Starting /dee2/code/volunteer_pipeline.sh SRR7169877 current disk space = 3051072925696 free memory = 1578692832 SRR7169877 SRAfilesize 103d17961fc553660babf82ebe415263 SRR7169877.sra SRR7169877.sra file validated SRR7169877 is paired end SRR7169877 is conventional basespace SRR7169877 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169877_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.928 28.0 18.0 33.0 18.0 33.0 2 29.34425 31.0 29.0 33.0 25.0 33.0 3 32.0795 33.0 31.0 33.0 30.0 33.0 4 32.69075 33.0 33.0 33.0 31.0 34.0 5 33.0915 33.0 33.0 34.0 33.0 34.0 6 37.18375 38.0 37.0 38.0 36.0 38.0 7 37.57475 38.0 38.0 38.0 37.0 38.0 8 37.584 38.0 38.0 38.0 37.0 38.0 9 36.8025 38.0 38.0 38.0 35.0 38.0 10-14 37.64785 38.0 38.0 38.0 37.6 38.0 15-19 37.5227 38.0 38.0 38.0 37.6 38.0 20-24 37.48715 38.0 38.0 38.0 37.4 38.0 25-29 37.627449999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.5893 38.0 38.0 38.0 38.0 38.0 35-39 37.481849999999994 38.0 38.0 38.0 37.4 38.0 40-44 37.4072 38.0 38.0 38.0 37.0 38.0 45-49 37.49205 38.0 38.0 38.0 37.4 38.0 50-54 37.412349999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.37845 38.0 38.0 38.0 37.0 38.0 60-64 37.24665 38.0 38.0 38.0 36.0 38.0 65-69 37.1609 38.0 38.0 38.0 36.0 38.0 70-74 37.09984999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.99765 38.0 38.0 38.0 36.0 38.0 80-84 36.7924 38.0 37.8 38.0 34.8 38.0 85-89 36.23425 38.0 37.0 38.0 32.8 38.0 90-94 36.6982 38.0 38.0 38.0 34.4 38.0 95-99 36.658300000000004 38.0 37.8 38.0 34.0 38.0 100-104 36.37695 38.0 37.0 38.0 33.8 38.0 105-109 35.4131 38.0 35.8 38.0 29.4 38.0 110-114 35.343599999999995 38.0 35.8 38.0 28.8 38.0 115-119 35.54535 38.0 35.8 38.0 30.6 38.0 120-124 35.43820000000001 38.0 36.0 38.0 30.0 38.0 125-129 33.8296 37.4 32.6 38.0 23.2 38.0 130-134 34.006150000000005 37.8 33.8 38.0 24.6 38.0 135-139 34.25355 38.0 33.6 38.0 25.6 38.0 140-144 33.27915 38.0 33.0 38.0 21.4 38.0 145-149 31.863400000000002 36.4 31.4 38.0 14.4 38.0 150-151 27.62775 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 3.0 18 0.0 19 0.0 20 2.0 21 1.0 22 7.0 23 4.0 24 9.0 25 9.0 26 16.0 27 18.0 28 18.0 29 33.0 30 37.0 31 59.0 32 88.0 33 136.0 34 243.0 35 513.0 36 1369.0 37 1435.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.775 10.549999999999999 9.55 38.125 2 20.92092092092092 13.73873873873874 36.76176176176176 28.57857857857858 3 20.599999999999998 19.175 25.924999999999997 34.300000000000004 4 23.375 27.325 22.775000000000002 26.525 5 22.0 32.15 24.2 21.65 6 18.475 34.675 26.174999999999997 20.674999999999997 7 14.224999999999998 26.200000000000003 42.199999999999996 17.375 8 17.724999999999998 25.75 31.5 25.025 9 17.875 24.55 33.825 23.75 10-14 19.735 30.555 26.534999999999997 23.175 15-19 20.064999999999998 29.005 27.445000000000004 23.485 20-24 19.72 29.025000000000002 27.565 23.69 25-29 20.155 28.88 27.834999999999997 23.13 30-34 20.22 28.95 27.250000000000004 23.580000000000002 35-39 19.955000000000002 29.049999999999997 27.57 23.425 40-44 19.919999999999998 28.965000000000003 27.805000000000003 23.31 45-49 20.71 28.62 27.560000000000002 23.11 50-54 20.06 28.7 27.67 23.57 55-59 20.119999999999997 28.854999999999997 27.57 23.455000000000002 60-64 19.919999999999998 28.499999999999996 27.87 23.71 65-69 20.465 28.685 27.175 23.674999999999997 70-74 20.335 28.785 27.04 23.84 75-79 20.27 28.67 27.29 23.77 80-84 20.294999999999998 28.660000000000004 27.139999999999997 23.905 85-89 20.09 28.605000000000004 26.974999999999998 24.33 90-94 20.474999999999998 28.595 27.115000000000002 23.815 95-99 20.74 28.410000000000004 27.22 23.630000000000003 100-104 20.549999999999997 28.255000000000003 27.405 23.79 105-109 20.66 28.199999999999996 26.875 24.265 110-114 21.044999999999998 28.810000000000002 26.945000000000004 23.200000000000003 115-119 21.385 28.294999999999998 27.175 23.145 120-124 20.855 28.749999999999996 27.284999999999997 23.11 125-129 20.54 28.605000000000004 27.355 23.5 130-134 21.29 28.355000000000004 27.284999999999997 23.07 135-139 20.9 27.825 27.544999999999998 23.73 140-144 20.715 28.044999999999998 27.134999999999998 24.104999999999997 145-149 20.36 28.71 26.705000000000002 24.224999999999998 150-151 19.9875 28.0625 26.887499999999996 25.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.5 22 1.0 23 3.0 24 3.5 25 3.0 26 5.5 27 7.5 28 8.0 29 10.5 30 15.0 31 24.0 32 33.5 33 47.0 34 56.0 35 66.5 36 92.0 37 118.5 38 125.0 39 148.0 40 181.0 41 207.0 42 234.0 43 256.5 44 276.5 45 275.0 46 275.5 47 256.0 48 225.5 49 210.0 50 176.0 51 144.5 52 128.0 53 99.5 54 75.5 55 59.0 56 41.5 57 31.0 58 19.0 59 11.5 60 10.5 61 7.5 62 8.0 63 7.0 64 5.0 65 2.5 66 0.5 67 0.5 68 2.0 69 2.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.9125 0.0 0.0 0.0 0.0 106-107 0.9874999999999999 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.3375000000000004 0.0 0.0 0.0 0.0 124-125 2.5875 0.0 0.0 0.0 0.0 126-127 2.825 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.2125 0.0 0.0 0.0 0.0 132-133 3.375 0.0 0.0 0.0 0.0 134-135 3.5999999999999996 0.0 0.0 0.0 0.0 136-137 3.7625 0.0 0.0 0.0 0.0 138-139 3.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 25 4.977651E-4 29.0 130-134 >>END_MODULE SRR7169877 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169877_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.251 34.0 33.0 34.0 33.0 34.0 2 33.2745 34.0 33.0 34.0 33.0 34.0 3 33.318 34.0 33.0 34.0 33.0 34.0 4 33.27725 34.0 33.0 34.0 33.0 34.0 5 33.33425 34.0 33.0 34.0 33.0 34.0 6 37.517 38.0 38.0 38.0 38.0 38.0 7 37.51625 38.0 38.0 38.0 38.0 38.0 8 37.39625 38.0 38.0 38.0 38.0 38.0 9 37.4985 38.0 38.0 38.0 38.0 38.0 10-14 37.42425 38.0 38.0 38.0 37.8 38.0 15-19 37.3986 38.0 38.0 38.0 37.4 38.0 20-24 37.4022 38.0 38.0 38.0 37.2 38.0 25-29 37.0193 38.0 38.0 38.0 36.2 38.0 30-34 37.2972 38.0 38.0 38.0 37.0 38.0 35-39 37.09505 38.0 38.0 38.0 36.2 38.0 40-44 37.31455 38.0 38.0 38.0 37.0 38.0 45-49 36.892250000000004 38.0 38.0 38.0 35.2 38.0 50-54 37.1483 38.0 38.0 38.0 36.4 38.0 55-59 37.20495 38.0 38.0 38.0 37.0 38.0 60-64 37.03535 38.0 38.0 38.0 36.2 38.0 65-69 37.0519 38.0 38.0 38.0 36.0 38.0 70-74 37.0741 38.0 38.0 38.0 36.6 38.0 75-79 37.051100000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.9197 38.0 38.0 38.0 36.0 38.0 85-89 36.701750000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.728249999999996 38.0 38.0 38.0 35.2 38.0 95-99 36.62415 38.0 38.0 38.0 34.8 38.0 100-104 36.40335 38.0 38.0 38.0 34.2 38.0 105-109 36.36795 38.0 38.0 38.0 33.8 38.0 110-114 36.2697 38.0 38.0 38.0 34.0 38.0 115-119 36.125800000000005 38.0 37.4 38.0 33.6 38.0 120-124 35.886399999999995 38.0 37.0 38.0 32.6 38.0 125-129 35.13985 38.0 35.6 38.0 28.2 38.0 130-134 35.31125 38.0 35.8 38.0 30.4 38.0 135-139 34.00365 38.0 34.2 38.0 23.4 38.0 140-144 33.62665 38.0 33.0 38.0 23.0 38.0 145-149 32.761199999999995 38.0 32.6 38.0 16.6 38.0 150-151 28.949375000000003 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 1.0 6 2.0 7 0.0 8 1.0 9 0.0 10 2.0 11 1.0 12 1.0 13 1.0 14 4.0 15 1.0 16 3.0 17 2.0 18 5.0 19 4.0 20 4.0 21 6.0 22 6.0 23 13.0 24 7.0 25 12.0 26 8.0 27 16.0 28 23.0 29 35.0 30 38.0 31 38.0 32 65.0 33 90.0 34 159.0 35 311.0 36 805.0 37 2335.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.5 20.825 15.45 27.224999999999998 2 25.63781890945473 26.413206603301653 31.090545272636316 16.858429214607305 3 20.4 28.825 32.15 18.625 4 23.861930965482742 33.1415707853927 22.836418209104554 20.16008004002001 5 22.88072018004501 36.00900225056264 22.030507626906726 19.079769942485623 6 20.3 37.724999999999994 22.8 19.175 7 20.825 22.05 37.65 19.475 8 22.0 24.875 27.425 25.7 9 21.325 24.6 29.625 24.45 10-14 22.415 28.634999999999998 26.815 22.134999999999998 15-19 22.57 28.1 28.235 21.095 20-24 22.075 28.33 27.99 21.605 25-29 22.759999999999998 28.305000000000003 27.85 21.085 30-34 22.62 27.93 27.889999999999997 21.560000000000002 35-39 22.8 28.03 27.63 21.54 40-44 23.225 27.79 28.265 20.72 45-49 22.994999999999997 27.644999999999996 28.849999999999998 20.51 50-54 22.215 27.77 28.34 21.675 55-59 22.735 27.455000000000002 28.625 21.185000000000002 60-64 22.645 28.095 27.750000000000004 21.51 65-69 23.695 27.96 28.005000000000003 20.34 70-74 24.095 27.205000000000002 27.93 20.77 75-79 23.325000000000003 27.85 27.765 21.060000000000002 80-84 23.505000000000003 28.110000000000003 27.48 20.905 85-89 23.29 27.589999999999996 28.37 20.75 90-94 23.685000000000002 27.544999999999998 27.955000000000002 20.815 95-99 23.985 27.215 28.375 20.424999999999997 100-104 24.0 27.18 27.994999999999997 20.825 105-109 23.145 27.91 28.265 20.68 110-114 23.09 28.255000000000003 27.255000000000003 21.4 115-119 23.94 27.555000000000003 27.839999999999996 20.665 120-124 23.775 28.105000000000004 27.785 20.335 125-129 24.154999999999998 27.83 27.439999999999998 20.575 130-134 23.845 27.705000000000002 27.689999999999998 20.76 135-139 24.474999999999998 26.91 27.500000000000004 21.115000000000002 140-144 24.095 27.884999999999998 27.765 20.255000000000003 145-149 24.59 27.365000000000002 27.63 20.415 150-151 24.575 26.8125 27.825 20.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.5 24 2.0 25 2.5 26 2.5 27 3.5 28 5.0 29 6.0 30 14.0 31 21.0 32 23.0 33 32.5 34 41.5 35 58.5 36 79.0 37 97.0 38 122.0 39 161.5 40 208.5 41 238.5 42 273.5 43 286.0 44 269.0 45 274.5 46 294.5 47 273.0 48 230.0 49 202.0 50 168.0 51 140.0 52 117.5 53 90.0 54 67.5 55 52.5 56 39.5 57 30.0 58 20.5 59 14.0 60 10.0 61 6.5 62 5.5 63 3.5 64 2.5 65 3.5 66 3.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.05 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.3375000000000004 0.0 0.0 0.0 0.0 124-125 2.5875 0.0 0.0 0.0 0.0 126-127 2.825 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.2125 0.0 0.0 0.0 0.0 132-133 3.375 0.0 0.0 0.0 0.0 134-135 3.5999999999999996 0.0 0.0 0.0 0.0 136-137 3.7625 0.0 0.0 0.0 0.0 138-139 3.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGGTG 10 0.006830828 145.0 5 >>END_MODULE Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620198 spots for SRR7169877.sra Written 620198 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra Read 620187 spots for SRR7169877.sra Written 620187 spots for SRR7169877.sra SRR ids: ['SRR7169877.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pz0shv4p SRR7169877.sra spots: 12403751 blocks: [[1, 620187], [620188, 1240374], [1240375, 1860561], [1860562, 2480748], [2480749, 3100935], [3100936, 3721122], [3721123, 4341309], [4341310, 4961496], [4961497, 5581683], [5581684, 6201870], [6201871, 6822057], [6822058, 7442244], [7442245, 8062431], [8062432, 8682618], [8682619, 9302805], [9302806, 9922992], [9922993, 10543179], [10543180, 11163366], [11163367, 11783553], [11783554, 12403751]] SRR7169877 file size 4181523 SRR7169877 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169877 SRR7169877_1.fastq SRR7169877_2.fastq Input file: SRR7169877_1.fastq Paired file: SRR7169877_2.fastq trimmed: SRR7169877-trimmed-pair1.fastq, SRR7169877-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:24:03 2025 >> started Wed Feb 12 01:24:15 2025 >> done (12.758s) 12403751 read pairs processed; of these: 8292 ( 0.07%) short read pairs filtered out after trimming by size control 7447 ( 0.06%) empty read pairs filtered out after trimming by size control 12388012 (99.87%) read pairs available; of these: 5715847 (46.14%) trimmed read pairs available after processing 6672165 (53.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 4 0.00% 24 2 0.00% 25 0 0.00% 26 3 0.00% 27 2 0.00% 28 2 0.00% 29 3 0.00% 30 2 0.00% 31 5 0.00% 32 4 0.00% 33 3 0.00% 34 6 0.00% 35 6 0.00% 36 5 0.00% 37 4 0.00% 38 5 0.00% 39 11 0.00% 40 6 0.00% 41 17 0.00% 42 21 0.00% 43 23 0.00% 44 24 0.00% 45 18 0.00% 46 18 0.00% 47 24 0.00% 48 28 0.00% 49 43 0.00% 50 45 0.00% 51 49 0.00% 52 48 0.00% 53 72 0.00% 54 75 0.00% 55 81 0.00% 56 77 0.00% 57 98 0.00% 58 108 0.00% 59 168 0.00% 60 157 0.00% 61 182 0.00% 62 239 0.00% 63 239 0.00% 64 299 0.00% 65 281 0.00% 66 340 0.00% 67 379 0.00% 68 422 0.00% 69 500 0.00% 70 560 0.00% 71 687 0.01% 72 734 0.01% 73 837 0.01% 74 967 0.01% 75 1026 0.01% 76 1104 0.01% 77 1319 0.01% 78 1344 0.01% 79 1470 0.01% 80 1689 0.01% 81 1927 0.02% 82 2195 0.02% 83 2416 0.02% 84 3029 0.02% 85 3447 0.03% 86 3547 0.03% 87 3815 0.03% 88 4203 0.03% 89 4168 0.03% 90 4597 0.04% 91 4843 0.04% 92 5194 0.04% 93 5454 0.04% 94 5980 0.05% 95 6360 0.05% 96 6380 0.05% 97 6627 0.05% 98 6691 0.05% 99 7192 0.06% 100 7271 0.06% 101 7623 0.06% 102 8245 0.07% 103 8565 0.07% 104 8952 0.07% 105 9373 0.08% 106 9857 0.08% 107 9981 0.08% 108 10092 0.08% 109 10548 0.09% 110 10699 0.09% 111 11125 0.09% 112 11560 0.09% 113 11980 0.10% 114 12530 0.10% 115 13180 0.11% 116 13667 0.11% 117 13803 0.11% 118 14097 0.11% 119 14247 0.12% 120 14803 0.12% 121 15233 0.12% 122 15732 0.13% 123 16625 0.13% 124 17323 0.14% 125 18088 0.15% 126 19295 0.16% 127 20020 0.16% 128 20786 0.17% 129 21814 0.18% 130 23003 0.19% 131 24387 0.20% 132 25447 0.21% 133 27178 0.22% 134 29179 0.24% 135 31663 0.26% 136 34113 0.28% 137 37206 0.30% 138 41062 0.33% 139 44575 0.36% 140 49318 0.40% 141 55792 0.45% 142 64065 0.52% 143 73917 0.60% 144 89675 0.72% 145 114181 0.92% 146 148854 1.20% 147 211168 1.70% 148 334987 2.70% 149 671119 5.42% 150 3083888 24.89% 151 6672165 53.86% 12388012 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=44 prefix-density=0.17 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=12 fanout-score=117.47 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=20.6 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=33 prefix-density=0.35 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=35 fanout-score=102.19 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=13.6 sequence=CTGTTGTTGAGGCCATGACATGTGGTTTGCCAAC SRR7169877 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:25:00 Started mapping on | Feb 12 01:25:00 Finished on | Feb 12 01:26:17 Mapping speed, Million of reads per hour | 579.18 Number of input reads | 12388012 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11697214 Uniquely mapped reads % | 94.42% Average mapped length | 295.61 Number of splices: Total | 11716528 Number of splices: Annotated (sjdb) | 11536241 Number of splices: GT/AG | 11541597 Number of splices: GC/AG | 142184 Number of splices: AT/AC | 8916 Number of splices: Non-canonical | 23831 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 223039 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 25946 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.53% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 476998 476998 476998 N_multimapping 223039 223039 223039 N_noFeature 259037 11594882 301141 N_ambiguous 113713 502 53171 UnstrandedReadsAssigned:11324464 PositiveStrandReadsAssigned:101830 NegativeStrandReadsAssigned:11342902 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169877 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169877-trimmed-pair1.fastq SRR7169877-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,388,012 reads, 11,265,784 reads pseudoaligned [quant] estimated average fragment length: 304.563 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,004 rounds 52401 SRR7169877.ke.tsv 34699 SRR7169877.se.tsv 87100 total ==> SRR7169877.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1714.44 215 11.5234 Potri.005G024800.1.v4.1 1035 731.437 36 4.5226 Potri.004G059700.1.v4.1 961 657.524 3 0.419248 Potri.007G009000.2.v4.1 1416 1112.44 0 0 Potri.003G141000.2.v4.1 2943 2639.44 207.08 7.20921 Potri.016G087400.1.v4.1 270 76.2178 925.876 1116.24 Potri.015G069301.1.v4.1 564 269.804 0 0 Potri.010G195200.1.v4.1 1773 1469.44 6 0.3752 Potri.012G127500.1.v4.1 977 673.487 6197 845.501 ==> SRR7169877.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 732 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 153 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169877 completed mapping pipeline successfully