 22 4.0 23 5.0 24 7.0 25 10.0 26 17.0 27 13.0 28 22.0 29 34.0 30 24.0 31 63.0 32 85.0 33 141.0 34 234.0 35 577.0 36 1387.0 37 1352.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.137068534267133 37.843921960980495 7.8039019509754874 30.21510755377689 2 20.424999999999997 13.3 35.075 31.2 3 19.650000000000002 19.1 26.200000000000003 35.05 4 23.25 26.55 23.65 26.55 5 22.7 32.800000000000004 23.925 20.575 6 19.625 37.275000000000006 23.599999999999998 19.5 7 15.0 27.925 40.65 16.425 8 17.724999999999998 27.275 30.875000000000004 24.125 9 16.18714035526645 26.494871153365025 32.89967475606705 24.418313735301474 10-14 19.195 30.885 27.3 22.62 15-19 20.005 28.815 28.005000000000003 23.175 20-24 20.385 29.09 27.11 23.415 25-29 19.445 29.765000000000004 27.665 23.125 30-34 19.869999999999997 28.884999999999998 27.389999999999997 23.855 35-39 19.6 29.375 27.375 23.65 40-44 20.04 29.635 26.995 23.330000000000002 45-49 20.41 28.754999999999995 27.439999999999998 23.395 50-54 19.755 29.675 27.189999999999998 23.380000000000003 55-59 20.080000000000002 28.665000000000003 27.150000000000002 24.104999999999997 60-64 19.93 29.294999999999998 26.87 23.905 65-69 19.605 29.235 27.115000000000002 24.044999999999998 70-74 19.845 29.25 27.315 23.59 75-79 19.515 28.439999999999998 28.01 24.035 80-84 20.415 29.03 27.389999999999997 23.165 85-89 21.04 28.299999999999997 27.325 23.335 90-94 20.495 28.83 27.26 23.415 95-99 20.275000000000002 28.87 27.425 23.43 100-104 20.335 28.544999999999998 27.779999999999998 23.34 105-109 20.735 29.085 26.695 23.485 110-114 20.65 28.865000000000002 26.584999999999997 23.9 115-119 20.755000000000003 29.39 27.295 22.56 120-124 20.68206820682068 28.432843284328435 26.962696269626964 23.92239223922392 125-129 20.347208324994998 28.99239543726236 26.600960576345805 24.05943566139684 130-134 20.94 28.535 27.005000000000003 23.52 135-139 21.01 28.975 26.314999999999998 23.7 140-144 21.044999999999998 28.13 26.77 24.055 145-149 20.849999999999998 28.83 26.474999999999998 23.845 150-151 20.825 28.787499999999998 26.1 24.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 2.0 24 2.5 25 4.0 26 5.0 27 8.0 28 13.0 29 17.0 30 17.5 31 28.0 32 40.0 33 52.5 34 65.5 35 74.0 36 102.0 37 107.5 38 122.0 39 175.5 40 199.0 41 209.0 42 235.0 43 274.5 44 282.5 45 270.5 46 281.0 47 273.0 48 225.5 49 183.0 50 164.0 51 142.0 52 108.0 53 85.0 54 68.0 55 43.0 56 33.0 57 25.0 58 18.0 59 13.0 60 6.5 61 4.0 62 3.5 63 4.0 64 2.0 65 0.0 66 0.5 67 1.5 68 3.0 69 2.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.075 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.01 125-129 0.06 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.0750000000000002 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.7375 0.0 0.0 0.0 0.0 108-109 1.925 0.0 0.0 0.0 0.0 110-111 2.275 0.0 0.0 0.0 0.0 112-113 2.625 0.0 0.0 0.0 0.0 114-115 3.0 0.0 0.0 0.0 0.0 116-117 3.375 0.0 0.0 0.0 0.0 118-119 3.875 0.0 0.0 0.0 0.0 120-121 4.175 0.0 0.0 0.0 0.0 122-123 4.7 0.0 0.0 0.0 0.0 124-125 5.025 0.0 0.0 0.0 0.0 126-127 5.425 0.0 0.0 0.0 0.0 128-129 6.1125 0.0 0.0 0.0 0.0 130-131 6.6875 0.0 0.0 0.0 0.0 132-133 7.2125 0.0 0.0 0.0 0.0 134-135 7.725 0.0 0.0 0.0 0.0 136-137 8.3375 0.0 0.0 0.0 0.0 138-139 8.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTGA 10 0.006830828 145.0 8 ATAAGCC 10 0.006830828 145.0 8 TATAAGC 10 0.006830828 145.0 7 ATTATAA 10 0.006830828 145.0 5 >>END_MODULE SRR7169872 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169872_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1505 34.0 33.0 34.0 33.0 34.0 2 33.3255 34.0 33.0 34.0 33.0 34.0 3 33.3485 34.0 33.0 34.0 33.0 34.0 4 33.38925 34.0 33.0 34.0 33.0 34.0 5 33.374 34.0 33.0 34.0 33.0 34.0 6 37.569 38.0 38.0 38.0 38.0 38.0 7 37.53175 38.0 38.0 38.0 38.0 38.0 8 37.53 38.0 38.0 38.0 38.0 38.0 9 37.49075 38.0 38.0 38.0 38.0 38.0 10-14 37.48305 38.0 38.0 38.0 38.0 38.0 15-19 37.458549999999995 38.0 38.0 38.0 37.8 38.0 20-24 37.124649999999995 38.0 38.0 38.0 36.8 38.0 25-29 37.31685 38.0 38.0 38.0 37.6 38.0 30-34 37.12515 38.0 38.0 38.0 36.8 38.0 35-39 37.367000000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.30155 38.0 38.0 38.0 37.8 38.0 45-49 37.1721 38.0 38.0 38.0 37.0 38.0 50-54 37.310599999999994 38.0 38.0 38.0 37.8 38.0 55-59 37.348299999999995 38.0 38.0 38.0 38.0 38.0 60-64 37.1597 38.0 38.0 38.0 37.0 38.0 65-69 37.18035 38.0 38.0 38.0 37.0 38.0 70-74 36.54025 38.0 37.8 38.0 33.4 38.0 75-79 36.65689999999999 38.0 38.0 38.0 35.0 38.0 80-84 37.07119999999999 38.0 38.0 38.0 36.8 38.0 85-89 36.9608 38.0 38.0 38.0 36.4 38.0 90-94 37.00385 38.0 38.0 38.0 36.4 38.0 95-99 36.912099999999995 38.0 38.0 38.0 36.0 38.0 100-104 36.76365 38.0 38.0 38.0 35.8 38.0 105-109 36.613299999999995 38.0 38.0 38.0 35.0 38.0 110-114 36.04515 38.0 37.2 38.0 32.6 38.0 115-119 36.37425 38.0 38.0 38.0 34.0 38.0 120-124 36.11725 38.0 38.0 38.0 33.8 38.0 125-129 35.9917 38.0 38.0 38.0 33.8 38.0 130-134 35.689049999999995 38.0 36.8 38.0 32.0 38.0 135-139 35.263799999999996 38.0 36.2 38.0 31.0 38.0 140-144 31.455099999999998 36.4 28.0 38.0 14.8 38.0 145-149 33.75465 38.0 33.8 38.0 24.6 38.0 150-151 29.261375 35.5 19.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 2.0 4 4.0 5 2.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 0.0 16 1.0 17 4.0 18 1.0 19 5.0 20 7.0 21 7.0 22 2.0 23 8.0 24 7.0 25 11.0 26 12.0 27 15.0 28 18.0 29 23.0 30 27.0 31 41.0 32 32.0 33 62.0 34 135.0 35 252.0 36 805.0 37 2503.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.65 21.4 12.825000000000001 25.124999999999996 2 26.075 26.75 29.875 17.299999999999997 3 22.005501375343837 28.557139284821204 30.957739434858716 18.479619904976243 4 24.681170292573142 32.6081520380095 23.305826456614152 19.4048512128032 5 24.18104526131533 37.009252313078264 21.780445111277817 17.029257314328582 6 21.3 37.05 23.625 18.025 7 20.9 23.375 36.65 19.075 8 21.955488872218055 26.38159539884971 26.881720430107524 24.781195298824706 9 21.875 26.3 29.049999999999997 22.775000000000002 10-14 23.765 28.605000000000004 26.340000000000003 21.29 15-19 22.975 28.244999999999997 27.96 20.82 20-24 22.82 28.125 27.85 21.205 25-29 23.615 27.755000000000003 27.97 20.66 30-34 23.925 27.62 27.694999999999997 20.76 35-39 23.015 27.98 27.935 21.07 40-44 23.305 27.68 28.4 20.615 45-49 22.86 27.915 28.144999999999996 21.08 50-54 23.13615680784039 28.48642432121606 27.75638781939097 20.621031051552578 55-59 23.505000000000003 28.22 28.175 20.1 60-64 23.49 27.73 27.775 21.005 65-69 23.35 27.625 28.560000000000002 20.465 70-74 23.505000000000003 27.875 28.194999999999997 20.424999999999997 75-79 23.57 27.639999999999997 28.34 20.45 80-84 23.3 27.715 27.855 21.13 85-89 23.645 27.935 28.155 20.265 90-94 22.93 28.125 28.49 20.455000000000002 95-99 24.25 27.275 28.384999999999998 20.09 100-104 23.65 27.755000000000003 27.99 20.605 105-109 23.472347234723472 27.867786778677868 28.202820282028203 20.457045704570458 110-114 24.305 28.46 27.3 19.935 115-119 24.04 27.48 27.944999999999997 20.535 120-124 24.565 27.650000000000002 27.935 19.85 125-129 24.88 27.250000000000004 27.76 20.11 130-134 25.1 27.735 27.515 19.650000000000002 135-139 24.865000000000002 27.500000000000004 27.67 19.965 140-144 25.295 27.595 27.229999999999997 19.88 145-149 25.3 27.560000000000002 27.200000000000003 19.939999999999998 150-151 25.924999999999997 27.125 27.6 19.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.5 27 3.5 28 4.0 29 3.5 30 8.5 31 16.0 32 19.0 33 31.5 34 44.5 35 57.0 36 74.0 37 98.5 38 128.5 39 169.5 40 211.5 41 234.0 42 261.0 43 284.5 44 308.5 45 300.5 46 290.5 47 290.5 48 237.0 49 197.5 50 173.5 51 140.5 52 112.0 53 84.0 54 67.0 55 43.5 56 26.5 57 20.5 58 11.0 59 7.0 60 4.5 61 4.0 62 6.5 63 5.0 64 2.5 65 2.5 66 2.0 67 1.5 68 2.0 69 2.0 70 0.5 71 0.0 72 0.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.025 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7564296520423601 1.5 3 0.0 0.0 4 0.0 0.0 5 0.02521432173474534 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6499999999999999 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.2625000000000002 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.8375 0.0 0.0 0.0 0.0 108-109 2.0250000000000004 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.75 0.0 0.0 0.0 0.0 114-115 3.125 0.0 0.0 0.0 0.0 116-117 3.5125 0.0 0.0 0.0 0.0 118-119 4.050000000000001 0.0 0.0 0.0 0.0 120-121 4.3375 0.0 0.0 0.0 0.0 122-123 4.9 0.0 0.0 0.0 0.0 124-125 5.275 0.0 0.0 0.0 0.0 126-127 5.6375 0.0 0.0 0.0 0.0 128-129 6.3 0.0 0.0 0.0 0.0 130-131 6.8625 0.0 0.0 0.0 0.0 132-133 7.362500000000001 0.0 0.0 0.0 0.0 134-135 7.887499999999999 0.0 0.0 0.0 0.0 136-137 8.5375 0.0 0.0 0.0 0.0 138-139 9.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTGAG 10 0.006830828 145.0 6 ATTTTTC 10 0.006830828 145.0 3 >>END_MODULE Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569661 spots for SRR7169872.sra Written 569661 spots for SRR7169872.sra Read 569679 spots for SRR7169872.sra Written 569679 spots for SRR7169872.sra SRR ids: ['SRR7169872.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w774gra3 SRR7169872.sra spots: 11393238 blocks: [[1, 569661], [569662, 1139322], [1139323, 1708983], [1708984, 2278644], [2278645, 2848305], [2848306, 3417966], [3417967, 3987627], [3987628, 4557288], [4557289, 5126949], [5126950, 5696610], [5696611, 6266271], [6266272, 6835932], [6835933, 7405593], [7405594, 7975254], [7975255, 8544915], [8544916, 9114576], [9114577, 9684237], [9684238, 10253898], [10253899, 10823559], [10823560, 11393238]] SRR7169872 file size 3839094 SRR7169872 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169872 SRR7169872_1.fastq SRR7169872_2.fastq Input file: SRR7169872_1.fastq Paired file: SRR7169872_2.fastq trimmed: SRR7169872-trimmed-pair1.fastq, SRR7169872-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:04:11 2025 >> started Wed Feb 12 00:04:25 2025 >> done (13.307s) 11393238 read pairs processed; of these: 13030 ( 0.11%) short read pairs filtered out after trimming by size control 20132 ( 0.18%) empty read pairs filtered out after trimming by size control 11360076 (99.71%) read pairs available; of these: 5658614 (49.81%) trimmed read pairs available after processing 5701462 (50.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 1 0.00% 23 4 0.00% 24 3 0.00% 25 3 0.00% 26 4 0.00% 27 7 0.00% 28 5 0.00% 29 3 0.00% 30 8 0.00% 31 23 0.00% 32 7 0.00% 33 4 0.00% 34 5 0.00% 35 7 0.00% 36 8 0.00% 37 16 0.00% 38 19 0.00% 39 18 0.00% 40 13 0.00% 41 25 0.00% 42 31 0.00% 43 21 0.00% 44 22 0.00% 45 24 0.00% 46 28 0.00% 47 50 0.00% 48 48 0.00% 49 68 0.00% 50 63 0.00% 51 66 0.00% 52 82 0.00% 53 89 0.00% 54 116 0.00% 55 118 0.00% 56 129 0.00% 57 161 0.00% 58 144 0.00% 59 205 0.00% 60 230 0.00% 61 275 0.00% 62 330 0.00% 63 364 0.00% 64 383 0.00% 65 437 0.00% 66 464 0.00% 67 534 0.00% 68 615 0.01% 69 715 0.01% 70 780 0.01% 71 934 0.01% 72 1063 0.01% 73 1218 0.01% 74 1366 0.01% 75 1592 0.01% 76 2005 0.02% 77 2116 0.02% 78 2145 0.02% 79 2407 0.02% 80 2500 0.02% 81 2977 0.03% 82 3219 0.03% 83 3684 0.03% 84 4502 0.04% 85 5241 0.05% 86 5671 0.05% 87 5933 0.05% 88 6503 0.06% 89 6729 0.06% 90 7277 0.06% 91 7879 0.07% 92 8478 0.07% 93 9033 0.08% 94 9786 0.09% 95 10479 0.09% 96 11244 0.10% 97 11653 0.10% 98 12387 0.11% 99 12774 0.11% 100 13533 0.12% 101 14177 0.12% 102 15090 0.13% 103 15630 0.14% 104 16776 0.15% 105 17604 0.15% 106 18637 0.16% 107 19003 0.17% 108 19853 0.17% 109 19813 0.17% 110 20457 0.18% 111 21563 0.19% 112 22319 0.20% 113 23221 0.20% 114 24268 0.21% 115 25188 0.22% 116 25977 0.23% 117 27042 0.24% 118 27702 0.24% 119 27877 0.25% 120 28293 0.25% 121 29081 0.26% 122 30091 0.26% 123 31109 0.27% 124 32370 0.28% 125 33470 0.29% 126 34603 0.30% 127 35668 0.31% 128 36726 0.32% 129 37328 0.33% 130 37787 0.33% 131 39024 0.34% 132 40333 0.36% 133 41894 0.37% 134 43796 0.39% 135 46222 0.41% 136 47565 0.42% 137 49989 0.44% 138 52891 0.47% 139 55939 0.49% 140 58946 0.52% 141 63925 0.56% 142 70593 0.62% 143 82551 0.73% 144 90051 0.79% 145 110918 0.98% 146 131081 1.15% 147 177103 1.56% 148 283444 2.50% 149 570161 5.02% 150 2650353 23.33% 151 5701462 50.19% 11360076 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=32 prefix-density=0.23 prefix-fanout=2.3 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=50.36 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=8.6 sequence=ACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCAC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=39 prefix-density=0.28 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=160.28 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=8.5 sequence=AAAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7169872 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:05:14 Started mapping on | Feb 12 00:05:15 Finished on | Feb 12 00:06:14 Mapping speed, Million of reads per hour | 693.16 Number of input reads | 11360076 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 10901688 Uniquely mapped reads % | 95.96% Average mapped length | 292.09 Number of splices: Total | 9947986 Number of splices: Annotated (sjdb) | 9783139 Number of splices: GT/AG | 9806731 Number of splices: GC/AG | 111399 Number of splices: AT/AC | 8278 Number of splices: Non-canonical | 21578 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 189812 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 43615 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.91% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 278832 278832 278832 N_multimapping 189812 189812 189812 N_noFeature 239698 10767926 290612 N_ambiguous 126666 536 43487 UnstrandedReadsAssigned:10535324 PositiveStrandReadsAssigned:133226 NegativeStrandReadsAssigned:10567589 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169872 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169872-trimmed-pair1.fastq SRR7169872-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,360,076 reads, 10,519,509 reads pseudoaligned [quant] estimated average fragment length: 224.309 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,001 rounds 52401 SRR7169872.ke.tsv 34699 SRR7169872.se.tsv 87100 total ==> SRR7169872.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.69 175 9.56136 Potri.005G024800.1.v4.1 1035 811.691 16 1.93286 Potri.004G059700.1.v4.1 961 737.702 1 0.13292 Potri.007G009000.2.v4.1 1416 1192.69 0 0 Potri.003G141000.2.v4.1 2943 2719.69 248.036 8.94266 Potri.016G087400.1.v4.1 270 87.3755 982.656 1102.76 Potri.015G069301.1.v4.1 564 343.595 0 0 Potri.010G195200.1.v4.1 1773 1549.69 8 0.506193 Potri.012G127500.1.v4.1 977 753.702 2939 382.359 ==> SRR7169872.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 969 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 174 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169872 completed mapping pipeline successfully