Starting /dee2/code/volunteer_pipeline.sh SRR7169884 current disk space = 3051221741568 free memory = 1429613396 SRR7169884 SRAfilesize 9d5731a79aec6dcd4311c2e82dd1a7df SRR7169884.sra SRR7169884.sra file validated SRR7169884 is paired end SRR7169884 is conventional basespace SRR7169884 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169884_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.349 18.0 18.0 18.0 18.0 32.0 2 29.10925 29.0 27.0 31.0 27.0 33.0 3 31.269 31.0 31.0 33.0 29.0 33.0 4 32.4 33.0 33.0 33.0 31.0 33.0 5 32.88325 33.0 33.0 33.0 33.0 34.0 6 36.96175 38.0 37.0 38.0 36.0 38.0 7 37.49025 38.0 38.0 38.0 37.0 38.0 8 37.644 38.0 38.0 38.0 38.0 38.0 9 37.5945 38.0 38.0 38.0 38.0 38.0 10-14 37.646 38.0 38.0 38.0 38.0 38.0 15-19 37.6366 38.0 38.0 38.0 38.0 38.0 20-24 37.6265 38.0 38.0 38.0 38.0 38.0 25-29 37.591300000000004 38.0 38.0 38.0 37.8 38.0 30-34 37.5697 38.0 38.0 38.0 38.0 38.0 35-39 37.34285 38.0 38.0 38.0 37.0 38.0 40-44 37.4762 38.0 38.0 38.0 37.0 38.0 45-49 37.4561 38.0 38.0 38.0 37.0 38.0 50-54 37.30775 38.0 38.0 38.0 36.8 38.0 55-59 37.1283 38.0 38.0 38.0 36.0 38.0 60-64 37.035250000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.982 38.0 38.0 38.0 35.6 38.0 70-74 36.65555 38.0 37.6 38.0 34.4 38.0 75-79 36.4326 38.0 37.6 38.0 33.8 38.0 80-84 36.6576 38.0 37.8 38.0 34.2 38.0 85-89 36.596050000000005 38.0 37.8 38.0 34.2 38.0 90-94 36.49915 38.0 37.8 38.0 34.0 38.0 95-99 36.38395 38.0 37.2 38.0 34.0 38.0 100-104 35.977850000000004 38.0 37.0 38.0 32.0 38.0 105-109 34.733799999999995 38.0 34.8 38.0 25.2 38.0 110-114 34.8481 38.0 35.0 38.0 26.0 38.0 115-119 35.32615 38.0 35.8 38.0 29.2 38.0 120-124 35.19965 38.0 35.6 38.0 28.8 38.0 125-129 34.6207 38.0 34.8 38.0 26.2 38.0 130-134 34.16605 38.0 33.6 38.0 24.0 38.0 135-139 33.234300000000005 37.8 33.0 38.0 19.2 38.0 140-144 32.52005 37.0 31.4 38.0 14.2 38.0 145-149 31.37405 36.2 31.0 38.0 10.8 38.0 150-151 26.356 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 0.0 18 2.0 19 3.0 20 3.0 21 6.0 22 3.0 23 10.0 24 8.0 25 12.0 26 11.0 27 14.0 28 29.0 29 41.0 30 64.0 31 74.0 32 89.0 33 156.0 34 266.0 35 602.0 36 1301.0 37 1301.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.629722291718785 11.733800350262696 14.085564173129846 34.550913184888664 2 21.45 14.975 34.125 29.45 3 18.475 19.175 27.85 34.5 4 22.0 27.450000000000003 24.775 25.775 5 23.25 32.275 23.599999999999998 20.875 6 19.675 35.375 25.224999999999998 19.725 7 14.649999999999999 25.25 42.85 17.25 8 17.299999999999997 26.125 32.625 23.95 9 18.01351013259945 24.243182386790092 34.025519139354515 23.71778834125594 10-14 19.5 30.159999999999997 27.235 23.105 15-19 19.985 29.465000000000003 27.779999999999998 22.770000000000003 20-24 19.67 29.34 27.705000000000002 23.285 25-29 19.38 28.975 28.015 23.630000000000003 30-34 20.064999999999998 28.965000000000003 27.74 23.23 35-39 19.925 28.720000000000002 27.584999999999997 23.77 40-44 19.71 29.285 27.905 23.1 45-49 19.905 29.5 27.284999999999997 23.31 50-54 19.919999999999998 29.080000000000002 27.860000000000003 23.14 55-59 20.369999999999997 28.705000000000002 27.845 23.080000000000002 60-64 19.89 28.754999999999995 27.655 23.7 65-69 19.744999999999997 29.020000000000003 28.000000000000004 23.235 70-74 20.06 28.84 27.505000000000003 23.595 75-79 20.945 29.065 27.58 22.41 80-84 19.93 29.2 27.41 23.46 85-89 20.71 29.03 27.155 23.105 90-94 20.369999999999997 28.935 27.26 23.435 95-99 20.044999999999998 28.65 27.73 23.575 100-104 20.565 28.665000000000003 27.505000000000003 23.265 105-109 20.155 28.825 27.634999999999998 23.385 110-114 19.935 28.705000000000002 27.944999999999997 23.415 115-119 20.01 28.71 27.67 23.61 120-124 20.32101605080254 28.891444572228615 27.521376068803438 23.266163308165407 125-129 20.61370576162587 28.743054512689593 26.845872753666715 23.79736697201782 130-134 20.585 28.925 27.395000000000003 23.095 135-139 20.575 29.015 26.655 23.755000000000003 140-144 20.825 29.104999999999997 26.825 23.244999999999997 145-149 20.8 29.189999999999998 26.87 23.14 150-151 20.875 29.625 26.0375 23.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 3.5 25 3.5 26 5.0 27 8.0 28 9.5 29 13.0 30 18.0 31 28.5 32 36.0 33 41.0 34 57.5 35 75.0 36 93.0 37 109.5 38 133.5 39 178.5 40 209.0 41 226.5 42 266.5 43 286.5 44 269.0 45 267.5 46 276.0 47 270.5 48 239.0 49 198.0 50 159.0 51 116.5 52 95.5 53 84.0 54 66.0 55 39.0 56 25.0 57 26.5 58 19.5 59 15.5 60 11.5 61 4.5 62 2.5 63 3.0 64 2.0 65 0.5 66 1.0 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.075 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.11499999999999999 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.4874999999999998 0.0 0.0 0.0 0.0 102-103 1.7125 0.0 0.0 0.0 0.0 104-105 2.0 0.0 0.0 0.0 0.0 106-107 2.1875 0.0 0.0 0.0 0.0 108-109 2.35 0.0 0.0 0.0 0.0 110-111 2.5625 0.0 0.0 0.0 0.0 112-113 2.8875 0.0 0.0 0.0 0.0 114-115 3.1875 0.0 0.0 0.0 0.0 116-117 3.4375 0.0 0.0 0.0 0.0 118-119 3.825 0.0 0.0 0.0 0.0 120-121 4.137499999999999 0.0 0.0 0.0 0.0 122-123 4.4875 0.0 0.0 0.0 0.0 124-125 4.8375 0.0 0.0 0.0 0.0 126-127 5.2375 0.0 0.0 0.0 0.0 128-129 5.7375 0.0 0.0 0.0 0.0 130-131 6.2375 0.0 0.0 0.0 0.0 132-133 6.675000000000001 0.0 0.0 0.0 0.0 134-135 7.15 0.0 0.0 0.0 0.0 136-137 7.5625 0.0 0.0 0.0 0.0 138-139 8.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGCAGC 10 0.006830828 145.0 9 GCACACG 45 0.008957279 48.333332 145 TTCTCTG 20 0.00593511 29.0 70-74 >>END_MODULE SRR7169884 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169884_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.23275 34.0 33.0 34.0 33.0 34.0 2 33.38425 34.0 33.0 34.0 33.0 34.0 3 33.3805 34.0 33.0 34.0 33.0 34.0 4 33.4085 34.0 33.0 34.0 33.0 34.0 5 33.4485 34.0 33.0 34.0 33.0 34.0 6 37.6335 38.0 38.0 38.0 38.0 38.0 7 37.598 38.0 38.0 38.0 38.0 38.0 8 37.60475 38.0 38.0 38.0 38.0 38.0 9 37.55075 38.0 38.0 38.0 38.0 38.0 10-14 37.5684 38.0 38.0 38.0 38.0 38.0 15-19 37.546499999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.2063 38.0 38.0 38.0 37.2 38.0 25-29 37.376149999999996 38.0 38.0 38.0 37.6 38.0 30-34 37.23135 38.0 38.0 38.0 37.2 38.0 35-39 37.4771 38.0 38.0 38.0 38.0 38.0 40-44 37.4139 38.0 38.0 38.0 37.8 38.0 45-49 37.321450000000006 38.0 38.0 38.0 37.2 38.0 50-54 37.4441 38.0 38.0 38.0 38.0 38.0 55-59 37.470150000000004 38.0 38.0 38.0 38.0 38.0 60-64 37.33325 38.0 38.0 38.0 37.4 38.0 65-69 37.36815 38.0 38.0 38.0 37.4 38.0 70-74 36.5602 38.0 37.8 38.0 33.4 38.0 75-79 36.89475 38.0 38.0 38.0 36.0 38.0 80-84 37.240950000000005 38.0 38.0 38.0 37.0 38.0 85-89 37.1224 38.0 38.0 38.0 36.8 38.0 90-94 37.12185000000001 38.0 38.0 38.0 36.8 38.0 95-99 37.07075 38.0 38.0 38.0 36.4 38.0 100-104 36.914049999999996 38.0 38.0 38.0 36.0 38.0 105-109 36.742599999999996 38.0 38.0 38.0 35.4 38.0 110-114 36.1102 38.0 37.4 38.0 32.2 38.0 115-119 36.59985 38.0 38.0 38.0 34.6 38.0 120-124 36.36675 38.0 38.0 38.0 34.0 38.0 125-129 36.23925 38.0 38.0 38.0 33.8 38.0 130-134 35.960950000000004 38.0 37.6 38.0 32.6 38.0 135-139 35.5898 38.0 36.6 38.0 31.2 38.0 140-144 31.5622 36.6 28.0 38.0 14.8 38.0 145-149 34.141099999999994 38.0 34.8 38.0 26.4 38.0 150-151 29.572625000000002 35.5 27.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 1.0 5 2.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 0.0 15 1.0 16 3.0 17 1.0 18 2.0 19 0.0 20 8.0 21 3.0 22 2.0 23 6.0 24 2.0 25 7.0 26 13.0 27 11.0 28 16.0 29 21.0 30 25.0 31 39.0 32 52.0 33 85.0 34 126.0 35 234.0 36 747.0 37 2584.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.1 20.225 13.275 26.400000000000002 2 26.575 27.625 27.425 18.375 3 20.705176294073517 28.432108027006752 30.682670667666915 20.180045011252815 4 23.48087021755439 33.85846461615404 22.43060765191298 20.230057514378593 5 24.456114028507127 36.209052263065765 21.380345086271568 17.95448862215554 6 20.724999999999998 37.9 23.150000000000002 18.224999999999998 7 20.625 21.5 39.5 18.375 8 22.330582645661416 25.23130782695674 28.107026756689173 24.33108277069267 9 22.3 25.124999999999996 28.849999999999998 23.724999999999998 10-14 22.564999999999998 29.060000000000002 26.68 21.695 15-19 22.3 27.605 28.9 21.195 20-24 23.02 27.139999999999997 28.544999999999998 21.295 25-29 22.53 27.750000000000004 28.645 21.075 30-34 23.075000000000003 27.615000000000002 28.46 20.849999999999998 35-39 22.25 28.125 28.775000000000002 20.849999999999998 40-44 23.215 27.66 28.63 20.495 45-49 22.685 28.4 28.17 20.745 50-54 23.05615280764038 28.286414320716034 27.961398069903492 20.696034801740087 55-59 23.285 28.585 28.09 20.04 60-64 22.869999999999997 28.294999999999998 28.725 20.11 65-69 22.98 28.615000000000002 27.810000000000002 20.595 70-74 22.305 28.63 28.215 20.849999999999998 75-79 23.135 27.83 28.43 20.605 80-84 23.105 28.615000000000002 27.76 20.52 85-89 23.465 28.345 28.18 20.01 90-94 24.295 27.77 27.74 20.195 95-99 23.13 27.589999999999996 28.84 20.44 100-104 23.96 27.975 28.125 19.939999999999998 105-109 23.60854128119218 28.5042756413462 27.809171375706356 20.078011701755262 110-114 23.674999999999997 28.51 27.889999999999997 19.925 115-119 24.2 27.595 28.075 20.13 120-124 24.005000000000003 28.115000000000002 27.805000000000003 20.075000000000003 125-129 24.215 28.37 27.27 20.145 130-134 24.615000000000002 28.9 26.775 19.71 135-139 24.865000000000002 28.435 27.339999999999996 19.36 140-144 24.745 28.07 27.575 19.61 145-149 25.6 28.275 26.939999999999998 19.185 150-151 25.137500000000003 28.125 27.825 18.912499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.0 25 1.5 26 2.0 27 4.5 28 6.5 29 9.0 30 11.5 31 16.0 32 21.0 33 33.0 34 44.0 35 57.0 36 83.0 37 121.5 38 153.0 39 181.0 40 220.5 41 246.5 42 263.0 43 276.0 44 295.0 45 297.5 46 283.0 47 268.5 48 238.0 49 208.0 50 166.0 51 120.5 52 107.5 53 82.0 54 48.0 55 33.0 56 26.0 57 24.0 58 17.0 59 8.5 60 6.0 61 4.0 62 3.0 63 2.5 64 0.5 65 1.5 66 1.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.025 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.015 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5534591194968553 1.0999999999999999 3 0.0 0.0 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.55 0.0 0.0 0.0 0.0 102-103 1.775 0.0 0.0 0.0 0.0 104-105 2.0625 0.0 0.0 0.0 0.0 106-107 2.225 0.0 0.0 0.0 0.0 108-109 2.375 0.0 0.0 0.0 0.0 110-111 2.6125 0.0 0.0 0.0 0.0 112-113 2.9125 0.0 0.0 0.0 0.0 114-115 3.25 0.0 0.0 0.0 0.0 116-117 3.5125 0.0 0.0 0.0 0.0 118-119 3.9375 0.0 0.0 0.0 0.0 120-121 4.275 0.0 0.0 0.0 0.0 122-123 4.6375 0.0 0.0 0.0 0.0 124-125 4.9875 0.0 0.0 0.0 0.0 126-127 5.3875 0.0 0.0 0.0 0.0 128-129 5.875 0.0 0.0 0.0 0.0 130-131 6.35 0.0 0.0 0.0 0.0 132-133 6.725 0.0 0.0 0.0 0.0 134-135 7.175000000000001 0.0 0.0 0.0 0.0 136-137 7.5375 0.0 0.0 0.0 0.0 138-139 7.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAAAC 10 0.006830828 145.0 2 >>END_MODULE Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639551 spots for SRR7169884.sra Written 639551 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra Read 639534 spots for SRR7169884.sra Written 639534 spots for SRR7169884.sra SRR ids: ['SRR7169884.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p7gjhn91 SRR7169884.sra spots: 12790697 blocks: [[1, 639534], [639535, 1279068], [1279069, 1918602], [1918603, 2558136], [2558137, 3197670], [3197671, 3837204], [3837205, 4476738], [4476739, 5116272], [5116273, 5755806], [5755807, 6395340], [6395341, 7034874], [7034875, 7674408], [7674409, 8313942], [8313943, 8953476], [8953477, 9593010], [9593011, 10232544], [10232545, 10872078], [10872079, 11511612], [11511613, 12151146], [12151147, 12790697]] SRR7169884 file size 4312647 SRR7169884 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169884 SRR7169884_1.fastq SRR7169884_2.fastq Input file: SRR7169884_1.fastq Paired file: SRR7169884_2.fastq trimmed: SRR7169884-trimmed-pair1.fastq, SRR7169884-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:08:41 2025 >> started Wed Feb 12 01:08:56 2025 >> done (15.338s) 12790697 read pairs processed; of these: 9928 ( 0.08%) short read pairs filtered out after trimming by size control 9520 ( 0.07%) empty read pairs filtered out after trimming by size control 12771249 (99.85%) read pairs available; of these: 6212856 (48.65%) trimmed read pairs available after processing 6558393 (51.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 4 0.00% 21 4 0.00% 22 1 0.00% 23 5 0.00% 24 3 0.00% 25 5 0.00% 26 7 0.00% 27 6 0.00% 28 10 0.00% 29 5 0.00% 30 7 0.00% 31 9 0.00% 32 7 0.00% 33 6 0.00% 34 6 0.00% 35 11 0.00% 36 11 0.00% 37 11 0.00% 38 15 0.00% 39 18 0.00% 40 12 0.00% 41 15 0.00% 42 25 0.00% 43 27 0.00% 44 18 0.00% 45 28 0.00% 46 27 0.00% 47 31 0.00% 48 53 0.00% 49 41 0.00% 50 41 0.00% 51 78 0.00% 52 89 0.00% 53 72 0.00% 54 102 0.00% 55 133 0.00% 56 115 0.00% 57 160 0.00% 58 183 0.00% 59 219 0.00% 60 252 0.00% 61 263 0.00% 62 318 0.00% 63 383 0.00% 64 454 0.00% 65 500 0.00% 66 519 0.00% 67 596 0.00% 68 692 0.01% 69 799 0.01% 70 924 0.01% 71 1133 0.01% 72 1274 0.01% 73 1449 0.01% 74 1708 0.01% 75 1852 0.01% 76 2012 0.02% 77 2177 0.02% 78 2412 0.02% 79 2682 0.02% 80 3033 0.02% 81 3431 0.03% 82 3854 0.03% 83 4352 0.03% 84 5232 0.04% 85 5654 0.04% 86 6082 0.05% 87 6445 0.05% 88 6953 0.05% 89 7343 0.06% 90 7878 0.06% 91 8468 0.07% 92 9104 0.07% 93 9722 0.08% 94 10372 0.08% 95 10986 0.09% 96 11417 0.09% 97 12134 0.10% 98 12157 0.10% 99 12793 0.10% 100 13612 0.11% 101 14100 0.11% 102 14942 0.12% 103 15818 0.12% 104 16452 0.13% 105 17318 0.14% 106 17867 0.14% 107 18159 0.14% 108 18816 0.15% 109 19300 0.15% 110 19394 0.15% 111 20040 0.16% 112 21322 0.17% 113 21687 0.17% 114 22883 0.18% 115 23716 0.19% 116 24523 0.19% 117 24806 0.19% 118 25260 0.20% 119 25786 0.20% 120 25959 0.20% 121 27027 0.21% 122 28025 0.22% 123 28846 0.23% 124 30164 0.24% 125 31357 0.25% 126 32673 0.26% 127 33186 0.26% 128 33510 0.26% 129 34770 0.27% 130 35479 0.28% 131 36162 0.28% 132 37509 0.29% 133 39991 0.31% 134 41672 0.33% 135 43762 0.34% 136 46191 0.36% 137 48852 0.38% 138 51901 0.41% 139 54827 0.43% 140 59276 0.46% 141 64896 0.51% 142 73777 0.58% 143 88108 0.69% 144 97059 0.76% 145 121389 0.95% 146 147589 1.16% 147 201959 1.58% 148 326425 2.56% 149 661541 5.18% 150 3051739 23.90% 151 6558393 51.35% 12771249 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=35 prefix-density=0.17 prefix-fanout=2.3 sequence=GAGGAAAGCATGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=286.48 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=29 prefix-density=0.34 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.12 sequence-density-rank=15 fanout-score=55.22 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=14.4 sequence=TGTTGGTGGTGG SRR7169884 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:09:41 Started mapping on | Feb 12 01:09:41 Finished on | Feb 12 01:10:55 Mapping speed, Million of reads per hour | 621.30 Number of input reads | 12771249 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12209661 Uniquely mapped reads % | 95.60% Average mapped length | 293.04 Number of splices: Total | 11531375 Number of splices: Annotated (sjdb) | 11347484 Number of splices: GT/AG | 11363305 Number of splices: GC/AG | 134428 Number of splices: AT/AC | 9532 Number of splices: Non-canonical | 24110 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 212815 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 26439 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 356837 356837 356837 N_multimapping 212815 212815 212815 N_noFeature 299985 12076725 356540 N_ambiguous 124953 685 48092 UnstrandedReadsAssigned:11784723 PositiveStrandReadsAssigned:132251 NegativeStrandReadsAssigned:11805029 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169884 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169884-trimmed-pair1.fastq SRR7169884-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,771,249 reads, 11,735,267 reads pseudoaligned [quant] estimated average fragment length: 235.978 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52401 SRR7169884.ke.tsv 34699 SRR7169884.se.tsv 87100 total ==> SRR7169884.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.02 253 13.0273 Potri.005G024800.1.v4.1 1035 800.022 31 3.55753 Potri.004G059700.1.v4.1 961 726.04 0 0 Potri.007G009000.2.v4.1 1416 1181.02 0 0 Potri.003G141000.2.v4.1 2943 2708.02 237.071 8.0374 Potri.016G087400.1.v4.1 270 83.0478 842.226 931.086 Potri.015G069301.1.v4.1 564 332.705 0 0 Potri.010G195200.1.v4.1 1773 1538.02 16 0.955096 Potri.012G127500.1.v4.1 977 742.028 3777 467.322 ==> SRR7169884.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1253 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 222 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169884 completed mapping pipeline successfully