Starting /dee2/code/volunteer_pipeline.sh SRR7169878 current disk space = 3051375730688 free memory = 760346600 SRR7169878 SRAfilesize 3ca86e593abfecf97bb0dee172465d22 SRR7169878.sra SRR7169878.sra file validated SRR7169878 is paired end SRR7169878 is conventional basespace SRR7169878 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169878_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.6925 30.0 18.0 33.0 18.0 33.0 2 30.50425 31.0 29.0 33.0 27.0 33.0 3 31.168 33.0 31.0 33.0 29.0 33.0 4 31.26575 33.0 31.0 33.0 29.0 33.0 5 32.593 33.0 33.0 33.0 32.0 34.0 6 36.758 38.0 37.0 38.0 34.0 38.0 7 35.17075 38.0 36.0 38.0 28.0 38.0 8 37.00475 38.0 38.0 38.0 35.0 38.0 9 37.4805 38.0 38.0 38.0 37.0 38.0 10-14 37.56785 38.0 38.0 38.0 37.4 38.0 15-19 37.5979 38.0 38.0 38.0 38.0 38.0 20-24 37.6106 38.0 38.0 38.0 38.0 38.0 25-29 37.585 38.0 38.0 38.0 38.0 38.0 30-34 37.495850000000004 38.0 38.0 38.0 37.6 38.0 35-39 37.47935 38.0 38.0 38.0 37.8 38.0 40-44 37.4113 38.0 38.0 38.0 37.2 38.0 45-49 37.47215 38.0 38.0 38.0 37.2 38.0 50-54 37.156499999999994 38.0 38.0 38.0 36.2 38.0 55-59 36.88365 38.0 38.0 38.0 35.4 38.0 60-64 37.0889 38.0 38.0 38.0 36.0 38.0 65-69 36.55315 38.0 37.6 38.0 33.8 38.0 70-74 36.9354 38.0 38.0 38.0 35.6 38.0 75-79 37.0158 38.0 38.0 38.0 36.0 38.0 80-84 36.92105 38.0 38.0 38.0 35.6 38.0 85-89 36.726350000000004 38.0 38.0 38.0 34.8 38.0 90-94 35.3113 38.0 36.0 38.0 27.4 38.0 95-99 36.2057 38.0 37.2 38.0 32.8 38.0 100-104 35.35424999999999 38.0 36.0 38.0 29.0 38.0 105-109 35.7238 38.0 36.4 38.0 30.8 38.0 110-114 35.08585000000001 38.0 35.8 38.0 27.4 38.0 115-119 34.8441 38.0 35.2 38.0 26.0 38.0 120-124 34.097699999999996 37.8 33.4 38.0 24.8 38.0 125-129 34.41605 38.0 34.8 38.0 23.6 38.0 130-134 34.815999999999995 38.0 34.8 38.0 27.0 38.0 135-139 34.40505 38.0 34.6 38.0 24.8 38.0 140-144 33.4452 37.6 33.4 38.0 21.8 38.0 145-149 32.9046 37.6 33.4 38.0 17.4 38.0 150-151 30.01125 36.0 27.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 3.0 17 3.0 18 1.0 19 3.0 20 2.0 21 1.0 22 6.0 23 2.0 24 14.0 25 13.0 26 11.0 27 22.0 28 30.0 29 31.0 30 49.0 31 65.0 32 93.0 33 125.0 34 247.0 35 491.0 36 1267.0 37 1516.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.375 11.425 10.775 37.425000000000004 2 22.71703777833375 14.786089567175381 32.12409306980235 30.372779584688516 3 19.175 20.05 27.625 33.15 4 23.95 27.450000000000003 22.8 25.8 5 22.35 30.675 25.7 21.275 6 20.3 36.199999999999996 24.474999999999998 19.025 7 15.575 27.875 38.725 17.825 8 18.65 26.625 29.775000000000002 24.95 9 17.599999999999998 25.674999999999997 33.925 22.8 10-14 19.235 30.42 27.700000000000003 22.645 15-19 20.07 28.915000000000003 27.62 23.395 20-24 20.064999999999998 29.515 27.46 22.96 25-29 19.775000000000002 28.884999999999998 27.810000000000002 23.53 30-34 19.64 28.965000000000003 27.935 23.46 35-39 20.419999999999998 28.71 27.41 23.46 40-44 20.294999999999998 28.675 27.13 23.9 45-49 20.349999999999998 28.665000000000003 27.11 23.875 50-54 20.01 28.67 28.1 23.22 55-59 19.950000000000003 28.845 27.355 23.849999999999998 60-64 19.89 28.765 27.389999999999997 23.955000000000002 65-69 20.215 28.915000000000003 27.54 23.330000000000002 70-74 19.919999999999998 28.49 27.49 24.099999999999998 75-79 20.075000000000003 28.615000000000002 27.155 24.154999999999998 80-84 20.435 28.115000000000002 27.62 23.830000000000002 85-89 20.669999999999998 29.455 26.815 23.06 90-94 20.28 28.425 27.465 23.830000000000002 95-99 20.25 28.515 27.685 23.549999999999997 100-104 20.044999999999998 28.615000000000002 27.500000000000004 23.84 105-109 20.335 28.494999999999997 27.255000000000003 23.915 110-114 20.325 29.175 26.965 23.535 115-119 20.74508036653147 28.861849682038958 27.184417405237593 23.20865254619198 120-124 20.800600450337754 28.276207155366524 27.23042281711284 23.692769577182887 125-129 20.875 28.244999999999997 26.950000000000003 23.93 130-134 20.485 28.444999999999997 27.345000000000002 23.724999999999998 135-139 20.29 28.235 27.365000000000002 24.11 140-144 20.889400230103547 28.252713721174526 27.36231304086839 23.495573007853533 145-149 20.424999999999997 28.32 27.544999999999998 23.71 150-151 21.587500000000002 27.5875 26.9625 23.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.0 23 1.5 24 2.5 25 4.0 26 6.5 27 9.0 28 12.0 29 16.5 30 22.5 31 33.0 32 39.5 33 42.0 34 55.5 35 78.0 36 85.0 37 103.5 38 133.5 39 159.5 40 180.5 41 191.0 42 220.5 43 260.5 44 286.5 45 275.5 46 251.0 47 238.0 48 228.5 49 201.0 50 166.5 51 144.0 52 127.5 53 112.0 54 86.0 55 60.0 56 41.5 57 30.0 58 21.5 59 16.0 60 10.5 61 5.5 62 6.5 63 5.5 64 4.0 65 5.0 66 4.5 67 3.5 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.145 120-124 0.075 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.045 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14228052472251 98.25 2 0.8072653884964682 1.6 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.8375 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.1124999999999998 0.0 0.0 0.0 0.0 122-123 1.275 0.0 0.0 0.0 0.0 124-125 1.3875000000000002 0.0 0.0 0.0 0.0 126-127 1.525 0.0 0.0 0.0 0.0 128-129 1.6749999999999998 0.0 0.0 0.0 0.0 130-131 1.775 0.0 0.0 0.0 0.0 132-133 1.9 0.0 0.0 0.0 0.0 134-135 2.1 0.0 0.0 0.0 0.0 136-137 2.25 0.0 0.0 0.0 0.0 138-139 2.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATGCA 10 0.006830828 145.0 5 TGATTCA 10 0.006830828 145.0 7 >>END_MODULE SRR7169878 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169878_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.069 34.0 33.0 34.0 32.0 34.0 2 33.11425 34.0 33.0 34.0 33.0 34.0 3 33.09725 34.0 33.0 34.0 33.0 34.0 4 33.08425 34.0 33.0 34.0 33.0 34.0 5 33.08525 34.0 33.0 34.0 33.0 34.0 6 37.22925 38.0 38.0 38.0 37.0 38.0 7 37.21325 38.0 38.0 38.0 37.0 38.0 8 37.174 38.0 38.0 38.0 37.0 38.0 9 37.155 38.0 38.0 38.0 38.0 38.0 10-14 37.05185 38.0 38.0 38.0 36.8 38.0 15-19 37.097049999999996 38.0 38.0 38.0 37.0 38.0 20-24 36.69135 38.0 37.8 38.0 35.2 38.0 25-29 35.489 38.0 36.8 38.0 26.0 38.0 30-34 36.81085 38.0 37.8 38.0 35.4 38.0 35-39 37.010749999999994 38.0 38.0 38.0 37.0 38.0 40-44 36.7934 38.0 38.0 38.0 36.0 38.0 45-49 36.9711 38.0 38.0 38.0 36.6 38.0 50-54 36.7731 38.0 38.0 38.0 36.0 38.0 55-59 36.891799999999996 38.0 38.0 38.0 36.2 38.0 60-64 36.75265 38.0 38.0 38.0 35.8 38.0 65-69 36.70075 38.0 38.0 38.0 36.0 38.0 70-74 36.7566 38.0 38.0 38.0 36.0 38.0 75-79 36.79255 38.0 38.0 38.0 36.0 38.0 80-84 36.69005 38.0 38.0 38.0 35.8 38.0 85-89 36.295049999999996 38.0 38.0 38.0 33.8 38.0 90-94 36.626850000000005 38.0 38.0 38.0 35.4 38.0 95-99 36.4581 38.0 38.0 38.0 34.6 38.0 100-104 36.28105 38.0 38.0 38.0 34.0 38.0 105-109 36.1522 38.0 38.0 38.0 34.0 38.0 110-114 36.21345 38.0 38.0 38.0 34.0 38.0 115-119 35.99385 38.0 38.0 38.0 33.6 38.0 120-124 35.69995 38.0 37.6 38.0 32.2 38.0 125-129 35.623799999999996 38.0 37.0 38.0 32.2 38.0 130-134 35.37915 38.0 36.2 38.0 31.0 38.0 135-139 34.5435 38.0 35.6 38.0 26.6 38.0 140-144 34.40565 38.0 35.2 38.0 26.0 38.0 145-149 33.464749999999995 38.0 34.4 38.0 18.4 38.0 150-151 30.056874999999998 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 2.0 4 3.0 5 2.0 6 3.0 7 1.0 8 2.0 9 3.0 10 0.0 11 1.0 12 5.0 13 1.0 14 2.0 15 1.0 16 4.0 17 2.0 18 4.0 19 3.0 20 10.0 21 5.0 22 7.0 23 8.0 24 11.0 25 11.0 26 11.0 27 26.0 28 24.0 29 42.0 30 34.0 31 54.0 32 61.0 33 83.0 34 145.0 35 241.0 36 631.0 37 2543.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.275 22.75 14.924999999999999 23.05 2 27.275 26.8 26.974999999999998 18.95 3 20.45 30.075000000000003 30.099999999999998 19.375 4 24.256064016004 33.158289572393095 23.305826456614152 19.279819954988746 5 23.1807951987997 36.25906476619154 22.50562640660165 18.0545136284071 6 23.05 34.5 24.05 18.4 7 20.125 22.025 38.0 19.85 8 23.1 26.174999999999997 26.200000000000003 24.525 9 22.85 25.75 28.875 22.525000000000002 10-14 23.51 28.425 26.295 21.77 15-19 23.16 28.410000000000004 27.265 21.165 20-24 23.895 28.110000000000003 27.37 20.625 25-29 23.565 28.215 26.650000000000002 21.57 30-34 23.41 27.52 27.515 21.555 35-39 23.52 27.52 27.615000000000002 21.345 40-44 23.485 28.32 27.125 21.07 45-49 23.465 27.955000000000002 27.96 20.62 50-54 23.22 27.779999999999998 27.83 21.17 55-59 23.68 27.675 27.935 20.71 60-64 22.68 27.889999999999997 27.865000000000002 21.565 65-69 23.53 27.07 28.48 20.919999999999998 70-74 23.195 27.584999999999997 28.499999999999996 20.72 75-79 23.535 27.705000000000002 27.965 20.794999999999998 80-84 23.28 27.88 27.85 20.990000000000002 85-89 23.95 27.595 27.815 20.64 90-94 23.685000000000002 27.655 28.105000000000004 20.555 95-99 23.39 27.955000000000002 28.08 20.575 100-104 23.95 28.185 27.529999999999998 20.335 105-109 23.265 27.474999999999998 28.405 20.855 110-114 24.305 27.889999999999997 27.05 20.755000000000003 115-119 23.805 28.03 27.950000000000003 20.215 120-124 24.14 27.515 28.199999999999996 20.145 125-129 23.474999999999998 28.235 27.57 20.72 130-134 24.65 27.395000000000003 27.63 20.325 135-139 23.93774085381112 28.442019918922977 27.631249687202843 19.98898954006306 140-144 24.099999999999998 27.500000000000004 27.785 20.615 145-149 23.98 27.165 27.705000000000002 21.15 150-151 24.2375 26.424999999999997 28.237499999999997 21.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 2.5 25 3.5 26 2.5 27 2.5 28 3.5 29 8.0 30 14.0 31 16.0 32 19.0 33 23.0 34 33.0 35 51.5 36 67.5 37 91.0 38 129.0 39 174.0 40 205.5 41 228.0 42 259.0 43 272.5 44 287.0 45 279.5 46 273.0 47 265.0 48 238.0 49 209.0 50 169.5 51 144.0 52 118.5 53 95.0 54 75.5 55 61.0 56 53.0 57 42.0 58 24.5 59 13.0 60 10.0 61 10.0 62 5.5 63 3.5 64 3.0 65 3.0 66 3.5 67 2.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.095 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26933736457546 98.5 2 0.6802721088435374 1.35 3 0.05039052658100278 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.775 0.0 0.0 0.0 0.0 114-115 0.8875 0.0 0.0 0.0 0.0 116-117 1.075 0.0 0.0 0.0 0.0 118-119 1.25 0.0 0.0 0.0 0.0 120-121 1.4249999999999998 0.0 0.0 0.0 0.0 122-123 1.5625 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.85 0.0 0.0 0.0 0.0 128-129 2.0 0.0 0.0 0.0 0.0 130-131 2.1125 0.0 0.0 0.0 0.0 132-133 2.2625 0.0 0.0 0.0 0.0 134-135 2.475 0.0 0.0 0.0 0.0 136-137 2.6500000000000004 0.0 0.0 0.0 0.0 138-139 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTCTG 10 0.006830828 145.0 9 AGAGAGA 40 0.0076550315 18.125 35-39 >>END_MODULE Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585436 spots for SRR7169878.sra Written 585436 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra Read 585419 spots for SRR7169878.sra Written 585419 spots for SRR7169878.sra SRR ids: ['SRR7169878.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ay8lwssy SRR7169878.sra spots: 11708397 blocks: [[1, 585419], [585420, 1170838], [1170839, 1756257], [1756258, 2341676], [2341677, 2927095], [2927096, 3512514], [3512515, 4097933], [4097934, 4683352], [4683353, 5268771], [5268772, 5854190], [5854191, 6439609], [6439610, 7025028], [7025029, 7610447], [7610448, 8195866], [8195867, 8781285], [8781286, 9366704], [9366705, 9952123], [9952124, 10537542], [10537543, 11122961], [11122962, 11708397]] SRR7169878 file size 3945891 SRR7169878 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169878 SRR7169878_1.fastq SRR7169878_2.fastq Input file: SRR7169878_1.fastq Paired file: SRR7169878_2.fastq trimmed: SRR7169878-trimmed-pair1.fastq, SRR7169878-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:28:16 2025 >> started Wed Feb 12 00:28:28 2025 >> done (12.325s) 11708397 read pairs processed; of these: 18020 ( 0.15%) short read pairs filtered out after trimming by size control 16454 ( 0.14%) empty read pairs filtered out after trimming by size control 11673923 (99.71%) read pairs available; of these: 4954466 (42.44%) trimmed read pairs available after processing 6719457 (57.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 2 0.00% 21 1 0.00% 22 4 0.00% 23 1 0.00% 24 2 0.00% 25 3 0.00% 26 2 0.00% 27 8 0.00% 28 4 0.00% 29 1 0.00% 30 4 0.00% 31 1 0.00% 32 3 0.00% 33 4 0.00% 34 7 0.00% 35 6 0.00% 36 4 0.00% 37 4 0.00% 38 8 0.00% 39 9 0.00% 40 7 0.00% 41 8 0.00% 42 12 0.00% 43 12 0.00% 44 13 0.00% 45 20 0.00% 46 15 0.00% 47 14 0.00% 48 27 0.00% 49 19 0.00% 50 26 0.00% 51 28 0.00% 52 42 0.00% 53 49 0.00% 54 54 0.00% 55 58 0.00% 56 50 0.00% 57 60 0.00% 58 77 0.00% 59 90 0.00% 60 100 0.00% 61 122 0.00% 62 124 0.00% 63 196 0.00% 64 192 0.00% 65 202 0.00% 66 204 0.00% 67 249 0.00% 68 316 0.00% 69 333 0.00% 70 379 0.00% 71 428 0.00% 72 500 0.00% 73 548 0.00% 74 602 0.01% 75 738 0.01% 76 898 0.01% 77 994 0.01% 78 927 0.01% 79 1031 0.01% 80 1163 0.01% 81 1348 0.01% 82 1527 0.01% 83 1705 0.01% 84 2618 0.02% 85 3250 0.03% 86 3480 0.03% 87 3943 0.03% 88 4242 0.04% 89 4250 0.04% 90 4463 0.04% 91 4645 0.04% 92 4719 0.04% 93 5180 0.04% 94 5331 0.05% 95 5763 0.05% 96 6087 0.05% 97 6024 0.05% 98 6213 0.05% 99 6487 0.06% 100 6811 0.06% 101 7320 0.06% 102 7749 0.07% 103 7971 0.07% 104 8436 0.07% 105 9003 0.08% 106 9297 0.08% 107 9441 0.08% 108 9712 0.08% 109 10371 0.09% 110 10533 0.09% 111 11171 0.10% 112 11656 0.10% 113 12424 0.11% 114 13049 0.11% 115 13770 0.12% 116 14224 0.12% 117 14423 0.12% 118 14743 0.13% 119 15053 0.13% 120 15299 0.13% 121 15746 0.13% 122 16291 0.14% 123 17003 0.15% 124 17650 0.15% 125 18805 0.16% 126 19684 0.17% 127 20207 0.17% 128 21100 0.18% 129 22159 0.19% 130 22988 0.20% 131 24181 0.21% 132 25063 0.21% 133 27286 0.23% 134 29239 0.25% 135 30656 0.26% 136 32120 0.28% 137 35138 0.30% 138 37468 0.32% 139 40359 0.35% 140 43855 0.38% 141 48691 0.42% 142 54792 0.47% 143 63630 0.55% 144 74632 0.64% 145 93138 0.80% 146 119015 1.02% 147 164627 1.41% 148 254945 2.18% 149 522407 4.47% 150 2716853 23.27% 151 6719457 57.56% 11673923 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=39 prefix-density=0.27 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=257.25 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=19.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAAC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=8.77 fanout-score-rank=14 prefix-density=0.41 prefix-fanout=4.3 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=43.09 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=10.6 sequence=TGTTGGTGGTGG SRR7169878 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:29:14 Started mapping on | Feb 12 00:29:14 Finished on | Feb 12 00:31:09 Mapping speed, Million of reads per hour | 365.44 Number of input reads | 11673923 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10614839 Uniquely mapped reads % | 90.93% Average mapped length | 295.83 Number of splices: Total | 9484223 Number of splices: Annotated (sjdb) | 9324209 Number of splices: GT/AG | 9349422 Number of splices: GC/AG | 106679 Number of splices: AT/AC | 7633 Number of splices: Non-canonical | 20489 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 192350 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 18383 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.22% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 884012 884012 884012 N_multimapping 192350 192350 192350 N_noFeature 241596 10489576 279887 N_ambiguous 132899 706 45466 UnstrandedReadsAssigned:10240344 PositiveStrandReadsAssigned:124557 NegativeStrandReadsAssigned:10289486 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169878 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169878-trimmed-pair1.fastq SRR7169878-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,673,923 reads, 10,245,246 reads pseudoaligned [quant] estimated average fragment length: 285.899 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,031 rounds 52401 SRR7169878.ke.tsv 34699 SRR7169878.se.tsv 87100 total ==> SRR7169878.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1733.1 182 9.31622 Potri.005G024800.1.v4.1 1035 750.101 30 3.54808 Potri.004G059700.1.v4.1 961 676.129 1 0.131209 Potri.007G009000.2.v4.1 1416 1131.1 0 0 Potri.003G141000.2.v4.1 2943 2658.1 145.028 4.8403 Potri.016G087400.1.v4.1 270 70.683 899 1128.33 Potri.015G069301.1.v4.1 564 286.256 0 0 Potri.010G195200.1.v4.1 1773 1488.1 34 2.02693 Potri.012G127500.1.v4.1 977 692.118 3589 460.029 ==> SRR7169878.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1116 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 207 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169878 completed mapping pipeline successfully