Starting /dee2/code/volunteer_pipeline.sh SRR7169880 current disk space = 3051435257856 free memory = 1396227300 SRR7169880 SRAfilesize 43d850db73d21a78d955d4912ea96a5e SRR7169880.sra SRR7169880.sra file validated SRR7169880 is paired end SRR7169880 is conventional basespace SRR7169880 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169880_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.9685 30.0 18.0 33.0 18.0 34.0 2 29.96275 31.0 29.0 33.0 25.0 33.0 3 32.34975 33.0 33.0 33.0 31.0 34.0 4 32.91925 33.0 33.0 34.0 33.0 34.0 5 33.297 33.0 33.0 34.0 33.0 34.0 6 37.362 38.0 38.0 38.0 36.0 38.0 7 37.67775 38.0 38.0 38.0 37.0 38.0 8 37.69425 38.0 38.0 38.0 38.0 38.0 9 37.70475 38.0 38.0 38.0 38.0 38.0 10-14 37.613150000000005 38.0 38.0 38.0 37.8 38.0 15-19 37.408550000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.65285 38.0 38.0 38.0 38.0 38.0 25-29 37.65155 38.0 38.0 38.0 38.0 38.0 30-34 37.491949999999996 38.0 38.0 38.0 37.6 38.0 35-39 37.49255 38.0 38.0 38.0 37.8 38.0 40-44 37.4011 38.0 38.0 38.0 37.4 38.0 45-49 37.34885 38.0 38.0 38.0 37.0 38.0 50-54 37.175 38.0 38.0 38.0 36.2 38.0 55-59 36.959050000000005 38.0 38.0 38.0 35.4 38.0 60-64 37.054950000000005 38.0 38.0 38.0 35.8 38.0 65-69 37.17725 38.0 38.0 38.0 36.0 38.0 70-74 36.8544 38.0 38.0 38.0 35.2 38.0 75-79 36.893649999999994 38.0 38.0 38.0 35.2 38.0 80-84 36.9439 38.0 38.0 38.0 35.6 38.0 85-89 36.87245 38.0 38.0 38.0 35.2 38.0 90-94 36.6753 38.0 38.0 38.0 34.4 38.0 95-99 36.43645 38.0 37.8 38.0 34.0 38.0 100-104 36.27435 38.0 37.2 38.0 33.8 38.0 105-109 35.5848 38.0 36.2 38.0 30.4 38.0 110-114 36.0418 38.0 37.0 38.0 33.0 38.0 115-119 35.87905000000001 38.0 36.6 38.0 32.8 38.0 120-124 35.66695 38.0 36.0 38.0 31.2 38.0 125-129 35.33095 38.0 36.0 38.0 29.0 38.0 130-134 34.88334999999999 38.0 35.0 38.0 27.8 38.0 135-139 34.6452 38.0 35.0 38.0 27.0 38.0 140-144 33.35215 37.6 33.6 38.0 19.8 38.0 145-149 32.77445 37.8 32.6 38.0 19.4 38.0 150-151 28.542499999999997 34.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 2.0 16 1.0 17 0.0 18 3.0 19 4.0 20 2.0 21 2.0 22 1.0 23 2.0 24 13.0 25 4.0 26 10.0 27 15.0 28 21.0 29 20.0 30 41.0 31 37.0 32 85.0 33 99.0 34 195.0 35 427.0 36 1192.0 37 1817.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.525000000000006 10.575 10.325 35.575 2 22.625 14.674999999999999 35.375 27.325 3 19.35 19.575 27.575 33.5 4 23.125 27.6 24.224999999999998 25.05 5 22.900000000000002 31.15 25.650000000000002 20.3 6 20.125 34.4 25.25 20.225 7 14.2 26.325 42.625 16.85 8 19.675 24.6 30.675 25.05 9 17.175 25.575 33.725 23.525 10-14 20.27 29.42 27.700000000000003 22.61 15-19 20.599999999999998 28.28 27.88 23.24 20-24 20.435 28.51 28.165000000000003 22.89 25-29 20.375 28.655 27.67 23.3 30-34 20.61 28.845 27.12 23.425 35-39 20.86 28.544999999999998 27.455000000000002 23.14 40-44 20.76 28.675 27.55 23.015 45-49 20.605 29.294999999999998 27.445000000000004 22.655 50-54 20.369999999999997 29.075 27.46 23.095 55-59 20.0 28.965000000000003 27.155 23.880000000000003 60-64 20.4 28.435 27.52 23.645 65-69 20.82 28.660000000000004 27.605 22.915 70-74 20.96 28.9 27.265 22.875 75-79 20.645 29.015 27.169999999999998 23.169999999999998 80-84 20.375 28.299999999999997 27.83 23.494999999999997 85-89 20.36 28.549999999999997 28.235 22.855 90-94 20.69 28.67 27.025 23.615 95-99 20.64 29.065 27.665 22.63 100-104 20.94 28.83 27.55 22.68 105-109 21.735 28.165000000000003 27.189999999999998 22.91 110-114 20.93 28.82 27.3 22.95 115-119 21.61 28.775000000000002 26.845000000000002 22.770000000000003 120-124 20.669999999999998 28.46 27.744999999999997 23.125 125-129 21.035 28.799999999999997 27.295 22.869999999999997 130-134 21.09 28.439999999999998 27.115000000000002 23.355 135-139 21.0 28.18 27.54 23.28 140-144 21.415 27.875 27.555000000000003 23.155 145-149 21.3 28.365000000000002 27.16 23.175 150-151 20.6125 27.987499999999997 27.187499999999996 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 0.0 23 1.0 24 1.5 25 3.0 26 7.0 27 8.5 28 11.5 29 16.5 30 18.5 31 26.0 32 35.5 33 36.0 34 45.0 35 64.5 36 85.5 37 101.5 38 137.0 39 178.0 40 196.0 41 213.5 42 240.0 43 248.0 44 261.0 45 268.0 46 264.5 47 263.0 48 232.5 49 208.0 50 177.5 51 153.5 52 124.0 53 91.5 54 79.5 55 64.5 56 39.5 57 25.5 58 18.0 59 8.0 60 10.5 61 9.5 62 5.5 63 3.5 64 3.5 65 3.5 66 1.5 67 0.5 68 0.5 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.1375 0.0 0.0 0.0 0.0 108-109 1.2625 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.7374999999999998 0.0 0.0 0.0 0.0 120-121 1.975 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.5125 0.0 0.0 0.0 0.0 126-127 2.7375 0.0 0.0 0.0 0.0 128-129 2.85 0.0 0.0 0.0 0.0 130-131 2.9749999999999996 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.4 0.0 0.0 0.0 0.0 136-137 3.6500000000000004 0.0 0.0 0.0 0.0 138-139 3.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169880 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169880_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.35875 34.0 33.0 34.0 33.0 34.0 2 33.45625 34.0 33.0 34.0 33.0 34.0 3 33.46325 34.0 33.0 34.0 33.0 34.0 4 33.40175 34.0 33.0 34.0 33.0 34.0 5 33.451 34.0 33.0 34.0 33.0 34.0 6 37.602 38.0 38.0 38.0 38.0 38.0 7 37.65775 38.0 38.0 38.0 38.0 38.0 8 37.624 38.0 38.0 38.0 38.0 38.0 9 37.18475 38.0 38.0 38.0 37.0 38.0 10-14 37.54915 38.0 38.0 38.0 38.0 38.0 15-19 37.52125 38.0 38.0 38.0 38.0 38.0 20-24 37.461850000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.28175 38.0 38.0 38.0 37.2 38.0 30-34 37.5037 38.0 38.0 38.0 38.0 38.0 35-39 37.35435 38.0 38.0 38.0 37.4 38.0 40-44 37.442350000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.4171 38.0 38.0 38.0 37.8 38.0 50-54 37.0029 38.0 38.0 38.0 36.2 38.0 55-59 37.34295 38.0 38.0 38.0 37.2 38.0 60-64 37.378699999999995 38.0 38.0 38.0 37.4 38.0 65-69 37.137150000000005 38.0 38.0 38.0 36.4 38.0 70-74 36.552 38.0 38.0 38.0 34.6 38.0 75-79 36.8414 38.0 38.0 38.0 35.6 38.0 80-84 36.43015 38.0 37.6 38.0 34.0 38.0 85-89 37.0243 38.0 38.0 38.0 36.2 38.0 90-94 37.0894 38.0 38.0 38.0 36.0 38.0 95-99 37.03335 38.0 38.0 38.0 36.0 38.0 100-104 36.6434 38.0 38.0 38.0 35.0 38.0 105-109 36.64985 38.0 38.0 38.0 34.8 38.0 110-114 36.64015 38.0 38.0 38.0 34.8 38.0 115-119 36.56314999999999 38.0 38.0 38.0 34.6 38.0 120-124 36.237 38.0 37.8 38.0 33.8 38.0 125-129 36.17075 38.0 37.6 38.0 33.6 38.0 130-134 35.95399999999999 38.0 37.2 38.0 33.4 38.0 135-139 35.54325 38.0 36.2 38.0 31.4 38.0 140-144 35.3215 38.0 36.0 38.0 31.0 38.0 145-149 34.77055 38.0 35.8 38.0 30.4 38.0 150-151 30.567749999999997 35.5 28.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 1.0 7 1.0 8 4.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 2.0 16 2.0 17 3.0 18 3.0 19 4.0 20 4.0 21 3.0 22 6.0 23 5.0 24 4.0 25 5.0 26 7.0 27 18.0 28 9.0 29 15.0 30 25.0 31 37.0 32 55.0 33 75.0 34 109.0 35 225.0 36 606.0 37 2768.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.525 21.55 15.25 25.674999999999997 2 25.575 26.775 30.349999999999998 17.299999999999997 3 20.3 28.675 31.1 19.925 4 22.725 35.5 23.625 18.15 5 24.45 36.15 21.95 17.45 6 20.150000000000002 37.425000000000004 23.425 19.0 7 19.775000000000002 21.925 38.45 19.85 8 21.25 26.5 27.0 25.25 9 20.674999999999997 26.05 29.2 24.075 10-14 22.27 29.09 26.985 21.654999999999998 15-19 22.35 27.800000000000004 27.935 21.915000000000003 20-24 21.84 28.65 27.72 21.790000000000003 25-29 22.67 28.105000000000004 27.665 21.560000000000002 30-34 22.220000000000002 27.97 28.485 21.325 35-39 22.12 28.435 28.299999999999997 21.145 40-44 22.189999999999998 27.72 28.095 21.995 45-49 22.915 26.97 28.439999999999998 21.675 50-54 22.56 28.16 28.139999999999997 21.14 55-59 22.805 28.050000000000004 27.900000000000002 21.245 60-64 22.34 27.875 28.04 21.745 65-69 22.705000000000002 27.834999999999997 28.33 21.13 70-74 23.125 27.97 27.925 20.979999999999997 75-79 22.625 27.875 28.455000000000002 21.044999999999998 80-84 22.93 28.115000000000002 27.62 21.335 85-89 23.365 28.000000000000004 27.71 20.925 90-94 23.369999999999997 27.045 28.51 21.075 95-99 23.155 27.955000000000002 27.794999999999998 21.095 100-104 24.08 27.26 27.71 20.95 105-109 22.955000000000002 28.050000000000004 28.275 20.72 110-114 23.265 27.68 28.175 20.880000000000003 115-119 23.48 26.955000000000002 28.28 21.285 120-124 23.630000000000003 27.815 27.474999999999998 21.08 125-129 23.150000000000002 28.465 27.689999999999998 20.695 130-134 23.419999999999998 27.36 28.050000000000004 21.17 135-139 23.715 26.75 28.18 21.355 140-144 23.29 28.04 27.71 20.96 145-149 24.185000000000002 27.750000000000004 27.57 20.495 150-151 23.7625 27.425 27.250000000000004 21.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.0 25 1.0 26 4.0 27 5.5 28 5.0 29 8.5 30 12.0 31 16.5 32 23.5 33 32.0 34 44.5 35 60.5 36 77.0 37 104.0 38 138.0 39 170.0 40 197.0 41 236.5 42 269.5 43 281.5 44 288.0 45 301.5 46 298.5 47 269.5 48 235.0 49 192.0 50 160.5 51 133.0 52 104.5 53 83.5 54 67.0 55 48.0 56 34.0 57 23.5 58 16.5 59 14.0 60 10.5 61 6.5 62 5.0 63 5.5 64 4.0 65 2.5 66 1.0 67 0.5 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.4249999999999998 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 2.1 0.0 0.0 0.0 0.0 122-123 2.425 0.0 0.0 0.0 0.0 124-125 2.6375 0.0 0.0 0.0 0.0 126-127 2.8625 0.0 0.0 0.0 0.0 128-129 2.975 0.0 0.0 0.0 0.0 130-131 3.0999999999999996 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.55 0.0 0.0 0.0 0.0 136-137 3.7875 0.0 0.0 0.0 0.0 138-139 3.9875000000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGTTC 10 0.006830828 145.0 7 >>END_MODULE Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551140 spots for SRR7169880.sra Written 551140 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra Read 551136 spots for SRR7169880.sra Written 551136 spots for SRR7169880.sra SRR ids: ['SRR7169880.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_agftcakl SRR7169880.sra spots: 11022724 blocks: [[1, 551136], [551137, 1102272], [1102273, 1653408], [1653409, 2204544], [2204545, 2755680], [2755681, 3306816], [3306817, 3857952], [3857953, 4409088], [4409089, 4960224], [4960225, 5511360], [5511361, 6062496], [6062497, 6613632], [6613633, 7164768], [7164769, 7715904], [7715905, 8267040], [8267041, 8818176], [8818177, 9369312], [9369313, 9920448], [9920449, 10471584], [10471585, 11022724]] SRR7169880 file size 3713539 SRR7169880 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169880 SRR7169880_1.fastq SRR7169880_2.fastq Input file: SRR7169880_1.fastq Paired file: SRR7169880_2.fastq trimmed: SRR7169880-trimmed-pair1.fastq, SRR7169880-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:37:18 2025 >> started Wed Feb 12 00:37:30 2025 >> done (11.886s) 11022724 read pairs processed; of these: 9039 ( 0.08%) short read pairs filtered out after trimming by size control 7740 ( 0.07%) empty read pairs filtered out after trimming by size control 11005945 (99.85%) read pairs available; of these: 4578393 (41.60%) trimmed read pairs available after processing 6427552 (58.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 5 0.00% 21 1 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 1 0.00% 26 2 0.00% 27 1 0.00% 28 5 0.00% 29 5 0.00% 30 7 0.00% 31 8 0.00% 32 2 0.00% 33 3 0.00% 34 5 0.00% 35 7 0.00% 36 6 0.00% 37 7 0.00% 38 10 0.00% 39 8 0.00% 40 14 0.00% 41 18 0.00% 42 7 0.00% 43 18 0.00% 44 16 0.00% 45 10 0.00% 46 20 0.00% 47 25 0.00% 48 26 0.00% 49 24 0.00% 50 48 0.00% 51 45 0.00% 52 59 0.00% 53 56 0.00% 54 59 0.00% 55 84 0.00% 56 95 0.00% 57 93 0.00% 58 126 0.00% 59 102 0.00% 60 122 0.00% 61 154 0.00% 62 201 0.00% 63 187 0.00% 64 246 0.00% 65 264 0.00% 66 272 0.00% 67 340 0.00% 68 366 0.00% 69 414 0.00% 70 504 0.00% 71 582 0.01% 72 630 0.01% 73 735 0.01% 74 868 0.01% 75 900 0.01% 76 999 0.01% 77 1136 0.01% 78 1174 0.01% 79 1299 0.01% 80 1516 0.01% 81 1640 0.01% 82 1917 0.02% 83 2152 0.02% 84 2658 0.02% 85 3235 0.03% 86 3380 0.03% 87 3600 0.03% 88 3807 0.03% 89 3955 0.04% 90 4195 0.04% 91 4525 0.04% 92 4813 0.04% 93 5212 0.05% 94 5382 0.05% 95 5798 0.05% 96 5911 0.05% 97 6284 0.06% 98 6336 0.06% 99 6735 0.06% 100 7021 0.06% 101 7255 0.07% 102 7846 0.07% 103 8297 0.08% 104 8780 0.08% 105 9088 0.08% 106 9383 0.09% 107 9406 0.09% 108 9682 0.09% 109 10066 0.09% 110 10450 0.09% 111 10665 0.10% 112 11359 0.10% 113 11807 0.11% 114 12196 0.11% 115 13110 0.12% 116 13066 0.12% 117 13483 0.12% 118 13806 0.13% 119 14147 0.13% 120 14166 0.13% 121 14517 0.13% 122 15064 0.14% 123 15851 0.14% 124 16802 0.15% 125 17187 0.16% 126 18059 0.16% 127 18442 0.17% 128 19036 0.17% 129 19417 0.18% 130 20689 0.19% 131 21187 0.19% 132 22524 0.20% 133 23901 0.22% 134 25107 0.23% 135 26979 0.25% 136 28890 0.26% 137 30820 0.28% 138 33219 0.30% 139 35700 0.32% 140 38385 0.35% 141 42961 0.39% 142 47892 0.44% 143 55551 0.50% 144 66416 0.60% 145 83449 0.76% 146 107410 0.98% 147 144906 1.32% 148 227831 2.07% 149 469084 4.26% 150 2550561 23.17% 151 6427552 58.40% 11005945 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=41 prefix-density=0.19 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=7 fanout-score=73.40 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=15.9 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=39 prefix-density=0.31 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=35 fanout-score=61.61 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=11.7 sequence=AGAAAATGGAAACCTTTCTATTCAC SRR7169880 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:38:15 Started mapping on | Feb 12 00:38:15 Finished on | Feb 12 00:39:19 Mapping speed, Million of reads per hour | 619.08 Number of input reads | 11005945 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10336572 Uniquely mapped reads % | 93.92% Average mapped length | 295.66 Number of splices: Total | 9983019 Number of splices: Annotated (sjdb) | 9827581 Number of splices: GT/AG | 9839038 Number of splices: GC/AG | 116079 Number of splices: AT/AC | 7657 Number of splices: Non-canonical | 20245 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 200473 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 19981 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.04% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 478349 478349 478349 N_multimapping 200473 200473 200473 N_noFeature 248917 10233735 288555 N_ambiguous 107465 553 43882 UnstrandedReadsAssigned:9980190 PositiveStrandReadsAssigned:102284 NegativeStrandReadsAssigned:10004135 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169880 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169880-trimmed-pair1.fastq SRR7169880-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,005,945 reads, 9,924,158 reads pseudoaligned [quant] estimated average fragment length: 286.949 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52401 SRR7169880.ke.tsv 34699 SRR7169880.se.tsv 87100 total ==> SRR7169880.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.05 212 13.4744 Potri.005G024800.1.v4.1 1035 749.051 31 4.556 Potri.004G059700.1.v4.1 961 675.099 0 0 Potri.007G009000.2.v4.1 1416 1130.05 0 0 Potri.003G141000.2.v4.1 2943 2657.05 191.03 7.91471 Potri.016G087400.1.v4.1 270 75.6644 748 1088.29 Potri.015G069301.1.v4.1 564 286.692 0 0 Potri.010G195200.1.v4.1 1773 1487.05 19 1.40657 Potri.012G127500.1.v4.1 977 691.075 4204 669.685 ==> SRR7169880.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 848 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 185 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169880 completed mapping pipeline successfully