Starting /dee2/code/volunteer_pipeline.sh SRR7169876 current disk space = 3051747024896 free memory = 1477867020 SRR7169876 SRAfilesize 18bce292c3d7644082e7653422f162b9 SRR7169876.sra SRR7169876.sra file validated SRR7169876 is paired end SRR7169876 is conventional basespace SRR7169876 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169876_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.51175 18.0 18.0 30.0 18.0 32.0 2 31.0055 31.0 30.0 33.0 28.0 33.0 3 32.12975 33.0 31.0 33.0 31.0 33.0 4 32.6195 33.0 33.0 33.0 31.0 34.0 5 33.1855 33.0 33.0 34.0 33.0 34.0 6 37.24625 38.0 37.0 38.0 36.0 38.0 7 37.50675 38.0 38.0 38.0 37.0 38.0 8 37.597 38.0 38.0 38.0 37.0 38.0 9 36.72375 38.0 38.0 38.0 35.0 38.0 10-14 37.6229 38.0 38.0 38.0 37.6 38.0 15-19 37.458650000000006 38.0 38.0 38.0 37.4 38.0 20-24 37.4199 38.0 38.0 38.0 37.0 38.0 25-29 37.56269999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.518950000000004 38.0 38.0 38.0 37.8 38.0 35-39 37.51055 38.0 38.0 38.0 37.8 38.0 40-44 37.32625 38.0 38.0 38.0 36.8 38.0 45-49 37.50205 38.0 38.0 38.0 37.2 38.0 50-54 37.3425 38.0 38.0 38.0 37.0 38.0 55-59 37.2757 38.0 38.0 38.0 36.6 38.0 60-64 37.154650000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.050650000000005 38.0 38.0 38.0 35.8 38.0 70-74 36.98755 38.0 38.0 38.0 36.0 38.0 75-79 36.85245 38.0 38.0 38.0 35.0 38.0 80-84 36.63205 38.0 37.6 38.0 34.6 38.0 85-89 36.112649999999995 38.0 37.0 38.0 32.6 38.0 90-94 36.50295 38.0 37.8 38.0 34.0 38.0 95-99 36.434099999999994 38.0 37.4 38.0 34.0 38.0 100-104 36.06025 38.0 37.0 38.0 32.8 38.0 105-109 35.07574999999999 38.0 35.2 38.0 26.6 38.0 110-114 35.189099999999996 38.0 35.4 38.0 27.0 38.0 115-119 35.34414999999999 38.0 35.8 38.0 30.0 38.0 120-124 35.1291 38.0 35.4 38.0 28.4 38.0 125-129 33.402049999999996 37.2 31.6 38.0 22.6 38.0 130-134 33.6601 37.4 33.2 38.0 22.6 38.0 135-139 33.988600000000005 38.0 33.4 38.0 24.0 38.0 140-144 32.93835 38.0 32.0 38.0 19.8 38.0 145-149 31.4863 36.4 31.4 38.0 13.2 38.0 150-151 27.013375 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 3.0 13 0.0 14 1.0 15 2.0 16 1.0 17 0.0 18 3.0 19 4.0 20 0.0 21 5.0 22 6.0 23 8.0 24 6.0 25 4.0 26 10.0 27 20.0 28 23.0 29 29.0 30 35.0 31 71.0 32 98.0 33 142.0 34 304.0 35 582.0 36 1357.0 37 1284.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.45 11.225 9.775 35.55 2 22.330582645661416 14.103525881470366 33.758439609902474 29.80745186296574 3 19.975 18.625 26.575 34.825 4 22.675 26.400000000000002 22.7 28.225 5 22.325 32.125 25.025 20.525 6 20.724999999999998 34.325 24.45 20.5 7 14.35 27.750000000000004 40.775 17.125 8 17.825 27.200000000000003 29.425 25.55 9 17.224999999999998 24.474999999999998 33.6 24.7 10-14 19.945 29.885 27.705000000000002 22.465 15-19 20.595 28.17 27.515 23.72 20-24 20.235 29.015 27.355 23.395 25-29 19.68 28.57 28.095 23.655 30-34 19.835 28.42 28.29 23.455000000000002 35-39 20.165 29.325000000000003 26.974999999999998 23.535 40-44 20.655 28.244999999999997 27.915 23.185 45-49 20.305 28.835 27.339999999999996 23.52 50-54 20.349999999999998 28.53 27.529999999999998 23.59 55-59 20.25 28.735 27.13 23.885 60-64 19.965 28.694999999999997 27.805000000000003 23.535 65-69 20.349999999999998 28.685 27.075 23.89 70-74 20.365 28.555000000000003 27.425 23.655 75-79 20.315 28.625 27.36 23.7 80-84 19.8 28.555000000000003 27.785 23.86 85-89 20.575 28.505000000000003 27.095000000000002 23.825 90-94 20.485 28.415000000000003 27.58 23.52 95-99 20.615 28.665000000000003 27.36 23.36 100-104 20.585 29.165000000000003 27.025 23.225 105-109 20.630000000000003 27.889999999999997 27.715 23.765 110-114 20.72 28.444999999999997 27.21 23.625 115-119 20.525 28.144999999999996 27.555000000000003 23.775 120-124 20.73 28.64 27.115000000000002 23.515 125-129 20.72 27.915 27.61 23.755000000000003 130-134 20.51 28.689999999999998 26.974999999999998 23.825 135-139 20.525 28.025 27.634999999999998 23.815 140-144 20.69 27.445000000000004 27.445000000000004 24.42 145-149 21.13 27.21 27.860000000000003 23.799999999999997 150-151 21.075 27.237499999999997 27.500000000000004 24.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 1.0 22 1.0 23 0.5 24 2.0 25 3.5 26 4.5 27 6.0 28 9.0 29 14.0 30 20.0 31 25.0 32 28.0 33 36.5 34 56.0 35 73.0 36 89.0 37 109.0 38 127.0 39 154.0 40 179.0 41 197.5 42 225.0 43 259.5 44 270.5 45 256.0 46 247.5 47 256.0 48 249.5 49 235.5 50 209.0 51 150.5 52 119.0 53 104.0 54 83.5 55 55.5 56 32.5 57 30.0 58 22.0 59 10.5 60 7.5 61 8.5 62 7.5 63 5.0 64 5.0 65 4.0 66 2.0 67 1.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5032712632108707 1.0 3 0.0754906894816306 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.2999999999999998 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.75 0.0 0.0 0.0 0.0 114-115 2.9000000000000004 0.0 0.0 0.0 0.0 116-117 3.1125 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 3.7875 0.0 0.0 0.0 0.0 124-125 3.9625 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.3875 0.0 0.0 0.0 0.0 130-131 4.737500000000001 0.0 0.0 0.0 0.0 132-133 5.0 0.0 0.0 0.0 0.0 134-135 5.2125 0.0 0.0 0.0 0.0 136-137 5.5875 0.0 0.0 0.0 0.0 138-139 5.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169876 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169876_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.26175 34.0 33.0 34.0 33.0 34.0 2 33.327 34.0 33.0 34.0 33.0 34.0 3 33.3555 34.0 33.0 34.0 33.0 34.0 4 33.31475 34.0 33.0 34.0 33.0 34.0 5 33.3765 34.0 33.0 34.0 33.0 34.0 6 37.5395 38.0 38.0 38.0 38.0 38.0 7 37.49175 38.0 38.0 38.0 38.0 38.0 8 37.3915 38.0 38.0 38.0 38.0 38.0 9 37.4645 38.0 38.0 38.0 38.0 38.0 10-14 37.3885 38.0 38.0 38.0 38.0 38.0 15-19 37.397149999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.409850000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.05135 38.0 38.0 38.0 36.2 38.0 30-34 37.3756 38.0 38.0 38.0 37.8 38.0 35-39 37.0168 38.0 38.0 38.0 36.4 38.0 40-44 37.30965 38.0 38.0 38.0 37.4 38.0 45-49 36.9362 38.0 38.0 38.0 35.2 38.0 50-54 37.18995 38.0 38.0 38.0 36.8 38.0 55-59 37.241949999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.1691 38.0 38.0 38.0 37.0 38.0 65-69 37.143 38.0 38.0 38.0 36.8 38.0 70-74 37.1697 38.0 38.0 38.0 37.0 38.0 75-79 37.137 38.0 38.0 38.0 36.8 38.0 80-84 36.91245 38.0 38.0 38.0 36.0 38.0 85-89 36.79495000000001 38.0 38.0 38.0 35.8 38.0 90-94 36.8617 38.0 38.0 38.0 36.0 38.0 95-99 36.713049999999996 38.0 38.0 38.0 35.2 38.0 100-104 36.5883 38.0 38.0 38.0 35.0 38.0 105-109 36.5255 38.0 38.0 38.0 34.4 38.0 110-114 36.4494 38.0 38.0 38.0 34.0 38.0 115-119 36.24250000000001 38.0 38.0 38.0 34.0 38.0 120-124 36.06835 38.0 37.6 38.0 33.6 38.0 125-129 35.31895 38.0 36.0 38.0 29.2 38.0 130-134 35.54729999999999 38.0 36.4 38.0 31.8 38.0 135-139 34.1727 38.0 34.6 38.0 23.8 38.0 140-144 33.77015 38.0 33.0 38.0 23.0 38.0 145-149 32.995799999999996 38.0 32.6 38.0 19.6 38.0 150-151 29.219500000000004 35.5 24.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 2.0 15 2.0 16 4.0 17 0.0 18 3.0 19 4.0 20 6.0 21 4.0 22 0.0 23 6.0 24 10.0 25 6.0 26 9.0 27 11.0 28 23.0 29 28.0 30 27.0 31 37.0 32 69.0 33 79.0 34 153.0 35 284.0 36 752.0 37 2463.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.325 20.075000000000003 13.825000000000001 25.775 2 24.95 26.25 30.099999999999998 18.7 3 20.275000000000002 27.55 31.974999999999998 20.200000000000003 4 24.075 33.625 23.925 18.375 5 24.025 35.925000000000004 22.625 17.424999999999997 6 21.175 36.85 23.3 18.675 7 19.7 22.375 37.525 20.4 8 21.725 26.224999999999998 27.500000000000004 24.55 9 21.5 25.924999999999997 29.95 22.625 10-14 23.115 29.555 26.25 21.08 15-19 23.03 28.384999999999998 27.305 21.279999999999998 20-24 23.665 27.71 27.18 21.445 25-29 22.675 28.77 27.405 21.15 30-34 22.5 27.73 28.055000000000003 21.715 35-39 22.275 28.595 28.044999999999998 21.085 40-44 23.47 27.694999999999997 27.894999999999996 20.94 45-49 23.36 27.589999999999996 28.43 20.62 50-54 22.895 28.28 27.779999999999998 21.044999999999998 55-59 22.865 27.900000000000002 28.18 21.055 60-64 22.955000000000002 28.335 27.855 20.855 65-69 23.73 27.500000000000004 27.584999999999997 21.185000000000002 70-74 23.48 28.155 28.1 20.265 75-79 23.315 27.994999999999997 27.875 20.815 80-84 23.54 27.91 28.035 20.515 85-89 23.895 27.925 27.215 20.965 90-94 23.66 27.355 28.37 20.615 95-99 23.94 27.47 28.33 20.26 100-104 23.810000000000002 28.494999999999997 27.13 20.565 105-109 23.98 27.939999999999998 27.834999999999997 20.244999999999997 110-114 24.44 27.939999999999998 27.345000000000002 20.275000000000002 115-119 24.44 27.79 27.515 20.255000000000003 120-124 24.404999999999998 27.639999999999997 27.705000000000002 20.25 125-129 23.745 28.265 27.575 20.415 130-134 24.135 27.900000000000002 27.55 20.415 135-139 24.725 28.38 27.250000000000004 19.645000000000003 140-144 24.82 27.815 27.529999999999998 19.835 145-149 25.145 28.565 26.715 19.575 150-151 24.875 27.5875 27.675 19.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.5 23 1.0 24 1.5 25 2.0 26 3.5 27 5.0 28 3.5 29 4.5 30 7.5 31 11.0 32 20.5 33 35.5 34 50.0 35 60.5 36 78.0 37 97.0 38 129.0 39 171.0 40 205.0 41 225.5 42 238.0 43 263.5 44 287.0 45 300.5 46 285.5 47 274.0 48 257.0 49 223.5 50 180.5 51 130.0 52 104.5 53 87.5 54 69.5 55 51.5 56 38.0 57 25.5 58 17.0 59 11.5 60 8.0 61 6.0 62 6.5 63 6.0 64 3.0 65 2.0 66 2.0 67 1.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.3250000000000002 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 2.0375 0.0 0.0 0.0 0.0 108-109 2.225 0.0 0.0 0.0 0.0 110-111 2.5250000000000004 0.0 0.0 0.0 0.0 112-113 2.8499999999999996 0.0 0.0 0.0 0.0 114-115 3.0 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.5125 0.0 0.0 0.0 0.0 120-121 3.8 0.0 0.0 0.0 0.0 122-123 4.05 0.0 0.0 0.0 0.0 124-125 4.237500000000001 0.0 0.0 0.0 0.0 126-127 4.375 0.0 0.0 0.0 0.0 128-129 4.675 0.0 0.0 0.0 0.0 130-131 5.025 0.0 0.0 0.0 0.0 132-133 5.275 0.0 0.0 0.0 0.0 134-135 5.475 0.0 0.0 0.0 0.0 136-137 5.85 0.0 0.0 0.0 0.0 138-139 6.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660613 spots for SRR7169876.sra Written 660613 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra Read 660610 spots for SRR7169876.sra Written 660610 spots for SRR7169876.sra SRR ids: ['SRR7169876.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_do8m7ugu SRR7169876.sra spots: 13212203 blocks: [[1, 660610], [660611, 1321220], [1321221, 1981830], [1981831, 2642440], [2642441, 3303050], [3303051, 3963660], [3963661, 4624270], [4624271, 5284880], [5284881, 5945490], [5945491, 6606100], [6606101, 7266710], [7266711, 7927320], [7927321, 8587930], [8587931, 9248540], [9248541, 9909150], [9909151, 10569760], [10569761, 11230370], [11230371, 11890980], [11890981, 12551590], [12551591, 13212203]] SRR7169876 file size 4455481 SRR7169876 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169876 SRR7169876_1.fastq SRR7169876_2.fastq Input file: SRR7169876_1.fastq Paired file: SRR7169876_2.fastq trimmed: SRR7169876-trimmed-pair1.fastq, SRR7169876-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:10:00 2025 >> started Wed Feb 12 00:10:16 2025 >> done (15.712s) 13212203 read pairs processed; of these: 11589 ( 0.09%) short read pairs filtered out after trimming by size control 16845 ( 0.13%) empty read pairs filtered out after trimming by size control 13183769 (99.78%) read pairs available; of these: 6485321 (49.19%) trimmed read pairs available after processing 6698448 (50.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 2 0.00% 21 5 0.00% 22 3 0.00% 23 6 0.00% 24 9 0.00% 25 3 0.00% 26 7 0.00% 27 3 0.00% 28 8 0.00% 29 5 0.00% 30 13 0.00% 31 7 0.00% 32 15 0.00% 33 9 0.00% 34 13 0.00% 35 15 0.00% 36 16 0.00% 37 23 0.00% 38 21 0.00% 39 22 0.00% 40 33 0.00% 41 47 0.00% 42 42 0.00% 43 37 0.00% 44 62 0.00% 45 66 0.00% 46 71 0.00% 47 80 0.00% 48 110 0.00% 49 101 0.00% 50 126 0.00% 51 149 0.00% 52 174 0.00% 53 199 0.00% 54 211 0.00% 55 244 0.00% 56 228 0.00% 57 310 0.00% 58 351 0.00% 59 418 0.00% 60 466 0.00% 61 592 0.00% 62 632 0.00% 63 711 0.01% 64 778 0.01% 65 902 0.01% 66 950 0.01% 67 1116 0.01% 68 1230 0.01% 69 1327 0.01% 70 1552 0.01% 71 1805 0.01% 72 2053 0.02% 73 2353 0.02% 74 2611 0.02% 75 2815 0.02% 76 3092 0.02% 77 3341 0.03% 78 3592 0.03% 79 3815 0.03% 80 4238 0.03% 81 4796 0.04% 82 5207 0.04% 83 5762 0.04% 84 6664 0.05% 85 7614 0.06% 86 8018 0.06% 87 8387 0.06% 88 8822 0.07% 89 9048 0.07% 90 9843 0.07% 91 10197 0.08% 92 10652 0.08% 93 11537 0.09% 94 12083 0.09% 95 12588 0.10% 96 12836 0.10% 97 12850 0.10% 98 13470 0.10% 99 13918 0.11% 100 14311 0.11% 101 14728 0.11% 102 15333 0.12% 103 15821 0.12% 104 16413 0.12% 105 17206 0.13% 106 17541 0.13% 107 17520 0.13% 108 17826 0.14% 109 18176 0.14% 110 18319 0.14% 111 18837 0.14% 112 19339 0.15% 113 19984 0.15% 114 21254 0.16% 115 21448 0.16% 116 21673 0.16% 117 22143 0.17% 118 22581 0.17% 119 22501 0.17% 120 22853 0.17% 121 22812 0.17% 122 23338 0.18% 123 24385 0.18% 124 25529 0.19% 125 25848 0.20% 126 27289 0.21% 127 27930 0.21% 128 28399 0.22% 129 29521 0.22% 130 30496 0.23% 131 31638 0.24% 132 32934 0.25% 133 34704 0.26% 134 36093 0.27% 135 38955 0.30% 136 41121 0.31% 137 44445 0.34% 138 47617 0.36% 139 51702 0.39% 140 56571 0.43% 141 63386 0.48% 142 71474 0.54% 143 82621 0.63% 144 99719 0.76% 145 124869 0.95% 146 162492 1.23% 147 231507 1.76% 148 365743 2.77% 149 727823 5.52% 150 3251020 24.66% 151 6698448 50.81% 13183769 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=43 prefix-density=0.22 prefix-fanout=1.9 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=27 fanout-score=70.90 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=17.7 sequence=CAAAATCATAGCCCACTTAAAAAAACGAGAGCAATCCATGCAATAACCTCATCAAAACCTTCTGTGTCACAAAGAATATATTGCTGCAACCATGCAAACTCCAAAGAACACAACATTGTTCAGAACAGTAAAGCTTACTGCCCCAGAAGTATCCGCAGGAGATTCTGGACTCGCTGCAGCTTTGGATCTCTTCTTTGGCTTTTCAGGTGCTGGTGCTGGAGTAGGAGGTTTAGGTGTAAAGATATCAAGAGGAAGAAGCACCTTGTCAACCTGATAAACAGCTAACTGGCTATCAGTGTAGATAGTGCCGGATACGCTTGTATTTGTAAGCCCTGTAGTTATATTCACAGAGTTTCCTGTGGTGGTTAC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=34 prefix-density=0.26 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=37 fanout-score=36.88 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=9.3 sequence=GAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAAGCT SRR7169876 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:10:59 Started mapping on | Feb 12 00:10:59 Finished on | Feb 12 00:12:19 Mapping speed, Million of reads per hour | 593.27 Number of input reads | 13183769 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12429630 Uniquely mapped reads % | 94.28% Average mapped length | 293.25 Number of splices: Total | 11329502 Number of splices: Annotated (sjdb) | 11140358 Number of splices: GT/AG | 11170980 Number of splices: GC/AG | 125457 Number of splices: AT/AC | 9018 Number of splices: Non-canonical | 24047 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 253636 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 24759 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.57% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 512107 512107 512107 N_multimapping 253636 253636 253636 N_noFeature 296065 12275924 350001 N_ambiguous 152385 779 52054 UnstrandedReadsAssigned:11981180 PositiveStrandReadsAssigned:152927 NegativeStrandReadsAssigned:12027575 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169876 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169876-trimmed-pair1.fastq SRR7169876-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,183,769 reads, 11,962,862 reads pseudoaligned [quant] estimated average fragment length: 275.86 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52401 SRR7169876.ke.tsv 34699 SRR7169876.se.tsv 87100 total ==> SRR7169876.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.14 246 12.6577 Potri.005G024800.1.v4.1 1035 760.14 19 2.24188 Potri.004G059700.1.v4.1 961 686.152 0 0 Potri.007G009000.2.v4.1 1416 1141.14 0 0 Potri.003G141000.2.v4.1 2943 2668.14 163.027 5.48029 Potri.016G087400.1.v4.1 270 84.1687 798 850.365 Potri.015G069301.1.v4.1 564 296.353 0 0 Potri.010G195200.1.v4.1 1773 1498.14 8 0.47895 Potri.012G127500.1.v4.1 977 702.146 2444 312.195 ==> SRR7169876.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1452 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 207 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR7169876 completed mapping pipeline successfully