Starting /dee2/code/volunteer_pipeline.sh SRR7169879 current disk space = 3051392442368 free memory = 1417351632 SRR7169879 SRAfilesize 5b544f27713227a17fe3b14aee785572 SRR7169879.sra SRR7169879.sra file validated SRR7169879 is paired end SRR7169879 is conventional basespace SRR7169879 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169879_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.81775 30.0 18.0 33.0 18.0 33.0 2 30.459 31.0 29.0 33.0 27.0 33.0 3 31.2105 33.0 31.0 33.0 29.0 33.0 4 31.32525 33.0 31.0 33.0 29.0 33.0 5 32.63275 33.0 33.0 33.0 32.0 33.0 6 36.75175 38.0 37.0 38.0 34.0 38.0 7 35.34875 38.0 36.0 38.0 29.0 38.0 8 36.97325 38.0 38.0 38.0 36.0 38.0 9 37.384 38.0 38.0 38.0 37.0 38.0 10-14 37.511799999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.543549999999996 38.0 38.0 38.0 37.8 38.0 20-24 37.58705 38.0 38.0 38.0 38.0 38.0 25-29 37.575100000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.503 38.0 38.0 38.0 37.8 38.0 35-39 37.46235 38.0 38.0 38.0 37.0 38.0 40-44 37.3278 38.0 38.0 38.0 36.8 38.0 45-49 37.42415 38.0 38.0 38.0 37.0 38.0 50-54 37.164 38.0 38.0 38.0 36.2 38.0 55-59 36.92055 38.0 38.0 38.0 35.4 38.0 60-64 37.0134 38.0 38.0 38.0 35.8 38.0 65-69 36.4813 38.0 37.6 38.0 33.4 38.0 70-74 36.8846 38.0 38.0 38.0 35.4 38.0 75-79 36.95100000000001 38.0 38.0 38.0 35.8 38.0 80-84 36.84065 38.0 38.0 38.0 35.4 38.0 85-89 36.7047 38.0 38.0 38.0 34.6 38.0 90-94 35.317099999999996 38.0 36.0 38.0 27.8 38.0 95-99 36.20075 38.0 36.8 38.0 32.6 38.0 100-104 35.26565 38.0 35.8 38.0 28.4 38.0 105-109 35.71495 38.0 36.4 38.0 30.4 38.0 110-114 34.93925 38.0 35.2 38.0 27.0 38.0 115-119 34.7033 38.0 34.6 38.0 25.6 38.0 120-124 34.1045 37.8 33.4 38.0 24.4 38.0 125-129 34.409499999999994 38.0 35.0 38.0 24.0 38.0 130-134 34.8611 38.0 34.8 38.0 27.0 38.0 135-139 34.33865 38.0 34.4 38.0 24.4 38.0 140-144 33.329499999999996 37.6 33.0 38.0 21.8 38.0 145-149 32.87765 37.4 33.4 38.0 17.0 38.0 150-151 29.7835 36.0 28.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 3.0 15 1.0 16 3.0 17 2.0 18 3.0 19 4.0 20 1.0 21 4.0 22 6.0 23 6.0 24 3.0 25 13.0 26 14.0 27 22.0 28 24.0 29 29.0 30 46.0 31 71.0 32 110.0 33 140.0 34 206.0 35 535.0 36 1296.0 37 1455.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.85 11.325000000000001 11.225 39.6 2 22.64764764764765 14.264264264264265 33.38338338338339 29.704704704704703 3 19.025 18.9 25.35 36.725 4 21.6 26.724999999999998 23.5 28.175 5 21.15 30.575000000000003 25.15 23.125 6 21.525 33.925 24.95 19.6 7 15.15 27.700000000000003 38.875 18.275 8 18.475 27.500000000000004 30.2 23.825 9 17.2 25.775 32.7 24.325 10-14 19.465 29.985 27.715 22.835 15-19 20.075000000000003 28.125 28.549999999999997 23.25 20-24 19.765 29.23 27.529999999999998 23.474999999999998 25-29 19.35 29.549999999999997 27.36 23.74 30-34 19.99 28.095 27.83 24.085 35-39 20.3 28.565 27.615000000000002 23.52 40-44 20.515 28.689999999999998 26.965 23.830000000000002 45-49 19.75 28.794999999999998 27.63 23.825 50-54 20.11 29.205 27.089999999999996 23.595 55-59 20.075000000000003 28.610000000000003 27.165 24.15 60-64 20.24 28.955 27.334999999999997 23.47 65-69 20.445 29.005 27.279999999999998 23.27 70-74 20.21 28.915000000000003 27.1 23.775 75-79 20.555 27.900000000000002 27.655 23.89 80-84 20.025000000000002 28.57 27.165 24.240000000000002 85-89 20.9 28.77 26.674999999999997 23.655 90-94 20.54 28.835 27.034999999999997 23.59 95-99 19.965 28.24 27.72 24.075 100-104 20.474999999999998 28.51 27.13 23.885 105-109 20.71 28.549999999999997 26.97 23.77 110-114 20.74 29.015 26.415 23.830000000000002 115-119 21.213183730715286 28.661590863554398 26.552795031055897 23.572430374674415 120-124 20.8437593834451 28.145330797717943 27.2695425883295 23.741367230507457 125-129 20.61 28.470000000000002 27.384999999999998 23.535 130-134 20.580000000000002 28.249999999999996 27.339999999999996 23.830000000000002 135-139 20.78 27.71 27.515 23.995 140-144 21.150287571892974 27.71692923230808 27.27181795448862 23.86096524131033 145-149 20.805 27.74 27.089999999999996 24.365000000000002 150-151 21.15 27.537499999999998 27.6375 23.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 0.5 21 0.5 22 1.0 23 1.0 24 1.5 25 3.0 26 5.5 27 7.0 28 8.0 29 10.5 30 16.5 31 22.0 32 31.0 33 44.5 34 54.5 35 71.0 36 84.0 37 98.5 38 125.0 39 158.0 40 179.0 41 194.5 42 245.5 43 270.5 44 265.0 45 263.0 46 257.0 47 252.5 48 239.5 49 224.5 50 195.5 51 156.0 52 127.5 53 102.0 54 70.0 55 51.0 56 41.5 57 32.0 58 26.5 59 17.0 60 10.5 61 9.5 62 6.0 63 3.5 64 2.5 65 2.0 66 1.0 67 1.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.18 120-124 0.09 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.025 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.2625000000000002 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.4875 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.7625 0.0 0.0 0.0 0.0 130-131 1.9 0.0 0.0 0.0 0.0 132-133 2.0375 0.0 0.0 0.0 0.0 134-135 2.175 0.0 0.0 0.0 0.0 136-137 2.3 0.0 0.0 0.0 0.0 138-139 2.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169879 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169879_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09575 34.0 33.0 34.0 32.0 34.0 2 33.204 34.0 33.0 34.0 33.0 34.0 3 33.2465 34.0 33.0 34.0 33.0 34.0 4 33.1775 34.0 33.0 34.0 33.0 34.0 5 33.199 34.0 33.0 34.0 33.0 34.0 6 37.26075 38.0 38.0 38.0 37.0 38.0 7 37.2765 38.0 38.0 38.0 38.0 38.0 8 37.19475 38.0 38.0 38.0 37.0 38.0 9 37.25225 38.0 38.0 38.0 37.0 38.0 10-14 37.1879 38.0 38.0 38.0 37.2 38.0 15-19 37.2254 38.0 38.0 38.0 37.2 38.0 20-24 36.86585 38.0 37.8 38.0 35.6 38.0 25-29 35.789249999999996 38.0 37.0 38.0 29.0 38.0 30-34 36.9815 38.0 37.8 38.0 36.2 38.0 35-39 37.18265 38.0 38.0 38.0 37.0 38.0 40-44 36.943599999999996 38.0 38.0 38.0 36.4 38.0 45-49 37.0932 38.0 38.0 38.0 37.0 38.0 50-54 36.921099999999996 38.0 38.0 38.0 36.2 38.0 55-59 37.0542 38.0 38.0 38.0 36.8 38.0 60-64 36.9024 38.0 38.0 38.0 36.2 38.0 65-69 36.884550000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.8934 38.0 38.0 38.0 36.0 38.0 75-79 36.9385 38.0 38.0 38.0 36.0 38.0 80-84 36.85055 38.0 38.0 38.0 36.0 38.0 85-89 36.52945 38.0 38.0 38.0 35.0 38.0 90-94 36.7247 38.0 38.0 38.0 35.8 38.0 95-99 36.5928 38.0 38.0 38.0 35.2 38.0 100-104 36.44945 38.0 38.0 38.0 34.6 38.0 105-109 36.33995 38.0 38.0 38.0 34.0 38.0 110-114 36.3275 38.0 38.0 38.0 34.0 38.0 115-119 36.1534 38.0 38.0 38.0 34.0 38.0 120-124 35.8983 38.0 37.4 38.0 33.0 38.0 125-129 35.7845 38.0 37.6 38.0 33.0 38.0 130-134 35.5481 38.0 36.6 38.0 32.4 38.0 135-139 34.693549999999995 38.0 35.8 38.0 26.6 38.0 140-144 34.6333 38.0 35.2 38.0 27.0 38.0 145-149 33.87480000000001 38.0 35.2 38.0 23.0 38.0 150-151 30.61525 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 1.0 5 1.0 6 0.0 7 0.0 8 2.0 9 2.0 10 0.0 11 2.0 12 4.0 13 1.0 14 3.0 15 2.0 16 2.0 17 4.0 18 4.0 19 6.0 20 4.0 21 4.0 22 6.0 23 9.0 24 10.0 25 14.0 26 18.0 27 18.0 28 31.0 29 19.0 30 33.0 31 55.0 32 54.0 33 87.0 34 142.0 35 209.0 36 616.0 37 2626.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.8 21.45 15.825 27.925 2 27.925 26.700000000000003 27.925 17.45 3 20.65 30.15 28.7 20.5 4 22.675 33.875 24.4 19.05 5 24.975 34.525 21.875 18.625 6 21.325 38.1 22.725 17.849999999999998 7 20.4 21.2 38.65 19.75 8 22.7 25.4 27.375 24.525 9 21.7 24.975 30.0 23.325000000000003 10-14 23.82 28.23 25.865 22.085 15-19 22.605 27.889999999999997 28.225 21.279999999999998 20-24 23.3 27.58 27.51 21.61 25-29 23.169999999999998 28.544999999999998 26.695 21.59 30-34 22.634999999999998 27.884999999999998 28.29 21.19 35-39 23.200000000000003 28.235 27.065 21.5 40-44 23.04 28.299999999999997 27.215 21.445 45-49 23.03 28.449999999999996 27.339999999999996 21.18 50-54 23.26 28.194999999999997 27.415 21.13 55-59 23.805 27.515 27.73 20.95 60-64 23.235 27.965 27.67 21.13 65-69 23.52 27.67 27.425 21.385 70-74 23.84 28.050000000000004 27.405 20.705000000000002 75-79 23.125 27.900000000000002 27.589999999999996 21.385 80-84 23.52 27.905 27.425 21.15 85-89 23.75 28.305000000000003 27.505000000000003 20.44 90-94 23.565 27.6 27.975 20.86 95-99 23.95 28.185 27.250000000000004 20.615 100-104 23.895 27.339999999999996 28.105000000000004 20.66 105-109 23.544999999999998 27.115000000000002 27.92 21.42 110-114 23.535 28.199999999999996 26.87 21.395 115-119 23.82 28.67 27.025 20.485 120-124 24.474999999999998 27.52 27.96 20.044999999999998 125-129 24.52 28.01 26.979999999999997 20.49 130-134 24.46 28.105000000000004 27.27 20.165 135-139 24.060263276440264 27.508884328544976 27.30366885229491 21.127183542719855 140-144 24.375 27.435 27.85 20.34 145-149 24.529999999999998 27.439999999999998 27.08 20.95 150-151 24.1125 27.987499999999997 28.6125 19.287499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.5 25 2.5 26 3.0 27 2.0 28 3.0 29 6.0 30 5.5 31 7.5 32 14.5 33 21.5 34 35.5 35 53.5 36 73.0 37 94.0 38 120.0 39 153.5 40 187.0 41 232.0 42 258.5 43 284.0 44 294.5 45 286.0 46 294.0 47 274.5 48 248.0 49 230.0 50 194.5 51 144.5 52 126.5 53 108.5 54 65.5 55 43.5 56 32.0 57 23.0 58 19.0 59 12.0 60 6.5 61 9.5 62 11.5 63 6.0 64 2.5 65 2.0 66 1.5 67 2.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.105 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.301129234629862 0.6 3 0.0 0.0 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 0.9125000000000001 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.1375 0.0 0.0 0.0 0.0 118-119 1.25 0.0 0.0 0.0 0.0 120-121 1.3624999999999998 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.6625 0.0 0.0 0.0 0.0 126-127 1.8375 0.0 0.0 0.0 0.0 128-129 2.0374999999999996 0.0 0.0 0.0 0.0 130-131 2.1875 0.0 0.0 0.0 0.0 132-133 2.325 0.0 0.0 0.0 0.0 134-135 2.475 0.0 0.0 0.0 0.0 136-137 2.5999999999999996 0.0 0.0 0.0 0.0 138-139 2.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGCG 10 0.006843168 144.91249 145 >>END_MODULE Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582061 spots for SRR7169879.sra Written 582061 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra Read 582055 spots for SRR7169879.sra Written 582055 spots for SRR7169879.sra SRR ids: ['SRR7169879.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4iyk8_wy SRR7169879.sra spots: 11641106 blocks: [[1, 582055], [582056, 1164110], [1164111, 1746165], [1746166, 2328220], [2328221, 2910275], [2910276, 3492330], [3492331, 4074385], [4074386, 4656440], [4656441, 5238495], [5238496, 5820550], [5820551, 6402605], [6402606, 6984660], [6984661, 7566715], [7566716, 8148770], [8148771, 8730825], [8730826, 9312880], [9312881, 9894935], [9894936, 10476990], [10476991, 11059045], [11059046, 11641106]] SRR7169879 file size 3923088 SRR7169879 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169879 SRR7169879_1.fastq SRR7169879_2.fastq Input file: SRR7169879_1.fastq Paired file: SRR7169879_2.fastq trimmed: SRR7169879-trimmed-pair1.fastq, SRR7169879-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:31:04 2025 >> started Wed Feb 12 00:31:16 2025 >> done (12.480s) 11641106 read pairs processed; of these: 8897 ( 0.08%) short read pairs filtered out after trimming by size control 8534 ( 0.07%) empty read pairs filtered out after trimming by size control 11623675 (99.85%) read pairs available; of these: 4846197 (41.69%) trimmed read pairs available after processing 6777478 (58.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 4 0.00% 22 3 0.00% 23 4 0.00% 24 2 0.00% 25 1 0.00% 26 3 0.00% 27 3 0.00% 28 3 0.00% 29 2 0.00% 30 4 0.00% 31 1 0.00% 32 4 0.00% 33 7 0.00% 34 4 0.00% 35 5 0.00% 36 7 0.00% 37 8 0.00% 38 2 0.00% 39 3 0.00% 40 8 0.00% 41 9 0.00% 42 11 0.00% 43 15 0.00% 44 16 0.00% 45 14 0.00% 46 14 0.00% 47 10 0.00% 48 18 0.00% 49 17 0.00% 50 29 0.00% 51 33 0.00% 52 47 0.00% 53 53 0.00% 54 41 0.00% 55 51 0.00% 56 44 0.00% 57 71 0.00% 58 71 0.00% 59 81 0.00% 60 99 0.00% 61 112 0.00% 62 143 0.00% 63 154 0.00% 64 175 0.00% 65 193 0.00% 66 190 0.00% 67 249 0.00% 68 284 0.00% 69 327 0.00% 70 359 0.00% 71 414 0.00% 72 462 0.00% 73 553 0.00% 74 600 0.01% 75 733 0.01% 76 820 0.01% 77 838 0.01% 78 932 0.01% 79 995 0.01% 80 1096 0.01% 81 1372 0.01% 82 1417 0.01% 83 1652 0.01% 84 2144 0.02% 85 2737 0.02% 86 2734 0.02% 87 3008 0.03% 88 3297 0.03% 89 3332 0.03% 90 3661 0.03% 91 3902 0.03% 92 4101 0.04% 93 4397 0.04% 94 4571 0.04% 95 4920 0.04% 96 5066 0.04% 97 5229 0.04% 98 5659 0.05% 99 5796 0.05% 100 6140 0.05% 101 6431 0.06% 102 6929 0.06% 103 7280 0.06% 104 7509 0.06% 105 7958 0.07% 106 8392 0.07% 107 8769 0.08% 108 8878 0.08% 109 9272 0.08% 110 9517 0.08% 111 9918 0.09% 112 10301 0.09% 113 10858 0.09% 114 11478 0.10% 115 11978 0.10% 116 12277 0.11% 117 12559 0.11% 118 13273 0.11% 119 13180 0.11% 120 13606 0.12% 121 14229 0.12% 122 14509 0.12% 123 15132 0.13% 124 15994 0.14% 125 16767 0.14% 126 17759 0.15% 127 18305 0.16% 128 19529 0.17% 129 19951 0.17% 130 20934 0.18% 131 22090 0.19% 132 23211 0.20% 133 25279 0.22% 134 26512 0.23% 135 27903 0.24% 136 29967 0.26% 137 31953 0.27% 138 34681 0.30% 139 37683 0.32% 140 40731 0.35% 141 45869 0.39% 142 51647 0.44% 143 60115 0.52% 144 71487 0.62% 145 89507 0.77% 146 114820 0.99% 147 160545 1.38% 148 250214 2.15% 149 519133 4.47% 150 2723790 23.43% 151 6777478 58.31% 11623675 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=40 prefix-density=0.30 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=259.34 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=17.4 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=44 prefix-density=0.24 prefix-fanout=2.2 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.13 sequence-density-rank=19 fanout-score=40.20 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=10.8 sequence=TGTTGGTGGTGG SRR7169879 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:32:02 Started mapping on | Feb 12 00:32:02 Finished on | Feb 12 00:33:01 Mapping speed, Million of reads per hour | 709.24 Number of input reads | 11623675 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11034623 Uniquely mapped reads % | 94.93% Average mapped length | 296.25 Number of splices: Total | 10174218 Number of splices: Annotated (sjdb) | 10011377 Number of splices: GT/AG | 10036933 Number of splices: GC/AG | 109465 Number of splices: AT/AC | 7438 Number of splices: Non-canonical | 20382 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 200721 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 13424 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.19% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 397914 397914 397914 N_multimapping 200721 200721 200721 N_noFeature 204685 10895531 250076 N_ambiguous 139730 704 45524 UnstrandedReadsAssigned:10690208 PositiveStrandReadsAssigned:138388 NegativeStrandReadsAssigned:10739023 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169879 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169879-trimmed-pair1.fastq SRR7169879-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,623,675 reads, 10,655,384 reads pseudoaligned [quant] estimated average fragment length: 287.896 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR7169879.ke.tsv 34699 SRR7169879.se.tsv 87100 total ==> SRR7169879.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1731.1 198 10.0183 Potri.005G024800.1.v4.1 1035 748.104 23 2.69289 Potri.004G059700.1.v4.1 961 674.138 2 0.259857 Potri.007G009000.2.v4.1 1416 1129.1 0 0 Potri.003G141000.2.v4.1 2943 2656.1 151.077 4.98203 Potri.016G087400.1.v4.1 270 70.698 773.992 958.92 Potri.015G069301.1.v4.1 564 284.299 0 0 Potri.010G195200.1.v4.1 1773 1486.1 32 1.88605 Potri.012G127500.1.v4.1 977 690.132 2499 317.166 ==> SRR7169879.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1177 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 156 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169879 completed mapping pipeline successfully