Starting /dee2/code/volunteer_pipeline.sh SRR7169874 current disk space = 3051659837440 free memory = 1153664680 SRR7169874 SRAfilesize 7771b19a8787626169501e2b55f99e62 SRR7169874.sra SRR7169874.sra file validated SRR7169874 is paired end SRR7169874 is conventional basespace SRR7169874 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169874_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.06 18.0 18.0 18.0 18.0 32.0 2 27.8375 27.0 27.0 30.0 25.0 31.0 3 30.113 31.0 29.0 33.0 27.0 33.0 4 32.1225 33.0 31.0 33.0 31.0 33.0 5 32.651 33.0 33.0 33.0 32.0 33.0 6 36.89 38.0 37.0 38.0 35.0 38.0 7 37.421 38.0 38.0 38.0 36.0 38.0 8 37.53175 38.0 38.0 38.0 37.0 38.0 9 37.6365 38.0 38.0 38.0 38.0 38.0 10-14 37.4841 38.0 38.0 38.0 37.0 38.0 15-19 37.1714 38.0 38.0 38.0 36.4 38.0 20-24 37.6126 38.0 38.0 38.0 37.6 38.0 25-29 37.61005 38.0 38.0 38.0 38.0 38.0 30-34 37.37915 38.0 38.0 38.0 37.4 38.0 35-39 37.456999999999994 38.0 38.0 38.0 37.4 38.0 40-44 37.30095 38.0 38.0 38.0 37.2 38.0 45-49 37.2512 38.0 38.0 38.0 36.8 38.0 50-54 37.03405 38.0 38.0 38.0 35.8 38.0 55-59 36.8242 38.0 37.8 38.0 34.8 38.0 60-64 36.9967 38.0 38.0 38.0 35.6 38.0 65-69 37.09455 38.0 38.0 38.0 36.0 38.0 70-74 36.7436 38.0 37.8 38.0 34.8 38.0 75-79 36.83725 38.0 38.0 38.0 35.2 38.0 80-84 36.784949999999995 38.0 38.0 38.0 35.0 38.0 85-89 36.768950000000004 38.0 38.0 38.0 34.6 38.0 90-94 36.55885 38.0 38.0 38.0 34.0 38.0 95-99 36.271550000000005 38.0 37.2 38.0 33.6 38.0 100-104 36.10119999999999 38.0 37.0 38.0 33.0 38.0 105-109 35.31175 38.0 35.8 38.0 29.0 38.0 110-114 35.78735 38.0 36.6 38.0 31.4 38.0 115-119 35.57165 38.0 36.0 38.0 30.6 38.0 120-124 35.544050000000006 38.0 36.0 38.0 31.0 38.0 125-129 35.10975 38.0 35.4 38.0 28.6 38.0 130-134 34.614250000000006 38.0 34.8 38.0 27.0 38.0 135-139 34.33775 38.0 34.6 38.0 25.6 38.0 140-144 33.20435 37.6 33.0 38.0 20.4 38.0 145-149 32.37415 36.6 31.8 38.0 15.2 38.0 150-151 28.062875 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 3.0 17 4.0 18 3.0 19 1.0 20 1.0 21 5.0 22 4.0 23 4.0 24 5.0 25 12.0 26 9.0 27 22.0 28 15.0 29 21.0 30 49.0 31 49.0 32 86.0 33 149.0 34 278.0 35 499.0 36 1350.0 37 1427.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.0 30.4 8.674999999999999 35.925000000000004 2 20.95 14.75 34.725 29.575000000000003 3 20.280070017504375 20.005001250312578 25.70642660665166 34.00850212553138 4 20.974999999999998 28.050000000000004 24.2 26.775 5 20.849999999999998 33.275 25.45 20.424999999999997 6 20.5 34.949999999999996 24.725 19.825 7 15.1 27.250000000000004 41.025 16.625 8 18.625 25.3 31.474999999999998 24.6 9 17.95 23.375 33.85 24.825 10-14 20.244999999999997 30.45 26.215 23.09 15-19 20.06 29.145 27.415 23.380000000000003 20-24 20.14 29.065 27.169999999999998 23.625 25-29 20.195 28.99 27.744999999999997 23.07 30-34 20.424999999999997 28.585 27.76 23.23 35-39 20.244999999999997 28.59 27.339999999999996 23.825 40-44 20.380000000000003 29.304999999999996 26.775 23.54 45-49 20.674999999999997 28.105000000000004 27.685 23.535 50-54 20.495 28.549999999999997 27.584999999999997 23.369999999999997 55-59 20.53 28.904999999999998 26.919999999999998 23.645 60-64 20.560000000000002 28.715000000000003 27.075 23.65 65-69 20.03 28.785 26.865 24.32 70-74 20.424999999999997 28.655 27.384999999999998 23.535 75-79 20.169999999999998 29.26 27.41 23.16 80-84 19.650000000000002 29.189999999999998 27.060000000000002 24.099999999999998 85-89 20.175 28.449999999999996 27.455000000000002 23.919999999999998 90-94 20.315 28.4 27.73 23.555 95-99 20.715 28.689999999999998 27.185 23.41 100-104 20.724999999999998 29.244999999999997 26.865 23.165 105-109 20.325 28.310000000000002 27.685 23.68 110-114 20.57 28.175 27.92 23.335 115-119 20.979999999999997 28.244999999999997 27.625 23.150000000000002 120-124 20.91 28.49 26.740000000000002 23.86 125-129 20.71 28.09 27.534999999999997 23.665 130-134 20.66 28.265 27.38 23.695 135-139 20.655 28.294999999999998 26.935 24.115000000000002 140-144 20.794999999999998 28.15 27.169999999999998 23.885 145-149 20.825 27.744999999999997 27.595 23.835 150-151 20.8875 27.3375 28.575 23.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 3.0 25 3.5 26 4.0 27 3.5 28 7.5 29 14.0 30 22.5 31 29.0 32 30.0 33 37.0 34 48.5 35 66.0 36 85.5 37 114.0 38 139.0 39 171.5 40 211.5 41 224.5 42 228.5 43 244.5 44 270.5 45 280.0 46 265.0 47 249.0 48 236.5 49 211.0 50 174.5 51 147.0 52 111.5 53 90.0 54 74.0 55 48.0 56 38.5 57 27.5 58 19.5 59 17.5 60 14.5 61 10.5 62 8.5 63 5.5 64 1.5 65 0.5 66 1.0 67 0.5 68 2.0 69 2.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.5 0.0 0.0 0.0 0.0 118-119 1.6749999999999998 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.1500000000000004 0.0 0.0 0.0 0.0 126-127 2.3 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.5375 0.0 0.0 0.0 0.0 132-133 2.8 0.0 0.0 0.0 0.0 134-135 3.0375 0.0 0.0 0.0 0.0 136-137 3.2625 0.0 0.0 0.0 0.0 138-139 3.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTAATT 10 0.006830828 145.0 2 AATTTCC 10 0.006830828 145.0 5 >>END_MODULE SRR7169874 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169874_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.34075 34.0 33.0 34.0 33.0 34.0 2 33.4145 34.0 33.0 34.0 33.0 34.0 3 33.45925 34.0 33.0 34.0 33.0 34.0 4 33.4085 34.0 33.0 34.0 33.0 34.0 5 33.42775 34.0 33.0 34.0 33.0 34.0 6 37.6085 38.0 38.0 38.0 38.0 38.0 7 37.55925 38.0 38.0 38.0 38.0 38.0 8 37.5975 38.0 38.0 38.0 38.0 38.0 9 37.10325 38.0 38.0 38.0 37.0 38.0 10-14 37.5005 38.0 38.0 38.0 37.8 38.0 15-19 37.47965000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.363150000000005 38.0 38.0 38.0 37.4 38.0 25-29 37.21525 38.0 38.0 38.0 36.8 38.0 30-34 37.48935 38.0 38.0 38.0 38.0 38.0 35-39 37.3192 38.0 38.0 38.0 37.2 38.0 40-44 37.363350000000004 38.0 38.0 38.0 37.2 38.0 45-49 37.367549999999994 38.0 38.0 38.0 37.6 38.0 50-54 37.006249999999994 38.0 38.0 38.0 36.0 38.0 55-59 37.329150000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.334149999999994 38.0 38.0 38.0 37.0 38.0 65-69 36.98115 38.0 38.0 38.0 35.8 38.0 70-74 36.41825 38.0 37.6 38.0 33.0 38.0 75-79 36.88250000000001 38.0 38.0 38.0 35.6 38.0 80-84 36.29485 38.0 37.6 38.0 32.6 38.0 85-89 36.9688 38.0 38.0 38.0 35.8 38.0 90-94 37.007799999999996 38.0 38.0 38.0 36.0 38.0 95-99 36.946600000000004 38.0 38.0 38.0 36.0 38.0 100-104 36.631299999999996 38.0 38.0 38.0 35.0 38.0 105-109 36.486 38.0 38.0 38.0 34.4 38.0 110-114 36.54805 38.0 38.0 38.0 34.6 38.0 115-119 36.3832 38.0 38.0 38.0 34.2 38.0 120-124 36.07895 38.0 37.6 38.0 33.6 38.0 125-129 36.0105 38.0 37.2 38.0 33.2 38.0 130-134 35.841449999999995 38.0 36.8 38.0 32.6 38.0 135-139 35.44255 38.0 36.0 38.0 30.6 38.0 140-144 35.099000000000004 38.0 36.0 38.0 31.0 38.0 145-149 34.732150000000004 38.0 35.6 38.0 29.6 38.0 150-151 30.1755 35.5 27.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 3.0 12 2.0 13 1.0 14 1.0 15 1.0 16 2.0 17 6.0 18 1.0 19 0.0 20 6.0 21 3.0 22 3.0 23 5.0 24 5.0 25 10.0 26 17.0 27 18.0 28 17.0 29 20.0 30 30.0 31 31.0 32 59.0 33 73.0 34 115.0 35 235.0 36 643.0 37 2688.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.95 20.65 13.575000000000001 27.825 2 25.55 26.825 30.775000000000002 16.85 3 19.900000000000002 29.775000000000002 31.95 18.375 4 24.75 32.824999999999996 22.85 19.575 5 23.825 35.925000000000004 22.725 17.525 6 20.95 36.5 23.575 18.975 7 19.775000000000002 22.1 38.224999999999994 19.900000000000002 8 22.725 24.525 27.075 25.674999999999997 9 22.475 24.25 30.175 23.1 10-14 23.085 28.79 26.465 21.66 15-19 22.875 28.194999999999997 27.750000000000004 21.18 20-24 22.675 28.265 27.97 21.09 25-29 22.564999999999998 27.985 28.13 21.32 30-34 22.12 28.249999999999996 28.294999999999998 21.335 35-39 22.13 28.555000000000003 28.249999999999996 21.065 40-44 23.465 28.23 27.525 20.78 45-49 23.169999999999998 27.99 27.865000000000002 20.974999999999998 50-54 23.09 28.21 27.735 20.965 55-59 22.884999999999998 27.825 28.720000000000002 20.57 60-64 23.29 27.54 28.46 20.71 65-69 23.275000000000002 28.205000000000002 28.035 20.485 70-74 23.330000000000002 27.905 28.16 20.605 75-79 23.35 27.875 27.97 20.805 80-84 23.735 27.715 28.22 20.330000000000002 85-89 23.31 27.355 28.38 20.955 90-94 23.505000000000003 27.77 28.305000000000003 20.419999999999998 95-99 23.77 27.955000000000002 27.925 20.349999999999998 100-104 23.395 27.894999999999996 28.275 20.435 105-109 23.465 27.43 28.485 20.62 110-114 23.44 27.805000000000003 27.845 20.91 115-119 23.955000000000002 28.025 27.6 20.419999999999998 120-124 23.825 27.83 27.91 20.435 125-129 24.13 27.650000000000002 27.62 20.599999999999998 130-134 24.13 27.939999999999998 27.474999999999998 20.455000000000002 135-139 24.63 27.77 26.955000000000002 20.645 140-144 24.310000000000002 27.665 27.595 20.43 145-149 24.725 28.144999999999996 26.85 20.28 150-151 23.0 28.8625 27.6125 20.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 1.0 26 3.5 27 4.0 28 3.0 29 5.5 30 11.5 31 16.0 32 21.5 33 38.5 34 52.5 35 63.0 36 78.0 37 104.5 38 140.0 39 165.5 40 190.0 41 235.0 42 267.5 43 295.5 44 310.0 45 289.0 46 282.5 47 264.5 48 232.5 49 205.0 50 163.5 51 127.5 52 106.5 53 88.5 54 65.0 55 46.0 56 32.5 57 24.0 58 23.0 59 14.5 60 6.0 61 5.5 62 5.5 63 3.0 64 1.5 65 0.5 66 1.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.6499999999999999 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.775 0.0 0.0 0.0 0.0 120-121 1.875 0.0 0.0 0.0 0.0 122-123 2.0875000000000004 0.0 0.0 0.0 0.0 124-125 2.2249999999999996 0.0 0.0 0.0 0.0 126-127 2.375 0.0 0.0 0.0 0.0 128-129 2.4875 0.0 0.0 0.0 0.0 130-131 2.625 0.0 0.0 0.0 0.0 132-133 2.875 0.0 0.0 0.0 0.0 134-135 3.125 0.0 0.0 0.0 0.0 136-137 3.3875 0.0 0.0 0.0 0.0 138-139 3.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTCCC 10 0.006830828 145.0 4 >>END_MODULE Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594295 spots for SRR7169874.sra Written 594295 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra Read 594290 spots for SRR7169874.sra Written 594290 spots for SRR7169874.sra SRR ids: ['SRR7169874.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u0c6xyeg SRR7169874.sra spots: 11885805 blocks: [[1, 594290], [594291, 1188580], [1188581, 1782870], [1782871, 2377160], [2377161, 2971450], [2971451, 3565740], [3565741, 4160030], [4160031, 4754320], [4754321, 5348610], [5348611, 5942900], [5942901, 6537190], [6537191, 7131480], [7131481, 7725770], [7725771, 8320060], [8320061, 8914350], [8914351, 9508640], [9508641, 10102930], [10102931, 10697220], [10697221, 11291510], [11291511, 11885805]] SRR7169874 file size 4006008 SRR7169874 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169874 SRR7169874_1.fastq SRR7169874_2.fastq Input file: SRR7169874_1.fastq Paired file: SRR7169874_2.fastq trimmed: SRR7169874-trimmed-pair1.fastq, SRR7169874-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:16:11 2025 >> started Wed Feb 12 00:16:26 2025 >> done (14.778s) 11885805 read pairs processed; of these: 8094 ( 0.07%) short read pairs filtered out after trimming by size control 7141 ( 0.06%) empty read pairs filtered out after trimming by size control 11870570 (99.87%) read pairs available; of these: 4913276 (41.39%) trimmed read pairs available after processing 6957294 (58.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 0 0.00% 21 2 0.00% 22 0 0.00% 23 2 0.00% 24 2 0.00% 25 1 0.00% 26 1 0.00% 27 7 0.00% 28 0 0.00% 29 4 0.00% 30 6 0.00% 31 2 0.00% 32 10 0.00% 33 7 0.00% 34 3 0.00% 35 4 0.00% 36 7 0.00% 37 7 0.00% 38 14 0.00% 39 6 0.00% 40 14 0.00% 41 15 0.00% 42 12 0.00% 43 30 0.00% 44 17 0.00% 45 15 0.00% 46 24 0.00% 47 32 0.00% 48 36 0.00% 49 31 0.00% 50 38 0.00% 51 52 0.00% 52 50 0.00% 53 44 0.00% 54 68 0.00% 55 78 0.00% 56 90 0.00% 57 105 0.00% 58 123 0.00% 59 139 0.00% 60 169 0.00% 61 207 0.00% 62 243 0.00% 63 268 0.00% 64 275 0.00% 65 332 0.00% 66 338 0.00% 67 348 0.00% 68 429 0.00% 69 540 0.00% 70 587 0.00% 71 638 0.01% 72 795 0.01% 73 903 0.01% 74 1043 0.01% 75 1104 0.01% 76 1181 0.01% 77 1277 0.01% 78 1361 0.01% 79 1550 0.01% 80 1717 0.01% 81 1956 0.02% 82 2209 0.02% 83 2472 0.02% 84 2948 0.02% 85 3374 0.03% 86 3545 0.03% 87 3775 0.03% 88 3904 0.03% 89 4065 0.03% 90 4464 0.04% 91 4717 0.04% 92 5382 0.05% 93 5528 0.05% 94 5890 0.05% 95 5988 0.05% 96 6369 0.05% 97 6483 0.05% 98 6465 0.05% 99 6769 0.06% 100 7113 0.06% 101 7522 0.06% 102 7929 0.07% 103 8393 0.07% 104 9002 0.08% 105 9058 0.08% 106 9467 0.08% 107 9743 0.08% 108 9815 0.08% 109 9958 0.08% 110 10147 0.09% 111 10729 0.09% 112 10860 0.09% 113 11592 0.10% 114 12223 0.10% 115 12760 0.11% 116 12892 0.11% 117 13341 0.11% 118 13568 0.11% 119 13772 0.12% 120 13821 0.12% 121 14391 0.12% 122 14882 0.13% 123 15575 0.13% 124 16626 0.14% 125 17268 0.15% 126 17723 0.15% 127 18509 0.16% 128 19150 0.16% 129 19802 0.17% 130 20222 0.17% 131 21063 0.18% 132 22374 0.19% 133 23702 0.20% 134 25156 0.21% 135 26583 0.22% 136 28390 0.24% 137 30361 0.26% 138 33035 0.28% 139 35516 0.30% 140 39260 0.33% 141 43035 0.36% 142 48402 0.41% 143 56423 0.48% 144 67735 0.57% 145 86236 0.73% 146 111360 0.94% 147 154662 1.30% 148 246050 2.07% 149 515085 4.34% 150 2798287 23.57% 151 6957294 58.61% 11870570 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=41 prefix-density=0.17 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.13 sequence-density-rank=11 fanout-score=99.20 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=19.7 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=39 prefix-density=0.35 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=262.28 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=28.2 sequence=AAGAAGAAGAAA SRR7169874 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:17:09 Started mapping on | Feb 12 00:17:09 Finished on | Feb 12 00:18:29 Mapping speed, Million of reads per hour | 534.18 Number of input reads | 11870570 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11180705 Uniquely mapped reads % | 94.19% Average mapped length | 295.90 Number of splices: Total | 10999014 Number of splices: Annotated (sjdb) | 10831596 Number of splices: GT/AG | 10840429 Number of splices: GC/AG | 128761 Number of splices: AT/AC | 8253 Number of splices: Non-canonical | 21571 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 210582 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 134911 % of reads mapped to too many loci | 1.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 487314 487314 487314 N_multimapping 210582 210582 210582 N_noFeature 228038 11074610 273266 N_ambiguous 109064 722 47661 UnstrandedReadsAssigned:10843603 PositiveStrandReadsAssigned:105373 NegativeStrandReadsAssigned:10859778 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169874 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169874-trimmed-pair1.fastq SRR7169874-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,870,570 reads, 10,837,388 reads pseudoaligned [quant] estimated average fragment length: 284.634 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 SRR7169874.ke.tsv 34699 SRR7169874.se.tsv 87100 total ==> SRR7169874.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1734.37 175 9.12976 Potri.005G024800.1.v4.1 1035 751.366 26 3.13101 Potri.004G059700.1.v4.1 961 677.408 2 0.267142 Potri.007G009000.2.v4.1 1416 1132.37 0 0 Potri.003G141000.2.v4.1 2943 2659.37 184.052 6.26216 Potri.016G087400.1.v4.1 270 73.1312 1144 1415.42 Potri.015G069301.1.v4.1 564 287.632 0 0 Potri.010G195200.1.v4.1 1773 1489.37 4 0.243008 Potri.012G127500.1.v4.1 977 693.38 3861 503.837 ==> SRR7169874.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 751 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 124 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169874 completed mapping pipeline successfully