Starting /dee2/code/volunteer_pipeline.sh SRR7169881 current disk space = 3051442548736 free memory = 870957148 SRR7169881 SRAfilesize 8002387511536a65757444453f42eeab SRR7169881.sra SRR7169881.sra file validated SRR7169881 is paired end SRR7169881 is conventional basespace SRR7169881 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169881_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.0265 28.0 18.0 33.0 18.0 33.0 2 28.863 30.0 27.0 33.0 18.0 33.0 3 31.0945 33.0 30.0 33.0 27.0 33.0 4 32.491 33.0 33.0 33.0 31.0 34.0 5 33.07225 33.0 33.0 34.0 33.0 34.0 6 37.3525 38.0 38.0 38.0 36.0 38.0 7 37.6685 38.0 38.0 38.0 37.0 38.0 8 37.76025 38.0 38.0 38.0 38.0 38.0 9 37.75375 38.0 38.0 38.0 38.0 38.0 10-14 37.73819999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.71755 38.0 38.0 38.0 38.0 38.0 20-24 37.69475 38.0 38.0 38.0 38.0 38.0 25-29 37.650850000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.5509 38.0 38.0 38.0 37.8 38.0 35-39 37.601350000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.56945 38.0 38.0 38.0 37.8 38.0 45-49 37.49925 38.0 38.0 38.0 37.2 38.0 50-54 37.343450000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.19325 38.0 38.0 38.0 36.2 38.0 60-64 37.097300000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.66435 38.0 37.8 38.0 34.0 38.0 70-74 36.91865 38.0 38.0 38.0 35.4 38.0 75-79 36.9076 38.0 38.0 38.0 35.4 38.0 80-84 36.73315 38.0 37.8 38.0 34.6 38.0 85-89 36.30145 38.0 37.2 38.0 33.2 38.0 90-94 36.3711 38.0 37.0 38.0 34.0 38.0 95-99 36.36775 38.0 37.0 38.0 34.0 38.0 100-104 35.865300000000005 38.0 36.8 38.0 32.0 38.0 105-109 35.5125 38.0 35.8 38.0 30.2 38.0 110-114 35.29625 38.0 36.0 38.0 29.0 38.0 115-119 34.431 38.0 34.6 38.0 24.8 38.0 120-124 34.0129 38.0 33.6 38.0 22.4 38.0 125-129 32.692899999999995 37.2 31.4 38.0 17.8 38.0 130-134 33.19585 37.6 32.2 38.0 21.4 38.0 135-139 32.93425 37.8 32.2 38.0 18.8 38.0 140-144 31.77125 36.8 30.4 38.0 13.6 38.0 145-149 30.115550000000002 36.0 28.0 38.0 8.0 38.0 150-151 23.841875 30.5 13.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 2.0 16 0.0 17 3.0 18 4.0 19 2.0 20 2.0 21 6.0 22 3.0 23 4.0 24 11.0 25 13.0 26 18.0 27 17.0 28 27.0 29 35.0 30 46.0 31 65.0 32 124.0 33 194.0 34 359.0 35 641.0 36 1343.0 37 1076.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.44164989939638 12.600603621730382 9.25553319919517 33.70221327967807 2 21.95 14.45 36.275 27.325 3 19.325 20.3 27.275 33.1 4 21.825 29.099999999999998 22.45 26.625 5 22.275 32.0 24.825 20.9 6 19.925 35.675000000000004 24.15 20.25 7 13.825000000000001 27.625 39.95 18.6 8 18.875 27.525 30.3 23.3 9 18.2 24.55 33.75 23.5 10-14 20.275000000000002 30.25 26.955000000000002 22.52 15-19 19.97 28.804999999999996 28.185 23.04 20-24 20.24 29.054999999999996 27.595 23.11 25-29 19.835 29.13 27.79 23.244999999999997 30-34 20.315 29.395 27.565 22.725 35-39 20.18 28.610000000000003 27.76 23.45 40-44 20.580000000000002 29.48 26.805 23.135 45-49 19.8 29.575000000000003 27.205000000000002 23.419999999999998 50-54 20.515 28.754999999999995 27.42 23.31 55-59 20.145 29.69 27.065 23.1 60-64 20.265 28.96 27.055 23.72 65-69 20.615 28.615000000000002 27.36 23.41 70-74 20.215 28.535 27.505000000000003 23.745 75-79 19.895 29.07 27.834999999999997 23.200000000000003 80-84 20.325 28.595 27.88 23.200000000000003 85-89 20.32 28.57 27.310000000000002 23.799999999999997 90-94 19.865 28.76 27.525 23.849999999999998 95-99 19.96 28.49 27.74 23.810000000000002 100-104 21.060000000000002 28.785 26.979999999999997 23.175 105-109 20.32 28.67 28.110000000000003 22.900000000000002 110-114 21.054476266773484 28.554976967754857 27.303224514320046 23.087322251151612 115-119 20.971457185778668 28.607911867801704 27.611417125688533 22.8092138207311 120-124 20.444422201091037 28.917471598018118 27.130774235523745 23.507331965367097 125-129 20.51743982385027 28.744432767852672 27.168092878947103 23.570034529349947 130-134 20.585 28.185 27.32 23.91 135-139 20.5 28.405 27.83 23.265 140-144 21.22 27.810000000000002 27.555000000000003 23.415 145-149 20.51 28.01 27.765 23.715 150-151 20.5875 28.237499999999997 27.712500000000002 23.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.5 24 3.0 25 3.5 26 5.0 27 8.0 28 11.5 29 13.0 30 18.5 31 25.0 32 28.5 33 35.5 34 47.5 35 73.5 36 99.0 37 114.0 38 138.5 39 162.0 40 182.5 41 220.0 42 256.0 43 273.0 44 278.5 45 281.0 46 283.0 47 260.5 48 226.0 49 205.0 50 178.5 51 143.0 52 110.0 53 87.0 54 64.0 55 40.0 56 32.5 57 25.5 58 15.0 59 12.0 60 7.5 61 4.5 62 6.5 63 5.0 64 2.0 65 3.0 66 3.0 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.13999999999999999 115-119 0.15 120-124 0.095 125-129 0.08499999999999999 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.5499999999999998 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 1.925 0.0 0.0 0.0 0.0 120-121 2.1500000000000004 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.5875 0.0 0.0 0.0 0.0 126-127 2.9000000000000004 0.0 0.0 0.0 0.0 128-129 3.1125 0.0 0.0 0.0 0.0 130-131 3.375 0.0 0.0 0.0 0.0 132-133 3.575 0.0 0.0 0.0 0.0 134-135 3.8125 0.0 0.0 0.0 0.0 136-137 4.0 0.0 0.0 0.0 0.0 138-139 4.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACAGA 10 0.006830828 145.0 145 ATTGCTC 10 0.006830828 145.0 5 CATATAT 10 0.006830828 145.0 3 >>END_MODULE SRR7169881 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169881_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.40925 34.0 33.0 34.0 33.0 34.0 2 33.4705 34.0 33.0 34.0 33.0 34.0 3 33.47875 34.0 33.0 34.0 33.0 34.0 4 33.46975 34.0 33.0 34.0 33.0 34.0 5 33.41375 34.0 33.0 34.0 33.0 34.0 6 37.68025 38.0 38.0 38.0 38.0 38.0 7 37.60825 38.0 38.0 38.0 38.0 38.0 8 37.61475 38.0 38.0 38.0 38.0 38.0 9 37.588 38.0 38.0 38.0 38.0 38.0 10-14 37.2772 38.0 38.0 38.0 37.0 38.0 15-19 37.595800000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.46365000000001 38.0 38.0 38.0 37.8 38.0 25-29 37.5603 38.0 38.0 38.0 37.8 38.0 30-34 37.56205 38.0 38.0 38.0 38.0 38.0 35-39 37.32915 38.0 38.0 38.0 37.4 38.0 40-44 37.45635 38.0 38.0 38.0 37.6 38.0 45-49 37.5188 38.0 38.0 38.0 38.0 38.0 50-54 37.477050000000006 38.0 38.0 38.0 38.0 38.0 55-59 37.40220000000001 38.0 38.0 38.0 37.2 38.0 60-64 37.38355 38.0 38.0 38.0 37.4 38.0 65-69 37.0751 38.0 38.0 38.0 36.2 38.0 70-74 37.2962 38.0 38.0 38.0 37.0 38.0 75-79 37.2141 38.0 38.0 38.0 37.0 38.0 80-84 37.097049999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.766850000000005 38.0 38.0 38.0 35.4 38.0 90-94 36.8617 38.0 38.0 38.0 35.6 38.0 95-99 36.78215000000001 38.0 38.0 38.0 35.4 38.0 100-104 35.5291 38.0 36.8 38.0 29.2 38.0 105-109 36.13575 38.0 37.2 38.0 32.8 38.0 110-114 35.935249999999996 38.0 37.4 38.0 32.2 38.0 115-119 34.906600000000005 38.0 35.2 38.0 26.8 38.0 120-124 35.1414 38.0 36.0 38.0 27.8 38.0 125-129 34.14874999999999 38.0 34.2 38.0 23.4 38.0 130-134 33.514700000000005 38.0 33.2 38.0 20.4 38.0 135-139 33.4153 38.0 33.0 38.0 20.8 38.0 140-144 32.9787 37.8 32.0 38.0 19.6 38.0 145-149 30.9726 36.8 30.2 38.0 10.2 38.0 150-151 25.722875000000002 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 2.0 8 0.0 9 1.0 10 0.0 11 3.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 2.0 18 4.0 19 6.0 20 6.0 21 6.0 22 8.0 23 6.0 24 11.0 25 11.0 26 12.0 27 12.0 28 29.0 29 22.0 30 38.0 31 50.0 32 78.0 33 135.0 34 233.0 35 441.0 36 1063.0 37 1818.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.125 20.349999999999998 13.775 25.75 2 25.3 27.250000000000004 29.525000000000002 17.925 3 20.45 28.95 31.374999999999996 19.225 4 23.5 34.2 23.825 18.475 5 24.025 35.449999999999996 22.650000000000002 17.875 6 21.375 37.9 22.900000000000002 17.825 7 19.875 22.725 37.6 19.8 8 22.775000000000002 25.1 27.800000000000004 24.325 9 22.85 24.55 28.975 23.625 10-14 23.515 28.895 26.27 21.32 15-19 22.939999999999998 27.61 28.194999999999997 21.255 20-24 23.330000000000002 28.395 27.495000000000005 20.78 25-29 23.41 28.1 27.965 20.525 30-34 22.945 28.59 27.92 20.544999999999998 35-39 22.82 28.205000000000002 28.17 20.805 40-44 23.075000000000003 28.055000000000003 28.17 20.7 45-49 23.36 28.02 27.894999999999996 20.724999999999998 50-54 23.119999999999997 27.860000000000003 28.599999999999998 20.419999999999998 55-59 23.745 28.15 27.77 20.335 60-64 23.265 27.884999999999998 27.85 21.0 65-69 23.275000000000002 28.084999999999997 28.055000000000003 20.585 70-74 23.52 27.49 27.96 21.029999999999998 75-79 23.29 27.355 28.845 20.51 80-84 23.135 28.4 27.515 20.95 85-89 23.31 27.655 28.365000000000002 20.669999999999998 90-94 22.994999999999997 27.625 28.48 20.9 95-99 23.49 28.165000000000003 27.815 20.53 100-104 23.474999999999998 27.810000000000002 28.025 20.69 105-109 23.435 28.425 27.425 20.715 110-114 23.745 27.6 28.1 20.555 115-119 24.154999999999998 27.675 27.88 20.29 120-124 24.435000000000002 27.255000000000003 27.675 20.635 125-129 23.386693346673336 28.61930965482741 27.56378189094547 20.430215107553774 130-134 23.82 28.54 27.43 20.21 135-139 24.2 28.17 27.32 20.31 140-144 24.05 28.18 27.48 20.29 145-149 24.445 27.794999999999998 27.79 19.97 150-151 25.0625 27.287499999999998 28.299999999999997 19.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 2.0 28 4.0 29 3.5 30 5.5 31 10.5 32 14.5 33 25.5 34 36.5 35 50.5 36 82.0 37 105.0 38 139.0 39 184.5 40 213.5 41 237.0 42 271.0 43 308.5 44 312.0 45 307.0 46 295.0 47 253.0 48 231.5 49 220.5 50 172.5 51 129.5 52 102.5 53 80.0 54 59.0 55 36.5 56 24.0 57 16.0 58 14.5 59 14.5 60 10.0 61 6.0 62 4.5 63 3.5 64 2.5 65 1.5 66 2.5 67 1.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.05 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29488793754722 98.575 2 0.6799294887937547 1.35 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.5499999999999998 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.8 0.0 0.0 0.0 0.0 118-119 1.95 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.4000000000000004 0.0 0.0 0.0 0.0 124-125 2.6375 0.0 0.0 0.0 0.0 126-127 2.9000000000000004 0.0 0.0 0.0 0.0 128-129 3.1125 0.0 0.0 0.0 0.0 130-131 3.3625 0.0 0.0 0.0 0.0 132-133 3.55 0.0 0.0 0.0 0.0 134-135 3.75 0.0 0.0 0.0 0.0 136-137 3.925 0.0 0.0 0.0 0.0 138-139 4.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGTT 10 0.006830828 145.0 1 >>END_MODULE Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575379 spots for SRR7169881.sra Written 575379 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra Read 575368 spots for SRR7169881.sra Written 575368 spots for SRR7169881.sra SRR ids: ['SRR7169881.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5ll_cwdq SRR7169881.sra spots: 11507371 blocks: [[1, 575368], [575369, 1150736], [1150737, 1726104], [1726105, 2301472], [2301473, 2876840], [2876841, 3452208], [3452209, 4027576], [4027577, 4602944], [4602945, 5178312], [5178313, 5753680], [5753681, 6329048], [6329049, 6904416], [6904417, 7479784], [7479785, 8055152], [8055153, 8630520], [8630521, 9205888], [9205889, 9781256], [9781257, 10356624], [10356625, 10931992], [10931993, 11507371]] SRR7169881 file size 3877770 SRR7169881 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169881 SRR7169881_1.fastq SRR7169881_2.fastq Input file: SRR7169881_1.fastq Paired file: SRR7169881_2.fastq trimmed: SRR7169881-trimmed-pair1.fastq, SRR7169881-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:38:17 2025 >> started Wed Feb 12 00:38:30 2025 >> done (12.905s) 11507371 read pairs processed; of these: 7790 ( 0.07%) short read pairs filtered out after trimming by size control 7822 ( 0.07%) empty read pairs filtered out after trimming by size control 11491759 (99.86%) read pairs available; of these: 5703887 (49.63%) trimmed read pairs available after processing 5787872 (50.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 8 0.00% 20 2 0.00% 21 1 0.00% 22 1 0.00% 23 3 0.00% 24 2 0.00% 25 3 0.00% 26 3 0.00% 27 2 0.00% 28 4 0.00% 29 4 0.00% 30 5 0.00% 31 5 0.00% 32 6 0.00% 33 7 0.00% 34 10 0.00% 35 4 0.00% 36 13 0.00% 37 11 0.00% 38 10 0.00% 39 7 0.00% 40 11 0.00% 41 15 0.00% 42 16 0.00% 43 19 0.00% 44 19 0.00% 45 19 0.00% 46 21 0.00% 47 23 0.00% 48 28 0.00% 49 30 0.00% 50 33 0.00% 51 43 0.00% 52 72 0.00% 53 58 0.00% 54 69 0.00% 55 70 0.00% 56 90 0.00% 57 112 0.00% 58 121 0.00% 59 145 0.00% 60 175 0.00% 61 184 0.00% 62 210 0.00% 63 267 0.00% 64 257 0.00% 65 315 0.00% 66 351 0.00% 67 355 0.00% 68 456 0.00% 69 438 0.00% 70 566 0.00% 71 691 0.01% 72 737 0.01% 73 900 0.01% 74 951 0.01% 75 1050 0.01% 76 1078 0.01% 77 1289 0.01% 78 1333 0.01% 79 1494 0.01% 80 1688 0.01% 81 1974 0.02% 82 2140 0.02% 83 2521 0.02% 84 3112 0.03% 85 3545 0.03% 86 3608 0.03% 87 3808 0.03% 88 3990 0.03% 89 4239 0.04% 90 4430 0.04% 91 5016 0.04% 92 5224 0.05% 93 5575 0.05% 94 6015 0.05% 95 6152 0.05% 96 6402 0.06% 97 6674 0.06% 98 6707 0.06% 99 7012 0.06% 100 7412 0.06% 101 7640 0.07% 102 8162 0.07% 103 8762 0.08% 104 8877 0.08% 105 9485 0.08% 106 9794 0.09% 107 9789 0.09% 108 10288 0.09% 109 10473 0.09% 110 10590 0.09% 111 11044 0.10% 112 11468 0.10% 113 12199 0.11% 114 12774 0.11% 115 13167 0.11% 116 13588 0.12% 117 14083 0.12% 118 14392 0.13% 119 14409 0.13% 120 15074 0.13% 121 15400 0.13% 122 16070 0.14% 123 17130 0.15% 124 17778 0.15% 125 18656 0.16% 126 19410 0.17% 127 20558 0.18% 128 21121 0.18% 129 22490 0.20% 130 23090 0.20% 131 24669 0.21% 132 26353 0.23% 133 27952 0.24% 134 30224 0.26% 135 32755 0.29% 136 35660 0.31% 137 38798 0.34% 138 42507 0.37% 139 46558 0.41% 140 51106 0.44% 141 57221 0.50% 142 65313 0.57% 143 75800 0.66% 144 92072 0.80% 145 114172 0.99% 146 148788 1.29% 147 208926 1.82% 148 332580 2.89% 149 678376 5.90% 150 3044830 26.50% 151 5787872 50.37% 11491759 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=35 prefix-density=0.16 prefix-fanout=2.7 sequence=AAAGAAGTCAAC criterion=fanout-score sequence-density=0.12 sequence-density-rank=6 fanout-score=42.09 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=13.0 sequence=TTCTCATCAAGGT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=36 prefix-density=0.24 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=279.18 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=30.7 sequence=AAGAAGAAGAAA SRR7169881 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:39:19 Started mapping on | Feb 12 00:39:19 Finished on | Feb 12 00:40:20 Mapping speed, Million of reads per hour | 678.20 Number of input reads | 11491759 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10785969 Uniquely mapped reads % | 93.86% Average mapped length | 295.18 Number of splices: Total | 10361055 Number of splices: Annotated (sjdb) | 10179123 Number of splices: GT/AG | 10205216 Number of splices: GC/AG | 125648 Number of splices: AT/AC | 8407 Number of splices: Non-canonical | 21784 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 201377 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 89662 % of reads mapped to too many loci | 0.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.50% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 513880 513880 513880 N_multimapping 201377 201377 201377 N_noFeature 244815 10663638 296804 N_ambiguous 116561 911 45542 UnstrandedReadsAssigned:10424593 PositiveStrandReadsAssigned:121420 NegativeStrandReadsAssigned:10443623 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169881 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169881-trimmed-pair1.fastq SRR7169881-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,491,759 reads, 10,414,007 reads pseudoaligned [quant] estimated average fragment length: 281.498 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR7169881.ke.tsv 34699 SRR7169881.se.tsv 87100 total ==> SRR7169881.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.5 245 14.094 Potri.005G024800.1.v4.1 1035 754.502 45 5.96135 Potri.004G059700.1.v4.1 961 680.52 2 0.293752 Potri.007G009000.2.v4.1 1416 1135.5 0 0 Potri.003G141000.2.v4.1 2943 2662.5 205 7.69585 Potri.016G087400.1.v4.1 270 73.6727 829 1124.71 Potri.015G069301.1.v4.1 564 291.09 0 0 Potri.010G195200.1.v4.1 1773 1492.5 39 2.61181 Potri.012G127500.1.v4.1 977 696.508 6207 890.734 ==> SRR7169881.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1794 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 286 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR7169881 completed mapping pipeline successfully