Starting /dee2/code/volunteer_pipeline.sh SRR7169882 current disk space = 3051383058432 free memory = 1247954216 SRR7169882 SRAfilesize 92a59a041576e1fbba15aaf5143d2fd7 SRR7169882.sra SRR7169882.sra file validated SRR7169882 is paired end SRR7169882 is conventional basespace SRR7169882 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169882_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.0975 18.0 18.0 25.0 18.0 32.0 2 27.56975 27.0 27.0 30.0 25.0 31.0 3 28.976 29.0 27.0 31.0 25.0 33.0 4 31.72625 33.0 31.0 33.0 29.0 33.0 5 32.13875 33.0 32.0 33.0 31.0 33.0 6 36.5735 37.0 36.0 38.0 34.0 38.0 7 37.4035 38.0 38.0 38.0 36.0 38.0 8 37.5005 38.0 38.0 38.0 37.0 38.0 9 37.5795 38.0 38.0 38.0 38.0 38.0 10-14 37.63965 38.0 38.0 38.0 38.0 38.0 15-19 37.60164999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.57465 38.0 38.0 38.0 37.8 38.0 25-29 37.6688 38.0 38.0 38.0 38.0 38.0 30-34 37.6349 38.0 38.0 38.0 38.0 38.0 35-39 37.562850000000005 38.0 38.0 38.0 37.8 38.0 40-44 37.6294 38.0 38.0 38.0 38.0 38.0 45-49 37.6295 38.0 38.0 38.0 38.0 38.0 50-54 37.603300000000004 38.0 38.0 38.0 38.0 38.0 55-59 37.4755 38.0 38.0 38.0 37.2 38.0 60-64 37.44055 38.0 38.0 38.0 37.2 38.0 65-69 37.375049999999995 38.0 38.0 38.0 37.2 38.0 70-74 37.39385 38.0 38.0 38.0 37.0 38.0 75-79 37.36065 38.0 38.0 38.0 37.0 38.0 80-84 37.116600000000005 38.0 38.0 38.0 36.2 38.0 85-89 37.1023 38.0 38.0 38.0 36.0 38.0 90-94 36.71935 38.0 38.0 38.0 34.6 38.0 95-99 37.03365 38.0 38.0 38.0 35.8 38.0 100-104 36.71835 38.0 38.0 38.0 34.6 38.0 105-109 36.0698 38.0 36.6 38.0 31.2 38.0 110-114 35.9794 38.0 36.8 38.0 32.2 38.0 115-119 35.2483 38.0 35.2 38.0 28.6 38.0 120-124 36.0505 38.0 37.2 38.0 33.0 38.0 125-129 35.1796 38.0 35.6 38.0 27.8 38.0 130-134 35.70875 38.0 36.0 38.0 32.2 38.0 135-139 35.7522 38.0 36.2 38.0 32.4 38.0 140-144 34.9696 38.0 35.4 38.0 28.8 38.0 145-149 33.104 37.6 32.6 38.0 21.6 38.0 150-151 28.919125 35.5 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 2.0 18 1.0 19 1.0 20 2.0 21 4.0 22 3.0 23 8.0 24 7.0 25 9.0 26 5.0 27 11.0 28 15.0 29 19.0 30 31.0 31 35.0 32 64.0 33 101.0 34 150.0 35 340.0 36 1153.0 37 2037.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.675 17.5 4.925 30.9 2 22.664663160530928 13.799148509892312 35.386927122464314 28.149261207112446 3 19.85 19.35 26.5 34.300000000000004 4 23.95 27.200000000000003 22.975 25.874999999999996 5 23.200000000000003 31.374999999999996 24.6 20.825 6 19.2 35.199999999999996 25.224999999999998 20.375 7 15.325 28.65 39.375 16.650000000000002 8 16.325 25.5 33.175 25.0 9 17.25 24.15 34.2 24.4 10-14 19.985 30.009999999999998 27.29 22.715 15-19 20.435 28.665000000000003 27.875 23.025000000000002 20-24 20.035 28.99 26.875 24.099999999999998 25-29 19.919999999999998 29.115000000000002 28.01 22.955000000000002 30-34 20.01 28.615000000000002 28.13 23.244999999999997 35-39 19.805 28.95 27.68 23.565 40-44 20.025000000000002 29.095 27.48 23.400000000000002 45-49 20.57 29.270000000000003 27.46 22.7 50-54 20.07 29.565 27.169999999999998 23.195 55-59 20.01 29.299999999999997 26.790000000000003 23.9 60-64 20.625 28.64 27.655 23.080000000000002 65-69 20.105 28.38 27.744999999999997 23.77 70-74 20.005 28.415000000000003 27.975 23.605 75-79 19.935 28.860000000000003 27.97 23.235 80-84 20.22 28.37 27.589999999999996 23.82 85-89 20.805 28.055000000000003 27.92 23.22 90-94 20.465 28.71 26.96 23.865 95-99 20.560000000000002 28.34 28.144999999999996 22.955000000000002 100-104 20.580000000000002 29.080000000000002 27.084999999999997 23.255 105-109 20.87 28.439999999999998 26.75 23.94 110-114 20.635 28.720000000000002 27.265 23.380000000000003 115-119 21.44466136056465 28.708014216348797 26.70571156830355 23.141612854783 120-124 21.285 28.655 26.424999999999997 23.635 125-129 21.195 29.189999999999998 25.785000000000004 23.830000000000002 130-134 21.805 28.82 26.085 23.29 135-139 21.099999999999998 29.049999999999997 25.540000000000003 24.310000000000002 140-144 21.58 28.610000000000003 25.955000000000002 23.855 145-149 21.765 28.599999999999998 25.929999999999996 23.705000000000002 150-151 20.9875 29.65 25.05 24.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 2.0 27 6.0 28 9.0 29 9.5 30 15.5 31 27.0 32 35.5 33 45.0 34 54.5 35 65.5 36 91.5 37 111.0 38 135.0 39 177.0 40 188.0 41 215.5 42 251.0 43 259.5 44 273.5 45 282.5 46 271.5 47 245.5 48 241.5 49 221.5 50 178.5 51 138.5 52 101.0 53 89.5 54 78.0 55 58.5 56 40.0 57 25.5 58 19.5 59 11.0 60 4.5 61 2.0 62 2.0 63 2.5 64 2.0 65 1.5 66 1.0 67 1.0 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.11499999999999999 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.30000000000000004 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.48750000000000004 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.775 0.0 0.0 0.0 0.0 88-89 0.8374999999999999 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.2125 0.0 0.0 0.0 0.0 94-95 1.5499999999999998 0.0 0.0 0.0 0.0 96-97 1.9249999999999998 0.0 0.0 0.0 0.0 98-99 2.275 0.0 0.0 0.0 0.0 100-101 2.6875 0.0 0.0 0.0 0.0 102-103 3.2125 0.0 0.0 0.0 0.0 104-105 3.55 0.0 0.0 0.0 0.0 106-107 4.05 0.0 0.0 0.0 0.0 108-109 4.5125 0.0 0.0 0.0 0.0 110-111 4.987500000000001 0.0 0.0 0.0 0.0 112-113 5.5625 0.0 0.0 0.0 0.0 114-115 6.2125 0.0 0.0 0.0 0.0 116-117 7.15 0.0 0.0 0.0 0.0 118-119 7.85 0.0 0.0 0.0 0.0 120-121 8.525 0.0 0.0 0.0 0.0 122-123 9.3875 0.0 0.0 0.0 0.0 124-125 10.325 0.0 0.0 0.0 0.0 126-127 11.0375 0.0 0.0 0.0 0.0 128-129 11.8875 0.0 0.0 0.0 0.0 130-131 12.75 0.0 0.0 0.0 0.0 132-133 13.4625 0.0 0.0 0.0 0.0 134-135 14.350000000000001 0.0 0.0 0.0 0.0 136-137 15.3 0.0 0.0 0.0 0.0 138-139 16.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGAAAT 10 0.006830828 145.0 3 CAGTCAC 60 0.004491891 14.500001 140-144 >>END_MODULE SRR7169882 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169882_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3125 34.0 33.0 34.0 33.0 34.0 2 33.3625 34.0 33.0 34.0 33.0 34.0 3 33.37975 34.0 33.0 34.0 33.0 34.0 4 33.373 34.0 33.0 34.0 33.0 34.0 5 33.311 34.0 33.0 34.0 33.0 34.0 6 37.461 38.0 38.0 38.0 38.0 38.0 7 37.502 38.0 38.0 38.0 38.0 38.0 8 37.53725 38.0 38.0 38.0 38.0 38.0 9 37.5855 38.0 38.0 38.0 38.0 38.0 10-14 37.566700000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.4867 38.0 38.0 38.0 38.0 38.0 20-24 37.506600000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.38250000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.334050000000005 38.0 38.0 38.0 37.8 38.0 35-39 37.08885 38.0 38.0 38.0 36.8 38.0 40-44 37.35164999999999 38.0 38.0 38.0 37.6 38.0 45-49 37.3912 38.0 38.0 38.0 38.0 38.0 50-54 37.4089 38.0 38.0 38.0 38.0 38.0 55-59 37.381800000000005 38.0 38.0 38.0 38.0 38.0 60-64 37.187400000000004 38.0 38.0 38.0 37.2 38.0 65-69 37.276149999999994 38.0 38.0 38.0 37.0 38.0 70-74 37.2799 38.0 38.0 38.0 37.2 38.0 75-79 37.2732 38.0 38.0 38.0 37.0 38.0 80-84 37.11645 38.0 38.0 38.0 36.8 38.0 85-89 36.801649999999995 38.0 38.0 38.0 35.8 38.0 90-94 37.00965 38.0 38.0 38.0 36.2 38.0 95-99 37.033849999999994 38.0 38.0 38.0 36.4 38.0 100-104 36.8817 38.0 38.0 38.0 36.0 38.0 105-109 36.45869999999999 38.0 37.8 38.0 34.2 38.0 110-114 36.247400000000006 38.0 37.4 38.0 33.0 38.0 115-119 36.528800000000004 38.0 38.0 38.0 34.6 38.0 120-124 36.4183 38.0 38.0 38.0 34.0 38.0 125-129 35.484500000000004 38.0 36.4 38.0 28.8 38.0 130-134 36.01655 38.0 37.8 38.0 33.4 38.0 135-139 35.55855 38.0 36.6 38.0 31.0 38.0 140-144 34.903949999999995 38.0 35.4 38.0 27.4 38.0 145-149 33.18845 38.0 32.6 38.0 21.2 38.0 150-151 29.777375 35.5 27.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 2.0 5 1.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 3.0 15 2.0 16 1.0 17 0.0 18 3.0 19 3.0 20 2.0 21 4.0 22 9.0 23 2.0 24 5.0 25 20.0 26 9.0 27 9.0 28 17.0 29 17.0 30 27.0 31 38.0 32 59.0 33 62.0 34 119.0 35 199.0 36 621.0 37 2756.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.85 24.275 8.975 22.900000000000002 2 26.174999999999997 28.175 29.799999999999997 15.85 3 20.474999999999998 27.725 34.050000000000004 17.75 4 24.099999999999998 34.150000000000006 23.575 18.175 5 25.2 36.325 21.2 17.275 6 21.099999999999998 37.675 22.375 18.85 7 20.8 22.475 36.95 19.775000000000002 8 20.95 25.775 28.95 24.325 9 22.325 24.85 29.925 22.900000000000002 10-14 23.580000000000002 28.82 26.51 21.09 15-19 22.6 28.599999999999998 27.725 21.075 20-24 23.18 28.075 27.925 20.82 25-29 23.115 28.395 27.485 21.005 30-34 23.395 27.639999999999997 28.15 20.815 35-39 23.145 27.61 28.43 20.815 40-44 23.25 28.16 28.13 20.46 45-49 23.59 27.83 27.810000000000002 20.77 50-54 22.869999999999997 28.53 27.884999999999998 20.715 55-59 23.605 28.165000000000003 28.22 20.01 60-64 23.225 28.205000000000002 27.955000000000002 20.615 65-69 23.555 27.775 28.46 20.21 70-74 23.855 27.68 28.32 20.145 75-79 22.935 28.02 28.349999999999998 20.695 80-84 23.05 27.83 28.375 20.745 85-89 23.474999999999998 27.075 28.38 21.07 90-94 23.03 27.74 28.73 20.5 95-99 23.715 27.650000000000002 28.67 19.965 100-104 23.724999999999998 28.050000000000004 28.115000000000002 20.11 105-109 23.615 27.965 27.810000000000002 20.61 110-114 24.335 27.68 27.800000000000004 20.185 115-119 24.675 28.125 27.43 19.77 120-124 24.54 28.415000000000003 26.965 20.080000000000002 125-129 25.47 28.175 26.825 19.53 130-134 25.60908499674821 27.870328680774424 26.65466006303467 19.86592625944269 135-139 25.874999999999996 27.72 27.500000000000004 18.905 140-144 25.855 27.265 27.22 19.66 145-149 26.47 27.095000000000002 26.75 19.685 150-151 26.487500000000004 26.087500000000002 27.675 19.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.0 25 1.5 26 0.5 27 0.5 28 2.5 29 6.0 30 8.5 31 15.5 32 20.0 33 29.0 34 51.5 35 68.0 36 83.0 37 106.5 38 138.0 39 185.0 40 228.5 41 241.5 42 256.0 43 274.0 44 280.0 45 298.0 46 300.5 47 258.0 48 233.5 49 209.5 50 164.5 51 128.0 52 99.0 53 85.5 54 64.0 55 43.0 56 31.5 57 24.0 58 18.5 59 14.0 60 10.0 61 5.5 62 4.0 63 3.5 64 2.5 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.055 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.6000000000000001 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.7875000000000001 0.0 0.0 0.0 0.0 90-91 0.9625 0.0 0.0 0.0 0.0 92-93 1.1625 0.0 0.0 0.0 0.0 94-95 1.525 0.0 0.0 0.0 0.0 96-97 1.8875 0.0 0.0 0.0 0.0 98-99 2.225 0.0 0.0 0.0 0.0 100-101 2.6624999999999996 0.0 0.0 0.0 0.0 102-103 3.0999999999999996 0.0 0.0 0.0 0.0 104-105 3.4375 0.0 0.0 0.0 0.0 106-107 4.0 0.0 0.0 0.0 0.0 108-109 4.5625 0.0 0.0 0.0 0.0 110-111 5.1625 0.0 0.0 0.0 0.0 112-113 5.762499999999999 0.0 0.0 0.0 0.0 114-115 6.4375 0.0 0.0 0.0 0.0 116-117 7.3625 0.0 0.0 0.0 0.0 118-119 8.1 0.0 0.0 0.0 0.0 120-121 8.75 0.0 0.0 0.0 0.0 122-123 9.625 0.0 0.0 0.0 0.0 124-125 10.6 0.0 0.0 0.0 0.0 126-127 11.325 0.0 0.0 0.0 0.0 128-129 12.1875 0.0 0.0 0.0 0.0 130-131 12.962499999999999 0.0 0.0 0.0 0.0 132-133 13.6625 0.0 0.0 0.0 0.0 134-135 14.55 0.0 0.0 0.0 0.0 136-137 15.524999999999999 0.0 0.0 0.0 0.0 138-139 16.450000000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGAGT 65 0.0076375785 13.384615 140-144 >>END_MODULE Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038451 spots for SRR7169882.sra Written 1038451 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra Read 1038433 spots for SRR7169882.sra Written 1038433 spots for SRR7169882.sra SRR ids: ['SRR7169882.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x42gpz16 SRR7169882.sra spots: 20768678 blocks: [[1, 1038433], [1038434, 2076866], [2076867, 3115299], [3115300, 4153732], [4153733, 5192165], [5192166, 6230598], [6230599, 7269031], [7269032, 8307464], [8307465, 9345897], [9345898, 10384330], [10384331, 11422763], [11422764, 12461196], [12461197, 13499629], [13499630, 14538062], [14538063, 15576495], [15576496, 16614928], [16614929, 17653361], [17653362, 18691794], [18691795, 19730227], [19730228, 20768678]] SRR7169882 file size 7016123 SRR7169882 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169882 SRR7169882_1.fastq SRR7169882_2.fastq Input file: SRR7169882_1.fastq Paired file: SRR7169882_2.fastq trimmed: SRR7169882-trimmed-pair1.fastq, SRR7169882-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:41:32 2025 >> started Wed Feb 12 00:41:58 2025 >> done (25.914s) 20768678 read pairs processed; of these: 13106 ( 0.06%) short read pairs filtered out after trimming by size control 10941 ( 0.05%) empty read pairs filtered out after trimming by size control 20744631 (99.88%) read pairs available; of these: 10634687 (51.26%) trimmed read pairs available after processing 10109944 (48.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 3 0.00% 21 9 0.00% 22 5 0.00% 23 6 0.00% 24 7 0.00% 25 8 0.00% 26 9 0.00% 27 9 0.00% 28 10 0.00% 29 9 0.00% 30 10 0.00% 31 20 0.00% 32 17 0.00% 33 10 0.00% 34 18 0.00% 35 20 0.00% 36 25 0.00% 37 18 0.00% 38 24 0.00% 39 28 0.00% 40 39 0.00% 41 47 0.00% 42 52 0.00% 43 49 0.00% 44 48 0.00% 45 62 0.00% 46 75 0.00% 47 92 0.00% 48 100 0.00% 49 127 0.00% 50 132 0.00% 51 174 0.00% 52 187 0.00% 53 222 0.00% 54 248 0.00% 55 283 0.00% 56 321 0.00% 57 361 0.00% 58 421 0.00% 59 556 0.00% 60 637 0.00% 61 817 0.00% 62 963 0.00% 63 1034 0.00% 64 1163 0.01% 65 1281 0.01% 66 1426 0.01% 67 1666 0.01% 68 1903 0.01% 69 2312 0.01% 70 2632 0.01% 71 3034 0.01% 72 3675 0.02% 73 4249 0.02% 74 4744 0.02% 75 5405 0.03% 76 6031 0.03% 77 6550 0.03% 78 7072 0.03% 79 8152 0.04% 80 9216 0.04% 81 10715 0.05% 82 12165 0.06% 83 13539 0.07% 84 15801 0.08% 85 17490 0.08% 86 18900 0.09% 87 20097 0.10% 88 21547 0.10% 89 23157 0.11% 90 25390 0.12% 91 27328 0.13% 92 30048 0.14% 93 32915 0.16% 94 35425 0.17% 95 38041 0.18% 96 39873 0.19% 97 41253 0.20% 98 42353 0.20% 99 44313 0.21% 100 47415 0.23% 101 49531 0.24% 102 52503 0.25% 103 55337 0.27% 104 58173 0.28% 105 61698 0.30% 106 63880 0.31% 107 64733 0.31% 108 66262 0.32% 109 67526 0.33% 110 68349 0.33% 111 70667 0.34% 112 73192 0.35% 113 76327 0.37% 114 79774 0.38% 115 82014 0.40% 116 83930 0.40% 117 85928 0.41% 118 85906 0.41% 119 86042 0.41% 120 87454 0.42% 121 88306 0.43% 122 90213 0.43% 123 93126 0.45% 124 95727 0.46% 125 97459 0.47% 126 100612 0.49% 127 102160 0.49% 128 102029 0.49% 129 103131 0.50% 130 104678 0.50% 131 104595 0.50% 132 106473 0.51% 133 108255 0.52% 134 111964 0.54% 135 115882 0.56% 136 117945 0.57% 137 120566 0.58% 138 124284 0.60% 139 126916 0.61% 140 129792 0.63% 141 135279 0.65% 142 140363 0.68% 143 149420 0.72% 144 165282 0.80% 145 186169 0.90% 146 214261 1.03% 147 270209 1.30% 148 379535 1.83% 149 737071 3.55% 150 4058161 19.56% 151 10109944 48.74% 20744631 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=34 prefix-density=0.19 prefix-fanout=2.4 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=49.71 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=10.4 sequence=TCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGAC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=34 prefix-density=0.24 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.03 sequence-density-rank=43 fanout-score=77.57 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=11.3 sequence=CTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCGACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7169882 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:42:39 Started mapping on | Feb 12 00:42:39 Finished on | Feb 12 00:44:13 Mapping speed, Million of reads per hour | 794.48 Number of input reads | 20744631 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 19991964 Uniquely mapped reads % | 96.37% Average mapped length | 286.75 Number of splices: Total | 17872102 Number of splices: Annotated (sjdb) | 17564080 Number of splices: GT/AG | 17609283 Number of splices: GC/AG | 207868 Number of splices: AT/AC | 15348 Number of splices: Non-canonical | 39603 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 332666 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 20673 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.90% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 432325 432325 432325 N_multimapping 332666 332666 332666 N_noFeature 514240 19738110 634187 N_ambiguous 211887 1265 77072 UnstrandedReadsAssigned:19265837 PositiveStrandReadsAssigned:252589 NegativeStrandReadsAssigned:19280705 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR7169882 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169882-trimmed-pair1.fastq SRR7169882-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,744,631 reads, 19,151,208 reads pseudoaligned [quant] estimated average fragment length: 204.938 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR7169882.ke.tsv 34699 SRR7169882.se.tsv 87100 total ==> SRR7169882.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1814.06 361 11.6187 Potri.005G024800.1.v4.1 1035 831.062 66 4.63674 Potri.004G059700.1.v4.1 961 757.074 3 0.231358 Potri.007G009000.2.v4.1 1416 1212.06 0 0 Potri.003G141000.2.v4.1 2943 2739.06 349.128 7.44191 Potri.016G087400.1.v4.1 270 101.52 1589 913.848 Potri.015G069301.1.v4.1 564 362.946 0 0 Potri.010G195200.1.v4.1 1773 1569.06 34 1.26515 Potri.012G127500.1.v4.1 977 773.074 7290 550.565 ==> SRR7169882.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2333 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 355 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 29 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7169882 completed mapping pipeline successfully