Starting /dee2/code/volunteer_pipeline.sh SRR7169873 current disk space = 3051707772928 free memory = 1235657472 SRR7169873 SRAfilesize 38c06c7d51a47cf387e285348a46eb1c SRR7169873.sra SRR7169873.sra file validated SRR7169873 is paired end SRR7169873 is conventional basespace SRR7169873 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169873_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.9625 18.0 18.0 18.0 18.0 32.0 2 26.00225 27.0 25.0 28.0 18.0 30.0 3 27.662 29.0 27.0 31.0 18.0 31.0 4 31.13125 31.0 30.0 33.0 29.0 33.0 5 32.059 33.0 31.0 33.0 30.0 33.0 6 36.58725 38.0 37.0 38.0 34.0 38.0 7 37.28275 38.0 38.0 38.0 36.0 38.0 8 37.60125 38.0 38.0 38.0 37.0 38.0 9 37.66625 38.0 38.0 38.0 38.0 38.0 10-14 37.648250000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.64115 38.0 38.0 38.0 38.0 38.0 20-24 37.69029999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.64135 38.0 38.0 38.0 38.0 38.0 30-34 37.586149999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.63395 38.0 38.0 38.0 38.0 38.0 40-44 37.5957 38.0 38.0 38.0 38.0 38.0 45-49 37.5818 38.0 38.0 38.0 38.0 38.0 50-54 37.37695 38.0 38.0 38.0 37.0 38.0 55-59 37.2603 38.0 38.0 38.0 36.4 38.0 60-64 37.09685 38.0 38.0 38.0 36.0 38.0 65-69 36.659 38.0 37.6 38.0 34.2 38.0 70-74 36.968599999999995 38.0 38.0 38.0 35.6 38.0 75-79 36.933400000000006 38.0 38.0 38.0 35.8 38.0 80-84 36.65365 38.0 37.8 38.0 34.6 38.0 85-89 36.2861 38.0 37.2 38.0 33.2 38.0 90-94 36.382799999999996 38.0 37.6 38.0 33.8 38.0 95-99 36.27505000000001 38.0 37.0 38.0 33.8 38.0 100-104 35.956599999999995 38.0 36.8 38.0 32.2 38.0 105-109 35.52285 38.0 36.4 38.0 30.0 38.0 110-114 35.4672 38.0 36.0 38.0 30.2 38.0 115-119 34.447649999999996 38.0 34.4 38.0 25.2 38.0 120-124 34.14635 38.0 33.8 38.0 22.4 38.0 125-129 32.784000000000006 37.4 31.6 38.0 16.8 38.0 130-134 33.361399999999996 37.6 32.2 38.0 22.2 38.0 135-139 33.008750000000006 38.0 33.0 38.0 18.4 38.0 140-144 32.0567 37.2 31.0 38.0 16.0 38.0 145-149 30.27385 36.0 28.0 38.0 6.2 38.0 150-151 23.887999999999998 31.0 12.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 2.0 18 4.0 19 5.0 20 1.0 21 1.0 22 5.0 23 12.0 24 4.0 25 11.0 26 18.0 27 20.0 28 34.0 29 38.0 30 60.0 31 84.0 32 125.0 33 192.0 34 327.0 35 667.0 36 1381.0 37 1004.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.06242134407249 32.267807701988424 9.262522023659702 34.40724893027939 2 21.2 15.8 35.85 27.150000000000002 3 19.45 20.375 27.1 33.074999999999996 4 22.525000000000002 28.525 23.05 25.900000000000002 5 21.725 34.175 23.474999999999998 20.625 6 18.325 35.775 24.9 21.0 7 13.5 27.400000000000002 41.099999999999994 18.0 8 18.15 27.35 30.4 24.099999999999998 9 17.275 24.6 33.525 24.6 10-14 19.689999999999998 30.78 26.86 22.67 15-19 19.06 29.53 27.865000000000002 23.544999999999998 20-24 19.650000000000002 29.59 27.54 23.22 25-29 20.064999999999998 29.45 27.605 22.88 30-34 19.495 29.45 27.405 23.65 35-39 19.715 29.395 27.67 23.22 40-44 20.195 29.360000000000003 26.840000000000003 23.605 45-49 19.8 29.095 27.834999999999997 23.27 50-54 19.634999999999998 29.970000000000002 26.884999999999998 23.51 55-59 19.82 29.455 27.525 23.200000000000003 60-64 19.814999999999998 29.04 27.05 24.095 65-69 20.22 29.470000000000002 27.534999999999997 22.775000000000002 70-74 19.73 29.515 27.435 23.32 75-79 19.57 29.21 27.265 23.955000000000002 80-84 19.54 28.93 27.49 24.04 85-89 19.575 28.87 27.785 23.77 90-94 20.595 29.18 26.595000000000002 23.630000000000003 95-99 19.875 29.34 27.13 23.655 100-104 20.849999999999998 28.645 26.93 23.575 105-109 20.62 28.48 27.284999999999997 23.615 110-114 20.075112669003506 29.173760640961444 27.230846269404108 23.520280420630947 115-119 20.516801041614503 29.00996544644199 27.182132305072866 23.29110120687065 120-124 20.316332148756196 28.80024025226488 26.963311477050905 23.920116121928025 125-129 20.47650032534161 29.210671204765003 26.617948846288602 23.694879623604784 130-134 20.990000000000002 28.645 26.76 23.605 135-139 20.155 28.965000000000003 27.33 23.549999999999997 140-144 20.51 28.765 26.525 24.2 145-149 20.474999999999998 28.645 26.795 24.085 150-151 20.4 28.349999999999998 27.1125 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.5 22 0.5 23 0.0 24 2.0 25 4.0 26 4.5 27 8.0 28 10.0 29 17.5 30 27.5 31 35.5 32 42.5 33 55.0 34 70.5 35 77.0 36 101.5 37 135.0 38 159.0 39 167.0 40 188.5 41 232.5 42 264.5 43 279.0 44 276.0 45 271.5 46 258.5 47 230.5 48 210.0 49 188.0 50 144.0 51 113.0 52 93.5 53 77.5 54 72.5 55 49.0 56 24.5 57 21.0 58 19.0 59 14.5 60 11.5 61 6.5 62 7.0 63 7.0 64 3.0 65 1.5 66 1.5 67 3.0 68 4.5 69 2.5 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.15 115-119 0.155 120-124 0.105 125-129 0.105 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09159727479182 98.175 2 0.8831693161746152 1.7500000000000002 3 0.025233409033560434 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.2000000000000002 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.4249999999999998 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.8875 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.7625 0.0 0.0 0.0 0.0 116-117 2.9625 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.5125 0.0 0.0 0.0 0.0 122-123 3.8 0.0 0.0 0.0 0.0 124-125 4.387499999999999 0.0 0.0 0.0 0.0 126-127 4.8125 0.0 0.0 0.0 0.0 128-129 5.175 0.0 0.0 0.0 0.0 130-131 5.5875 0.0 0.0 0.0 0.0 132-133 5.987500000000001 0.0 0.0 0.0 0.0 134-135 6.65 0.0 0.0 0.0 0.0 136-137 7.25 0.0 0.0 0.0 0.0 138-139 7.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATTAC 10 0.006830828 145.0 3 TTTTTTT 30 0.0014437955 24.166668 105-109 >>END_MODULE SRR7169873 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169873_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.4065 34.0 33.0 34.0 33.0 34.0 2 33.45725 34.0 33.0 34.0 33.0 34.0 3 33.4805 34.0 33.0 34.0 33.0 34.0 4 33.4395 34.0 33.0 34.0 33.0 34.0 5 33.42525 34.0 33.0 34.0 33.0 34.0 6 37.6035 38.0 38.0 38.0 38.0 38.0 7 37.52375 38.0 38.0 38.0 38.0 38.0 8 37.581 38.0 38.0 38.0 38.0 38.0 9 37.486 38.0 38.0 38.0 38.0 38.0 10-14 37.109449999999995 38.0 38.0 38.0 36.6 38.0 15-19 37.48495 38.0 38.0 38.0 38.0 38.0 20-24 37.310500000000005 38.0 38.0 38.0 37.6 38.0 25-29 37.4692 38.0 38.0 38.0 37.8 38.0 30-34 37.51174999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.23245 38.0 38.0 38.0 37.4 38.0 40-44 37.3642 38.0 38.0 38.0 37.6 38.0 45-49 37.459500000000006 38.0 38.0 38.0 38.0 38.0 50-54 37.38955 38.0 38.0 38.0 37.8 38.0 55-59 37.3502 38.0 38.0 38.0 37.6 38.0 60-64 37.270450000000004 38.0 38.0 38.0 37.4 38.0 65-69 36.900549999999996 38.0 38.0 38.0 36.2 38.0 70-74 37.092499999999994 38.0 38.0 38.0 36.8 38.0 75-79 37.15995 38.0 38.0 38.0 37.0 38.0 80-84 36.95495 38.0 38.0 38.0 36.4 38.0 85-89 36.635799999999996 38.0 38.0 38.0 35.4 38.0 90-94 36.70695 38.0 38.0 38.0 35.4 38.0 95-99 36.715349999999994 38.0 38.0 38.0 35.2 38.0 100-104 35.42530000000001 38.0 36.4 38.0 29.0 38.0 105-109 35.994299999999996 38.0 37.4 38.0 32.4 38.0 110-114 35.8918 38.0 37.4 38.0 32.2 38.0 115-119 34.75019999999999 38.0 35.2 38.0 26.0 38.0 120-124 34.9291 38.0 35.4 38.0 27.4 38.0 125-129 33.87285 38.0 34.0 38.0 22.2 38.0 130-134 33.207300000000004 37.8 32.4 38.0 19.8 38.0 135-139 33.4047 38.0 33.0 38.0 21.2 38.0 140-144 32.88585 37.6 32.0 38.0 19.4 38.0 145-149 30.721999999999998 36.8 29.6 38.0 7.8 38.0 150-151 25.494374999999998 32.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 4.0 4 2.0 5 1.0 6 0.0 7 2.0 8 2.0 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 2.0 15 1.0 16 1.0 17 3.0 18 1.0 19 4.0 20 5.0 21 1.0 22 7.0 23 9.0 24 15.0 25 15.0 26 9.0 27 19.0 28 15.0 29 38.0 30 55.0 31 72.0 32 78.0 33 117.0 34 227.0 35 430.0 36 984.0 37 1873.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.45 21.099999999999998 15.825 23.625 2 26.875 26.224999999999998 28.449999999999996 18.45 3 21.3 27.925 31.525 19.25 4 24.25 33.875 22.975 18.9 5 24.725 34.4 22.55 18.325 6 21.4 36.6 23.724999999999998 18.275 7 21.45 22.6 37.075 18.875 8 22.35 24.85 27.400000000000002 25.4 9 22.075 25.124999999999996 28.725 24.075 10-14 24.060000000000002 28.715000000000003 26.669999999999998 20.555 15-19 23.119999999999997 28.015 28.035 20.830000000000002 20-24 23.49 28.349999999999998 27.345000000000002 20.815 25-29 23.355 28.310000000000002 27.49 20.845 30-34 22.85 28.725 27.58 20.845 35-39 23.32 28.735 27.305 20.64 40-44 23.715 27.644999999999996 28.405 20.235 45-49 22.93 28.325 28.065 20.68 50-54 23.330000000000002 28.16 28.125 20.385 55-59 23.885 27.245 28.139999999999997 20.73 60-64 23.835 28.294999999999998 27.365000000000002 20.505000000000003 65-69 23.925 27.61 28.125 20.34 70-74 23.575 28.34 28.249999999999996 19.835 75-79 23.71 28.410000000000004 27.634999999999998 20.244999999999997 80-84 23.47 28.275 27.894999999999996 20.36 85-89 24.245 27.544999999999998 27.975 20.235 90-94 23.84 27.605 28.575 19.98 95-99 23.905 28.03 27.845 20.22 100-104 23.605 28.185 27.384999999999998 20.825 105-109 24.145 27.985 27.884999999999998 19.985 110-114 23.919999999999998 28.349999999999998 27.615000000000002 20.115 115-119 24.795 28.15 27.534999999999997 19.52 120-124 24.75 27.36 27.965 19.925 125-129 24.349739895958383 27.475990396158462 28.361344537815125 19.812925170068027 130-134 24.665 27.725 27.915 19.695 135-139 24.84 27.805000000000003 28.139999999999997 19.215 140-144 25.035 27.67 27.685 19.61 145-149 25.119999999999997 27.575 27.584999999999997 19.72 150-151 25.7875 27.237499999999997 28.325 18.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 1.0 24 1.5 25 3.0 26 3.5 27 2.0 28 6.0 29 8.5 30 11.5 31 22.0 32 24.5 33 34.5 34 50.5 35 58.5 36 70.5 37 92.0 38 130.0 39 168.0 40 210.0 41 247.5 42 263.5 43 267.0 44 272.5 45 286.5 46 292.0 47 280.0 48 257.0 49 208.0 50 160.5 51 134.5 52 100.5 53 77.5 54 65.0 55 49.0 56 35.5 57 24.5 58 17.5 59 12.5 60 10.0 61 9.5 62 6.0 63 5.0 64 5.5 65 4.0 66 2.5 67 1.5 68 2.0 69 1.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.04 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70689655172413 97.32499999999999 2 1.2170385395537524 2.4 3 0.05070993914807302 0.15 4 0.0 0.0 5 0.02535496957403651 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.4500000000000002 0.0 0.0 0.0 0.0 106-107 1.6375000000000002 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.325 0.0 0.0 0.0 0.0 112-113 2.6875 0.0 0.0 0.0 0.0 114-115 2.9749999999999996 0.0 0.0 0.0 0.0 116-117 3.2125 0.0 0.0 0.0 0.0 118-119 3.4875 0.0 0.0 0.0 0.0 120-121 3.7875 0.0 0.0 0.0 0.0 122-123 4.0375 0.0 0.0 0.0 0.0 124-125 4.574999999999999 0.0 0.0 0.0 0.0 126-127 4.9875 0.0 0.0 0.0 0.0 128-129 5.3375 0.0 0.0 0.0 0.0 130-131 5.762499999999999 0.0 0.0 0.0 0.0 132-133 6.15 0.0 0.0 0.0 0.0 134-135 6.7875 0.0 0.0 0.0 0.0 136-137 7.4 0.0 0.0 0.0 0.0 138-139 7.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606136 spots for SRR7169873.sra Written 606136 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra Read 606128 spots for SRR7169873.sra Written 606128 spots for SRR7169873.sra SRR ids: ['SRR7169873.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ebnlrkfc SRR7169873.sra spots: 12122568 blocks: [[1, 606128], [606129, 1212256], [1212257, 1818384], [1818385, 2424512], [2424513, 3030640], [3030641, 3636768], [3636769, 4242896], [4242897, 4849024], [4849025, 5455152], [5455153, 6061280], [6061281, 6667408], [6667409, 7273536], [7273537, 7879664], [7879665, 8485792], [8485793, 9091920], [9091921, 9698048], [9698049, 10304176], [10304177, 10910304], [10910305, 11516432], [11516433, 12122568]] SRR7169873 file size 4086240 SRR7169873 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169873 SRR7169873_1.fastq SRR7169873_2.fastq Input file: SRR7169873_1.fastq Paired file: SRR7169873_2.fastq trimmed: SRR7169873-trimmed-pair1.fastq, SRR7169873-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:13:52 2025 >> started Wed Feb 12 00:14:05 2025 >> done (13.091s) 12122568 read pairs processed; of these: 10098 ( 0.08%) short read pairs filtered out after trimming by size control 14110 ( 0.12%) empty read pairs filtered out after trimming by size control 12098360 (99.80%) read pairs available; of these: 6164540 (50.95%) trimmed read pairs available after processing 5933820 (49.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 3 0.00% 21 6 0.00% 22 1 0.00% 23 7 0.00% 24 4 0.00% 25 3 0.00% 26 2 0.00% 27 4 0.00% 28 5 0.00% 29 3 0.00% 30 3 0.00% 31 2 0.00% 32 6 0.00% 33 5 0.00% 34 4 0.00% 35 3 0.00% 36 6 0.00% 37 6 0.00% 38 12 0.00% 39 10 0.00% 40 15 0.00% 41 20 0.00% 42 23 0.00% 43 24 0.00% 44 21 0.00% 45 20 0.00% 46 36 0.00% 47 28 0.00% 48 32 0.00% 49 49 0.00% 50 70 0.00% 51 56 0.00% 52 65 0.00% 53 75 0.00% 54 85 0.00% 55 92 0.00% 56 110 0.00% 57 149 0.00% 58 147 0.00% 59 157 0.00% 60 207 0.00% 61 271 0.00% 62 305 0.00% 63 300 0.00% 64 360 0.00% 65 356 0.00% 66 376 0.00% 67 450 0.00% 68 593 0.00% 69 641 0.01% 70 737 0.01% 71 794 0.01% 72 1001 0.01% 73 1128 0.01% 74 1284 0.01% 75 1489 0.01% 76 1603 0.01% 77 1956 0.02% 78 2040 0.02% 79 2226 0.02% 80 2388 0.02% 81 2608 0.02% 82 3047 0.03% 83 3508 0.03% 84 4387 0.04% 85 5005 0.04% 86 5257 0.04% 87 5515 0.05% 88 5999 0.05% 89 6362 0.05% 90 6637 0.05% 91 7358 0.06% 92 7947 0.07% 93 8647 0.07% 94 9067 0.07% 95 9674 0.08% 96 10233 0.08% 97 10643 0.09% 98 11020 0.09% 99 11695 0.10% 100 11971 0.10% 101 12462 0.10% 102 13626 0.11% 103 14114 0.12% 104 15150 0.13% 105 15981 0.13% 106 16393 0.14% 107 16979 0.14% 108 17675 0.15% 109 17761 0.15% 110 18523 0.15% 111 19270 0.16% 112 20101 0.17% 113 20882 0.17% 114 22193 0.18% 115 23168 0.19% 116 23877 0.20% 117 24410 0.20% 118 25023 0.21% 119 25096 0.21% 120 25793 0.21% 121 26502 0.22% 122 27259 0.23% 123 28598 0.24% 124 30097 0.25% 125 31077 0.26% 126 32444 0.27% 127 33326 0.28% 128 34172 0.28% 129 34936 0.29% 130 36276 0.30% 131 36949 0.31% 132 38519 0.32% 133 40830 0.34% 134 43081 0.36% 135 45588 0.38% 136 48240 0.40% 137 50811 0.42% 138 54124 0.45% 139 57328 0.47% 140 61379 0.51% 141 66275 0.55% 142 73623 0.61% 143 82637 0.68% 144 96519 0.80% 145 116606 0.96% 146 146827 1.21% 147 202218 1.67% 148 315240 2.61% 149 639752 5.29% 150 3076374 25.43% 151 5933820 49.05% 12098360 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=9.52 fanout-score-rank=15 prefix-density=0.21 prefix-fanout=5.8 sequence=CAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=12 fanout-score=264.02 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=30.0 sequence=TTCTTCTTCTTTG criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.16 fanout-score-rank=30 prefix-density=0.32 prefix-fanout=2.7 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=6 fanout-score=238.45 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=25.0 sequence=AAGAAGAAGAAA SRR7169873 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:14:58 Started mapping on | Feb 12 00:14:59 Finished on | Feb 12 00:16:24 Mapping speed, Million of reads per hour | 512.40 Number of input reads | 12098360 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 11176809 Uniquely mapped reads % | 92.38% Average mapped length | 293.05 Number of splices: Total | 10322413 Number of splices: Annotated (sjdb) | 10118355 Number of splices: GT/AG | 10151012 Number of splices: GC/AG | 134145 Number of splices: AT/AC | 9529 Number of splices: Non-canonical | 27727 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 225952 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 208744 % of reads mapped to too many loci | 1.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.80% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 705556 705556 705556 N_multimapping 225952 225952 225952 N_noFeature 327700 11066771 377432 N_ambiguous 105905 914 44951 UnstrandedReadsAssigned:10743204 PositiveStrandReadsAssigned:109124 NegativeStrandReadsAssigned:10754426 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169873 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169873-trimmed-pair1.fastq SRR7169873-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,098,360 reads, 10,820,220 reads pseudoaligned [quant] estimated average fragment length: 234.963 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52401 SRR7169873.ke.tsv 34699 SRR7169873.se.tsv 87100 total ==> SRR7169873.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.04 225 11.208 Potri.005G024800.1.v4.1 1035 801.037 66 7.32219 Potri.004G059700.1.v4.1 961 727.057 0 0 Potri.007G009000.2.v4.1 1416 1182.04 0 0 Potri.003G141000.2.v4.1 2943 2709.04 269.116 8.82824 Potri.016G087400.1.v4.1 270 83.546 1203 1279.65 Potri.015G069301.1.v4.1 564 333.928 0 0 Potri.010G195200.1.v4.1 1773 1539.04 100 5.77432 Potri.012G127500.1.v4.1 977 743.047 9598 1147.93 ==> SRR7169873.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1053 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 289 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169873 completed mapping pipeline successfully