Starting /dee2/code/volunteer_pipeline.sh SRR7169875 current disk space = 3051373268992 free memory = 1477529916 SRR7169875 SRAfilesize 841520e7853ecd2de88d963ce1e47c2a SRR7169875.sra SRR7169875.sra file validated SRR7169875 is paired end SRR7169875 is conventional basespace SRR7169875 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169875_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.992 18.0 18.0 28.0 18.0 33.0 2 29.10175 29.0 27.0 31.0 27.0 33.0 3 31.28275 33.0 31.0 33.0 29.0 33.0 4 32.4395 33.0 33.0 33.0 31.0 33.0 5 32.74375 33.0 33.0 33.0 31.0 34.0 6 36.84475 38.0 37.0 38.0 34.0 38.0 7 37.364 38.0 38.0 38.0 36.0 38.0 8 37.55175 38.0 38.0 38.0 37.0 38.0 9 36.6025 38.0 38.0 38.0 34.0 38.0 10-14 37.53575 38.0 38.0 38.0 37.0 38.0 15-19 37.45085 38.0 38.0 38.0 37.0 38.0 20-24 37.452600000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.572199999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.54585 38.0 38.0 38.0 37.8 38.0 35-39 37.5241 38.0 38.0 38.0 37.8 38.0 40-44 37.39305 38.0 38.0 38.0 37.0 38.0 45-49 37.5104 38.0 38.0 38.0 37.0 38.0 50-54 37.4058 38.0 38.0 38.0 37.0 38.0 55-59 37.319 38.0 38.0 38.0 36.8 38.0 60-64 37.22855 38.0 38.0 38.0 36.0 38.0 65-69 37.101800000000004 38.0 38.0 38.0 36.0 38.0 70-74 37.0329 38.0 38.0 38.0 35.6 38.0 75-79 36.978 38.0 38.0 38.0 35.4 38.0 80-84 36.62915 38.0 37.6 38.0 34.4 38.0 85-89 36.05415000000001 38.0 37.0 38.0 32.2 38.0 90-94 36.547700000000006 38.0 37.6 38.0 34.0 38.0 95-99 36.52845 38.0 37.6 38.0 34.0 38.0 100-104 36.2104 38.0 37.0 38.0 33.2 38.0 105-109 35.164249999999996 38.0 35.4 38.0 27.0 38.0 110-114 35.1464 38.0 35.4 38.0 26.8 38.0 115-119 35.38719999999999 38.0 35.8 38.0 30.0 38.0 120-124 35.28935 38.0 35.8 38.0 29.0 38.0 125-129 33.628949999999996 37.4 32.2 38.0 22.8 38.0 130-134 33.91895000000001 37.6 33.8 38.0 24.0 38.0 135-139 34.185399999999994 38.0 33.8 38.0 24.8 38.0 140-144 33.07405 38.0 32.2 38.0 19.8 38.0 145-149 31.721449999999997 36.4 31.0 38.0 14.0 38.0 150-151 27.551000000000002 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 0.0 15 1.0 16 2.0 17 0.0 18 0.0 19 4.0 20 4.0 21 3.0 22 2.0 23 4.0 24 4.0 25 9.0 26 13.0 27 17.0 28 24.0 29 33.0 30 44.0 31 75.0 32 98.0 33 159.0 34 267.0 35 549.0 36 1365.0 37 1320.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.725 18.5 11.225 33.550000000000004 2 22.075 16.75 33.25 27.925 3 18.825 22.325 25.650000000000002 33.2 4 20.674999999999997 28.799999999999997 23.7 26.825 5 23.025000000000002 31.5 24.075 21.4 6 20.225 35.699999999999996 24.349999999999998 19.725 7 15.2 27.6 39.800000000000004 17.4 8 18.825 26.275 29.799999999999997 25.1 9 16.875 26.025 32.324999999999996 24.775 10-14 19.965 31.025000000000002 26.064999999999998 22.945 15-19 19.895 28.675 27.735 23.695 20-24 19.875 29.409999999999997 26.87 23.845 25-29 20.380000000000003 30.03 26.735 22.855 30-34 20.105 29.38 26.61 23.905 35-39 20.27 29.349999999999998 27.084999999999997 23.294999999999998 40-44 20.995 28.810000000000002 26.75 23.445 45-49 20.51 28.57 27.089999999999996 23.830000000000002 50-54 19.5 29.145 27.005000000000003 24.349999999999998 55-59 19.88 29.285 26.915 23.919999999999998 60-64 20.335 28.93 26.88 23.855 65-69 20.225 28.915000000000003 26.790000000000003 24.07 70-74 20.685000000000002 29.134999999999998 26.93 23.25 75-79 20.669999999999998 28.744999999999997 27.089999999999996 23.494999999999997 80-84 20.635 28.749999999999996 27.105 23.51 85-89 20.575 28.675 26.99 23.76 90-94 20.445 28.499999999999996 27.075 23.98 95-99 20.974999999999998 28.485 27.529999999999998 23.01 100-104 20.919999999999998 28.95 26.865 23.265 105-109 20.935000000000002 28.854999999999997 26.69 23.52 110-114 21.375 28.765 26.345000000000002 23.515 115-119 21.224999999999998 28.825 26.8 23.150000000000002 120-124 20.765 28.15 27.334999999999997 23.75 125-129 20.445 28.49 27.229999999999997 23.835 130-134 20.645 28.999999999999996 26.66 23.695 135-139 21.11 28.42 26.590000000000003 23.880000000000003 140-144 20.875 28.455000000000002 26.424999999999997 24.245 145-149 20.54 27.944999999999997 27.400000000000002 24.115000000000002 150-151 20.8625 28.375 26.625 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.0 21 1.0 22 2.5 23 2.5 24 2.0 25 6.0 26 9.5 27 11.5 28 17.5 29 20.0 30 23.5 31 27.5 32 39.5 33 48.0 34 57.0 35 69.5 36 87.5 37 109.5 38 127.5 39 142.5 40 176.5 41 212.0 42 208.5 43 222.5 44 243.0 45 252.0 46 258.0 47 246.5 48 223.5 49 213.0 50 190.5 51 166.0 52 148.0 53 112.5 54 87.5 55 64.0 56 42.0 57 28.0 58 22.5 59 20.0 60 15.5 61 12.0 62 8.5 63 5.0 64 2.5 65 1.5 66 1.0 67 2.5 68 2.0 69 1.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 1.8875 0.0 0.0 0.0 0.0 120-121 2.0375 0.0 0.0 0.0 0.0 122-123 2.1500000000000004 0.0 0.0 0.0 0.0 124-125 2.275 0.0 0.0 0.0 0.0 126-127 2.35 0.0 0.0 0.0 0.0 128-129 2.525 0.0 0.0 0.0 0.0 130-131 2.825 0.0 0.0 0.0 0.0 132-133 3.0125 0.0 0.0 0.0 0.0 134-135 3.1875 0.0 0.0 0.0 0.0 136-137 3.425 0.0 0.0 0.0 0.0 138-139 3.7750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGAGTT 10 0.006830828 145.0 4 >>END_MODULE SRR7169875 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169875_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2385 34.0 33.0 34.0 33.0 34.0 2 33.28675 34.0 33.0 34.0 33.0 34.0 3 33.28625 34.0 33.0 34.0 33.0 34.0 4 33.24825 34.0 33.0 34.0 33.0 34.0 5 33.27475 34.0 33.0 34.0 33.0 34.0 6 37.397 38.0 38.0 38.0 38.0 38.0 7 37.4535 38.0 38.0 38.0 38.0 38.0 8 37.37275 38.0 38.0 38.0 37.0 38.0 9 37.391 38.0 38.0 38.0 38.0 38.0 10-14 37.3146 38.0 38.0 38.0 37.2 38.0 15-19 37.274 38.0 38.0 38.0 37.0 38.0 20-24 37.251999999999995 38.0 38.0 38.0 37.4 38.0 25-29 36.95115 38.0 38.0 38.0 36.2 38.0 30-34 37.22735 38.0 38.0 38.0 37.0 38.0 35-39 36.981700000000004 38.0 38.0 38.0 36.0 38.0 40-44 37.21345 38.0 38.0 38.0 37.0 38.0 45-49 36.8769 38.0 38.0 38.0 35.4 38.0 50-54 37.097 38.0 38.0 38.0 36.6 38.0 55-59 37.111149999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.0369 38.0 38.0 38.0 36.4 38.0 65-69 37.035999999999994 38.0 38.0 38.0 36.0 38.0 70-74 37.0023 38.0 38.0 38.0 36.2 38.0 75-79 36.98135 38.0 38.0 38.0 36.0 38.0 80-84 36.8748 38.0 38.0 38.0 36.0 38.0 85-89 36.71145 38.0 38.0 38.0 35.2 38.0 90-94 36.8029 38.0 38.0 38.0 35.8 38.0 95-99 36.666399999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.426 38.0 38.0 38.0 34.0 38.0 105-109 36.390049999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.244150000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.13175 38.0 37.8 38.0 33.6 38.0 120-124 35.915350000000004 38.0 37.2 38.0 32.8 38.0 125-129 35.12425 38.0 35.8 38.0 27.0 38.0 130-134 35.380250000000004 38.0 36.0 38.0 30.8 38.0 135-139 33.9915 38.0 34.2 38.0 23.2 38.0 140-144 33.74345 38.0 33.0 38.0 22.4 38.0 145-149 33.110949999999995 38.0 32.6 38.0 19.6 38.0 150-151 29.107374999999998 35.0 17.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 3.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 3.0 15 1.0 16 3.0 17 3.0 18 3.0 19 3.0 20 8.0 21 6.0 22 4.0 23 11.0 24 4.0 25 8.0 26 10.0 27 21.0 28 17.0 29 33.0 30 44.0 31 45.0 32 72.0 33 97.0 34 144.0 35 295.0 36 707.0 37 2442.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.7 21.3 16.55 24.45 2 27.725 26.35 27.700000000000003 18.224999999999998 3 20.875 29.525000000000002 28.725 20.875 4 23.674999999999997 33.900000000000006 23.375 19.05 5 25.650000000000002 35.175 20.849999999999998 18.325 6 21.2 37.125 23.25 18.425 7 20.375 22.525000000000002 35.949999999999996 21.15 8 22.275 26.05 26.125 25.55 9 22.625 26.174999999999997 27.425 23.775 10-14 23.235 28.77 26.195 21.8 15-19 23.865 27.925 26.784999999999997 21.425 20-24 22.825 28.560000000000002 27.46 21.154999999999998 25-29 23.630000000000003 27.775 27.255000000000003 21.34 30-34 22.74 28.325 27.51 21.425 35-39 23.56 27.83 27.105 21.505 40-44 23.255 28.470000000000002 27.29 20.985 45-49 23.955000000000002 27.43 27.275 21.34 50-54 23.82 27.74 27.27 21.17 55-59 23.04 28.249999999999996 27.275 21.435000000000002 60-64 23.29 28.050000000000004 27.54 21.12 65-69 24.09 28.044999999999998 27.105 20.76 70-74 23.71 27.705000000000002 27.325 21.26 75-79 23.74 26.790000000000003 28.249999999999996 21.22 80-84 23.525 28.15 27.115000000000002 21.21 85-89 23.525 27.485 27.865000000000002 21.125 90-94 23.035 27.944999999999997 27.97 21.05 95-99 24.104999999999997 27.884999999999998 27.07 20.94 100-104 23.96 27.650000000000002 27.445000000000004 20.945 105-109 23.47 27.615000000000002 27.73 21.185000000000002 110-114 24.435000000000002 27.029999999999998 27.400000000000002 21.135 115-119 24.14 27.36 27.71 20.79 120-124 24.465 27.529999999999998 27.315 20.69 125-129 23.89 27.595 27.67 20.845 130-134 24.465 27.38 27.115000000000002 21.04 135-139 23.64 28.03 27.22 21.11 140-144 24.215 27.435 27.555000000000003 20.794999999999998 145-149 24.315 27.284999999999997 27.685 20.715 150-151 24.212500000000002 27.1125 27.725 20.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 2.0 25 4.0 26 4.0 27 2.5 28 5.0 29 7.0 30 6.5 31 7.0 32 9.5 33 17.5 34 29.5 35 50.0 36 66.0 37 80.5 38 117.5 39 159.5 40 199.0 41 200.0 42 220.0 43 267.0 44 287.0 45 316.0 46 315.5 47 277.0 48 256.0 49 237.0 50 197.5 51 157.5 52 121.5 53 101.5 54 75.5 55 53.5 56 41.5 57 26.0 58 18.5 59 16.5 60 14.0 61 7.5 62 4.0 63 5.0 64 4.5 65 3.0 66 3.0 67 2.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 1.8624999999999998 0.0 0.0 0.0 0.0 118-119 1.975 0.0 0.0 0.0 0.0 120-121 2.0875 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.35 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.6 0.0 0.0 0.0 0.0 130-131 2.875 0.0 0.0 0.0 0.0 132-133 3.025 0.0 0.0 0.0 0.0 134-135 3.1875 0.0 0.0 0.0 0.0 136-137 3.425 0.0 0.0 0.0 0.0 138-139 3.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTTTG 10 0.006830828 145.0 5 ATTTGCT 10 0.006830828 145.0 4 ATCCTTT 10 0.006830828 145.0 4 >>END_MODULE Read 575005 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Read 575021 spots for SRR7169875.sra Written 575021 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra Read 575005 spots for SRR7169875.sra Written 575005 spots for SRR7169875.sra SRR ids: ['SRR7169875.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y5y4v8u7 SRR7169875.sra spots: 11500116 blocks: [[1, 575005], [575006, 1150010], [1150011, 1725015], [1725016, 2300020], [2300021, 2875025], [2875026, 3450030], [3450031, 4025035], [4025036, 4600040], [4600041, 5175045], [5175046, 5750050], [5750051, 6325055], [6325056, 6900060], [6900061, 7475065], [7475066, 8050070], [8050071, 8625075], [8625076, 9200080], [9200081, 9775085], [9775086, 10350090], [10350091, 10925095], [10925096, 11500116]] SRR7169875 file size 3875311 SRR7169875 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169875 SRR7169875_1.fastq SRR7169875_2.fastq Input file: SRR7169875_1.fastq Paired file: SRR7169875_2.fastq trimmed: SRR7169875-trimmed-pair1.fastq, SRR7169875-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:28:20 2025 >> started Wed Feb 12 00:28:32 2025 >> done (12.170s) 11500116 read pairs processed; of these: 14247 ( 0.12%) short read pairs filtered out after trimming by size control 18572 ( 0.16%) empty read pairs filtered out after trimming by size control 11467297 (99.71%) read pairs available; of these: 5305118 (46.26%) trimmed read pairs available after processing 6162179 (53.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 0 0.00% 21 2 0.00% 22 5 0.00% 23 2 0.00% 24 6 0.00% 25 8 0.00% 26 4 0.00% 27 5 0.00% 28 1 0.00% 29 5 0.00% 30 4 0.00% 31 4 0.00% 32 3 0.00% 33 2 0.00% 34 7 0.00% 35 7 0.00% 36 6 0.00% 37 9 0.00% 38 8 0.00% 39 6 0.00% 40 11 0.00% 41 16 0.00% 42 8 0.00% 43 5 0.00% 44 17 0.00% 45 15 0.00% 46 18 0.00% 47 22 0.00% 48 29 0.00% 49 32 0.00% 50 34 0.00% 51 41 0.00% 52 48 0.00% 53 56 0.00% 54 53 0.00% 55 71 0.00% 56 69 0.00% 57 87 0.00% 58 118 0.00% 59 114 0.00% 60 124 0.00% 61 190 0.00% 62 203 0.00% 63 223 0.00% 64 268 0.00% 65 229 0.00% 66 304 0.00% 67 318 0.00% 68 356 0.00% 69 435 0.00% 70 505 0.00% 71 598 0.01% 72 730 0.01% 73 782 0.01% 74 864 0.01% 75 1113 0.01% 76 1310 0.01% 77 1480 0.01% 78 1377 0.01% 79 1549 0.01% 80 1646 0.01% 81 1936 0.02% 82 2173 0.02% 83 2288 0.02% 84 3241 0.03% 85 3797 0.03% 86 3975 0.03% 87 4330 0.04% 88 4608 0.04% 89 4731 0.04% 90 4824 0.04% 91 5102 0.04% 92 5487 0.05% 93 5908 0.05% 94 6266 0.05% 95 6643 0.06% 96 6733 0.06% 97 6946 0.06% 98 7100 0.06% 99 7229 0.06% 100 7855 0.07% 101 8099 0.07% 102 8576 0.07% 103 9163 0.08% 104 9492 0.08% 105 10227 0.09% 106 10547 0.09% 107 10753 0.09% 108 11136 0.10% 109 11453 0.10% 110 11661 0.10% 111 12072 0.11% 112 12618 0.11% 113 13470 0.12% 114 13878 0.12% 115 14589 0.13% 116 14951 0.13% 117 15128 0.13% 118 15283 0.13% 119 15559 0.14% 120 15955 0.14% 121 16554 0.14% 122 16803 0.15% 123 17866 0.16% 124 18693 0.16% 125 19474 0.17% 126 20273 0.18% 127 21313 0.19% 128 21947 0.19% 129 22442 0.20% 130 23675 0.21% 131 24804 0.22% 132 25984 0.23% 133 27626 0.24% 134 29239 0.25% 135 31219 0.27% 136 33514 0.29% 137 35931 0.31% 138 39093 0.34% 139 42393 0.37% 140 46097 0.40% 141 51103 0.45% 142 58419 0.51% 143 67378 0.59% 144 81663 0.71% 145 101608 0.89% 146 132798 1.16% 147 186702 1.63% 148 298594 2.60% 149 600146 5.23% 150 2830421 24.68% 151 6162179 53.74% 11467297 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=39 prefix-density=0.33 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=239.15 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=18.3 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=43 prefix-density=0.23 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.14 sequence-density-rank=18 fanout-score=43.88 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=11.6 sequence=TGTTGGTGGTGGTACTGGA SRR7169875 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:29:15 Started mapping on | Feb 12 00:29:15 Finished on | Feb 12 00:30:31 Mapping speed, Million of reads per hour | 543.19 Number of input reads | 11467297 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10666630 Uniquely mapped reads % | 93.02% Average mapped length | 295.19 Number of splices: Total | 9594767 Number of splices: Annotated (sjdb) | 9441938 Number of splices: GT/AG | 9462892 Number of splices: GC/AG | 107106 Number of splices: AT/AC | 7408 Number of splices: Non-canonical | 17361 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 195532 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 11603 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.15% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 618433 618433 618433 N_multimapping 195532 195532 195532 N_noFeature 194520 10531487 239113 N_ambiguous 136816 604 45906 UnstrandedReadsAssigned:10335294 PositiveStrandReadsAssigned:134539 NegativeStrandReadsAssigned:10381611 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169875 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169875-trimmed-pair1.fastq SRR7169875-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,467,297 reads, 10,307,230 reads pseudoaligned [quant] estimated average fragment length: 281.661 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,235 rounds 52401 SRR7169875.ke.tsv 34699 SRR7169875.se.tsv 87100 total ==> SRR7169875.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.34 164 8.42835 Potri.005G024800.1.v4.1 1035 754.339 44 5.20798 Potri.004G059700.1.v4.1 961 680.368 0 0 Potri.007G009000.2.v4.1 1416 1135.34 0 0 Potri.003G141000.2.v4.1 2943 2662.34 151.028 5.06499 Potri.016G087400.1.v4.1 270 75.1553 945.544 1123.33 Potri.015G069301.1.v4.1 564 289.574 0 0 Potri.010G195200.1.v4.1 1773 1492.34 5 0.299148 Potri.012G127500.1.v4.1 977 696.351 4237 543.267 ==> SRR7169875.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 994 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 144 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7169875 completed mapping pipeline successfully