Starting /dee2/code/volunteer_pipeline.sh SRR7169883 current disk space = 3051242119168 free memory = 1515653180 SRR7169883 SRAfilesize 3c53dc60fc3f0f23ee2bc495cb08b9cb SRR7169883.sra SRR7169883.sra file validated SRR7169883 is paired end SRR7169883 is conventional basespace SRR7169883 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169883_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.2375 18.0 18.0 18.0 18.0 32.0 2 24.867 25.0 18.0 27.0 18.0 30.0 3 25.003 25.0 18.0 29.0 18.0 31.0 4 28.31475 29.0 27.0 31.0 25.0 33.0 5 30.86775 32.0 32.0 33.0 27.0 33.0 6 36.04 37.0 36.0 38.0 33.0 38.0 7 37.021 38.0 37.0 38.0 35.0 38.0 8 37.13075 38.0 38.0 38.0 35.0 38.0 9 37.395 38.0 38.0 38.0 37.0 38.0 10-14 37.5188 38.0 38.0 38.0 37.0 38.0 15-19 37.55495 38.0 38.0 38.0 37.4 38.0 20-24 37.603750000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.5966 38.0 38.0 38.0 38.0 38.0 30-34 37.619150000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.56765 38.0 38.0 38.0 38.0 38.0 40-44 37.5355 38.0 38.0 38.0 38.0 38.0 45-49 37.5157 38.0 38.0 38.0 38.0 38.0 50-54 37.39675 38.0 38.0 38.0 37.0 38.0 55-59 37.36155000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.33454999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.24175 38.0 38.0 38.0 37.0 38.0 70-74 37.1507 38.0 38.0 38.0 36.2 38.0 75-79 37.104949999999995 38.0 38.0 38.0 36.0 38.0 80-84 37.02395 38.0 38.0 38.0 36.0 38.0 85-89 36.967200000000005 38.0 38.0 38.0 35.8 38.0 90-94 36.93829999999999 38.0 38.0 38.0 35.8 38.0 95-99 36.733450000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.52335 38.0 38.0 38.0 34.2 38.0 105-109 36.325 38.0 37.8 38.0 34.0 38.0 110-114 36.25165 38.0 37.6 38.0 33.8 38.0 115-119 36.1649 38.0 37.2 38.0 33.4 38.0 120-124 35.88865 38.0 37.0 38.0 32.6 38.0 125-129 35.54025 38.0 36.4 38.0 31.0 38.0 130-134 35.32465 38.0 36.0 38.0 29.8 38.0 135-139 35.3049 38.0 36.0 38.0 30.4 38.0 140-144 34.8291 38.0 35.0 38.0 28.0 38.0 145-149 34.349599999999995 38.0 35.0 38.0 26.6 38.0 150-151 31.000875 36.5 31.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 0.0 13 1.0 14 0.0 15 0.0 16 4.0 17 2.0 18 2.0 19 4.0 20 2.0 21 2.0 22 2.0 23 9.0 24 8.0 25 6.0 26 8.0 27 14.0 28 18.0 29 15.0 30 34.0 31 47.0 32 66.0 33 102.0 34 167.0 35 327.0 36 951.0 37 2204.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.532586558044805 17.28615071283096 7.30651731160896 38.87474541751528 2 22.275 17.025000000000002 32.675 28.025 3 22.575 20.625 24.5 32.300000000000004 4 23.05 28.15 21.575 27.224999999999998 5 22.8 34.150000000000006 22.55 20.5 6 20.599999999999998 37.025000000000006 23.125 19.25 7 13.850000000000001 26.85 40.9 18.4 8 18.2 26.875 29.775000000000002 25.15 9 17.775 24.6 32.6 25.025 10-14 19.55 30.48 27.02 22.95 15-19 19.985 29.054999999999996 27.555000000000003 23.405 20-24 19.7 28.655 27.775 23.87 25-29 19.395 29.56 27.54 23.505000000000003 30-34 19.495 29.285 27.32 23.9 35-39 20.115 29.07 27.005000000000003 23.810000000000002 40-44 19.695 29.14 27.415 23.75 45-49 19.814999999999998 28.46 27.465 24.26 50-54 20.025000000000002 29.049999999999997 27.705000000000002 23.22 55-59 19.985 28.560000000000002 27.67 23.785 60-64 19.905 28.92 27.195000000000004 23.98 65-69 19.915 28.945 27.389999999999997 23.75 70-74 20.495 29.025000000000002 27.500000000000004 22.98 75-79 19.665 28.615000000000002 27.185 24.535 80-84 20.580000000000002 28.535 26.985 23.9 85-89 19.759999999999998 28.46 27.625 24.154999999999998 90-94 20.285 28.29 27.415 24.01 95-99 20.04 29.005 27.279999999999998 23.674999999999997 100-104 20.655 28.51 27.315 23.52 105-109 20.47 27.66 27.93 23.94 110-114 20.91 28.58 27.47 23.04 115-119 20.495 29.12 26.724999999999998 23.66 120-124 20.165 28.08 27.810000000000002 23.945 125-129 20.755000000000003 28.194999999999997 27.400000000000002 23.65 130-134 20.995 28.04 27.0 23.965 135-139 20.62 27.715 27.52 24.145 140-144 20.785 28.205000000000002 27.145000000000003 23.865 145-149 20.830000000000002 28.57 26.795 23.805 150-151 20.424999999999997 27.650000000000002 27.8125 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.5 22 1.5 23 0.5 24 1.5 25 3.0 26 4.5 27 7.5 28 10.0 29 11.0 30 16.5 31 29.5 32 34.0 33 42.0 34 54.5 35 76.5 36 100.5 37 109.5 38 133.0 39 160.5 40 175.0 41 193.0 42 231.5 43 263.0 44 280.0 45 276.5 46 261.0 47 271.0 48 263.0 49 213.5 50 165.0 51 125.0 52 102.5 53 95.5 54 73.5 55 53.5 56 44.5 57 36.5 58 25.0 59 14.0 60 9.5 61 7.0 62 4.5 63 3.0 64 4.5 65 3.5 66 1.5 67 0.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7999999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.5125000000000002 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 1.9625 0.0 0.0 0.0 0.0 126-127 2.2 0.0 0.0 0.0 0.0 128-129 2.5 0.0 0.0 0.0 0.0 130-131 2.875 0.0 0.0 0.0 0.0 132-133 3.2875 0.0 0.0 0.0 0.0 134-135 3.575 0.0 0.0 0.0 0.0 136-137 3.925 0.0 0.0 0.0 0.0 138-139 4.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATGTA 10 0.006832588 144.9875 4 >>END_MODULE SRR7169883 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169883_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81975 33.0 33.0 34.0 32.0 34.0 2 32.87425 34.0 33.0 34.0 32.0 34.0 3 32.9275 34.0 33.0 34.0 32.0 34.0 4 32.81775 34.0 33.0 34.0 32.0 34.0 5 32.83575 34.0 33.0 34.0 32.0 34.0 6 37.05875 38.0 38.0 38.0 37.0 38.0 7 37.12275 38.0 38.0 38.0 37.0 38.0 8 37.11625 38.0 38.0 38.0 37.0 38.0 9 37.05625 38.0 38.0 38.0 37.0 38.0 10-14 37.10015 38.0 38.0 38.0 37.0 38.0 15-19 37.052949999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.03875 38.0 38.0 38.0 37.0 38.0 25-29 36.9887 38.0 38.0 38.0 37.0 38.0 30-34 36.9855 38.0 38.0 38.0 37.0 38.0 35-39 36.9172 38.0 38.0 38.0 36.8 38.0 40-44 36.88565 38.0 38.0 38.0 36.0 38.0 45-49 36.9033 38.0 38.0 38.0 36.6 38.0 50-54 36.901399999999995 38.0 38.0 38.0 36.4 38.0 55-59 36.789849999999994 38.0 38.0 38.0 36.0 38.0 60-64 36.77885 38.0 38.0 38.0 36.0 38.0 65-69 36.6431 38.0 38.0 38.0 35.6 38.0 70-74 36.53825 38.0 38.0 38.0 35.0 38.0 75-79 36.4196 38.0 38.0 38.0 34.8 38.0 80-84 36.4551 38.0 38.0 38.0 35.0 38.0 85-89 36.391949999999994 38.0 38.0 38.0 34.4 38.0 90-94 36.3156 38.0 38.0 38.0 34.0 38.0 95-99 36.17915000000001 38.0 38.0 38.0 34.0 38.0 100-104 36.096 38.0 38.0 38.0 34.0 38.0 105-109 35.9753 38.0 38.0 38.0 33.6 38.0 110-114 35.90935 38.0 38.0 38.0 33.2 38.0 115-119 35.6502 38.0 37.4 38.0 31.8 38.0 120-124 35.4469 38.0 37.0 38.0 31.0 38.0 125-129 35.19185 38.0 36.6 38.0 29.4 38.0 130-134 34.892799999999994 38.0 36.0 38.0 28.0 38.0 135-139 34.572250000000004 38.0 35.8 38.0 26.6 38.0 140-144 34.16465000000001 38.0 35.0 38.0 24.0 38.0 145-149 33.56965 38.0 35.0 38.0 20.4 38.0 150-151 29.47925 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 5.0 4 2.0 5 1.0 6 1.0 7 3.0 8 2.0 9 0.0 10 4.0 11 1.0 12 4.0 13 5.0 14 5.0 15 4.0 16 4.0 17 3.0 18 3.0 19 3.0 20 3.0 21 12.0 22 7.0 23 8.0 24 11.0 25 12.0 26 25.0 27 24.0 28 25.0 29 33.0 30 54.0 31 52.0 32 66.0 33 84.0 34 125.0 35 194.0 36 541.0 37 2656.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.444222111055524 19.684842421210604 14.832416208104052 27.03851925962982 2 25.407166123778502 26.860435980957153 31.044850914557752 16.68754698070659 3 20.426065162907268 27.844611528822057 32.00501253132832 19.724310776942357 4 24.57988462503135 33.48382242287434 22.071733132681214 19.864559819413092 5 24.604966139954854 34.93855028843742 22.598444946074743 17.85803862553298 6 22.400400902029567 37.65973440240541 22.074668003006764 17.865196692558253 7 19.88977955911824 21.993987975951903 38.602204408817634 19.514028056112224 8 22.194388777555112 24.949899799599198 26.102204408817638 26.753507014028056 9 21.348033074417437 25.156602355299423 29.691806564770733 23.803558005512404 10-14 23.14244200611253 29.144746730798136 25.993286236785412 21.719525026303923 15-19 23.169815102470313 27.904995740842814 28.075362028360978 20.849827128325902 20-24 23.54562308964273 28.265771408528334 27.4941123415343 20.694493160294634 25-29 22.954351856491456 28.932204239114096 27.248584456581646 20.864859447812798 30-34 22.869168712732375 28.270782181690635 27.985168111439595 20.874880994137396 35-39 23.21607536580477 27.55061134495891 27.906394066947282 21.326919222289035 40-44 23.147080932097218 28.48408920070158 27.662240040090204 20.706589827111 45-49 23.387622149837135 27.592082184916062 27.712352793786017 21.307942871460785 50-54 23.558005512402907 27.65722876472062 27.957905286895514 20.826860435980958 55-59 23.62816336757705 27.276371836632425 28.268604359809572 20.826860435980958 60-64 23.660870872375607 27.33376760034073 28.481234654507194 20.524126872776467 65-69 22.992883632354417 27.70873007918212 28.355216999097927 20.94316928936554 70-74 23.48401323042999 27.377969329457752 28.194848150746715 20.94316928936554 75-79 23.32982508895905 27.715130556808496 27.955695885330528 20.999348468901918 80-84 23.38111467522053 27.781676022453887 28.052325581395348 20.78488372093023 85-89 23.597814645882412 27.928424640368902 27.898350959851637 20.57540975389705 90-94 23.914786967418546 27.644110275689222 27.729323308270676 20.711779448621552 95-99 23.448621553884713 27.57894736842105 28.085213032581454 20.887218045112782 100-104 22.980152365677625 27.982157177225343 27.911988773055334 21.1257016840417 105-109 23.795678981402578 27.640483232242218 28.201914882951527 20.361922903403677 110-114 23.4320950518875 28.149596430540935 27.873865744222186 20.544442773349374 115-119 23.916967509025273 27.667468912956277 27.85800240673887 20.557561171279584 120-124 24.059584712609087 27.565452904002406 27.84130805497041 20.5336543284181 125-129 23.700842696629213 27.583266452648473 28.034711075441415 20.6811797752809 130-134 24.3176801123821 27.734296608468796 26.981737908890224 20.96628537025888 135-139 23.96026689409522 27.83324135855115 27.677720363216775 20.52877138413686 140-144 24.130663856691253 28.0947363139144 27.171458678307992 20.60314115108636 145-149 24.73906061822561 27.915495784825374 27.428743476515454 19.91670012043356 150-151 25.849742882227517 26.66499435595134 28.04465069609934 19.44061206572181 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 5.0 1 4.0 2 1.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 0.5 25 1.0 26 1.5 27 5.0 28 7.0 29 6.5 30 10.0 31 13.0 32 18.0 33 29.0 34 38.5 35 57.5 36 72.0 37 96.5 38 140.0 39 183.5 40 203.5 41 228.0 42 256.0 43 266.0 44 285.5 45 303.0 46 294.5 47 258.5 48 226.0 49 193.0 50 165.0 51 142.5 52 116.5 53 91.0 54 69.0 55 54.0 56 43.0 57 29.5 58 20.0 59 15.0 60 14.0 61 12.5 62 7.0 63 5.0 64 4.0 65 2.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.22499999999999998 3 0.25 4 0.325 5 0.325 6 0.22499999999999998 7 0.2 8 0.2 9 0.22499999999999998 10-14 0.20500000000000002 15-19 0.215 20-24 0.215 25-29 0.215 30-34 0.215 35-39 0.22 40-44 0.22499999999999998 45-49 0.22499999999999998 50-54 0.22499999999999998 55-59 0.22499999999999998 60-64 0.215 65-69 0.22999999999999998 70-74 0.22999999999999998 75-79 0.23500000000000001 80-84 0.24 85-89 0.245 90-94 0.25 95-99 0.25 100-104 0.24 105-109 0.255 110-114 0.265 115-119 0.27999999999999997 120-124 0.31 125-129 0.32 130-134 0.33999999999999997 135-139 0.335 140-144 0.35500000000000004 145-149 0.36 150-151 0.3375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.5125000000000002 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 1.95 0.0 0.0 0.0 0.0 126-127 2.1625 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.825 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.525 0.0 0.0 0.0 0.0 136-137 3.9000000000000004 0.0 0.0 0.0 0.0 138-139 4.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTAGAG 10 0.006830828 145.0 6 AGAGTAG 10 0.006830828 145.0 5 GAGAGTA 10 0.006830828 145.0 4 CTTAAAA 10 0.006830828 145.0 1 >>END_MODULE Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788862 spots for SRR7169883.sra Written 788862 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra Read 788857 spots for SRR7169883.sra Written 788857 spots for SRR7169883.sra SRR ids: ['SRR7169883.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8mtqe126 SRR7169883.sra spots: 15777145 blocks: [[1, 788857], [788858, 1577714], [1577715, 2366571], [2366572, 3155428], [3155429, 3944285], [3944286, 4733142], [4733143, 5521999], [5522000, 6310856], [6310857, 7099713], [7099714, 7888570], [7888571, 8677427], [8677428, 9466284], [9466285, 10255141], [10255142, 11043998], [11043999, 11832855], [11832856, 12621712], [12621713, 13410569], [13410570, 14199426], [14199427, 14988283], [14988284, 15777145]] SRR7169883 file size 5324656 SRR7169883 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169883 SRR7169883_1.fastq SRR7169883_2.fastq Input file: SRR7169883_1.fastq Paired file: SRR7169883_2.fastq trimmed: SRR7169883-trimmed-pair1.fastq, SRR7169883-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:02:21 2025 >> started Wed Feb 12 01:02:38 2025 >> done (17.153s) 15777145 read pairs processed; of these: 29120 ( 0.18%) short read pairs filtered out after trimming by size control 54945 ( 0.35%) empty read pairs filtered out after trimming by size control 15693080 (99.47%) read pairs available; of these: 6419516 (40.91%) trimmed read pairs available after processing 9273564 (59.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 2 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 0 0.00% 26 2 0.00% 27 1 0.00% 28 3 0.00% 29 0 0.00% 30 5 0.00% 31 1 0.00% 32 6 0.00% 33 5 0.00% 34 4 0.00% 35 3 0.00% 36 8 0.00% 37 4 0.00% 38 6 0.00% 39 6 0.00% 40 16 0.00% 41 12 0.00% 42 13 0.00% 43 14 0.00% 44 15 0.00% 45 18 0.00% 46 28 0.00% 47 22 0.00% 48 30 0.00% 49 31 0.00% 50 44 0.00% 51 48 0.00% 52 49 0.00% 53 50 0.00% 54 60 0.00% 55 84 0.00% 56 76 0.00% 57 94 0.00% 58 114 0.00% 59 126 0.00% 60 152 0.00% 61 189 0.00% 62 221 0.00% 63 241 0.00% 64 275 0.00% 65 313 0.00% 66 351 0.00% 67 463 0.00% 68 413 0.00% 69 513 0.00% 70 572 0.00% 71 678 0.00% 72 797 0.01% 73 890 0.01% 74 992 0.01% 75 1124 0.01% 76 1347 0.01% 77 1427 0.01% 78 1488 0.01% 79 1641 0.01% 80 1946 0.01% 81 2308 0.01% 82 2493 0.02% 83 3008 0.02% 84 3934 0.03% 85 4519 0.03% 86 4889 0.03% 87 5183 0.03% 88 5459 0.03% 89 5823 0.04% 90 6051 0.04% 91 6496 0.04% 92 7101 0.05% 93 7502 0.05% 94 7963 0.05% 95 8579 0.05% 96 9035 0.06% 97 9317 0.06% 98 9533 0.06% 99 10030 0.06% 100 10647 0.07% 101 10868 0.07% 102 11714 0.07% 103 12699 0.08% 104 13122 0.08% 105 13815 0.09% 106 14479 0.09% 107 14930 0.10% 108 15499 0.10% 109 15626 0.10% 110 16117 0.10% 111 16768 0.11% 112 17811 0.11% 113 18630 0.12% 114 19763 0.13% 115 20656 0.13% 116 21223 0.14% 117 22045 0.14% 118 22694 0.14% 119 23092 0.15% 120 23751 0.15% 121 24581 0.16% 122 25608 0.16% 123 26849 0.17% 124 28205 0.18% 125 29601 0.19% 126 31200 0.20% 127 32047 0.20% 128 32528 0.21% 129 34097 0.22% 130 35360 0.23% 131 37235 0.24% 132 38946 0.25% 133 41177 0.26% 134 43424 0.28% 135 46208 0.29% 136 49064 0.31% 137 51487 0.33% 138 56051 0.36% 139 59491 0.38% 140 64005 0.41% 141 69845 0.45% 142 77481 0.49% 143 86609 0.55% 144 100818 0.64% 145 119887 0.76% 146 150541 0.96% 147 202600 1.29% 148 307256 1.96% 149 658511 4.20% 150 3366595 21.45% 151 9273564 59.09% 15693080 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=43 prefix-density=0.17 prefix-fanout=1.9 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=276.40 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=29.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=36 prefix-density=0.30 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=307.28 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=29.0 sequence=AAGAAGAAGAAG SRR7169883 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:03:20 Started mapping on | Feb 12 01:03:20 Finished on | Feb 12 01:04:59 Mapping speed, Million of reads per hour | 570.66 Number of input reads | 15693080 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14864341 Uniquely mapped reads % | 94.72% Average mapped length | 295.22 Number of splices: Total | 14381156 Number of splices: Annotated (sjdb) | 14147127 Number of splices: GT/AG | 14164552 Number of splices: GC/AG | 176819 Number of splices: AT/AC | 10803 Number of splices: Non-canonical | 28982 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 267191 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 53496 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.18% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 576274 576274 576274 N_multimapping 267191 267191 267191 N_noFeature 330682 14721484 390531 N_ambiguous 147171 948 63528 UnstrandedReadsAssigned:14386488 PositiveStrandReadsAssigned:141909 NegativeStrandReadsAssigned:14410282 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169883 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169883-trimmed-pair1.fastq SRR7169883-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,693,080 reads, 14,307,604 reads pseudoaligned [quant] estimated average fragment length: 259.421 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR7169883.ke.tsv 34699 SRR7169883.se.tsv 87100 total ==> SRR7169883.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.58 264 10.0976 Potri.005G024800.1.v4.1 1035 776.579 43 3.72652 Potri.004G059700.1.v4.1 961 702.585 5 0.478952 Potri.007G009000.2.v4.1 1416 1157.58 0 0 Potri.003G141000.2.v4.1 2943 2684.58 284.035 7.1206 Potri.016G087400.1.v4.1 270 74.0818 1205 1094.7 Potri.015G069301.1.v4.1 564 311.284 0 0 Potri.010G195200.1.v4.1 1773 1514.58 26 1.15532 Potri.012G127500.1.v4.1 977 718.579 7341 687.546 ==> SRR7169883.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1229 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 320 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169883 completed mapping pipeline successfully