Starting /dee2/code/volunteer_pipeline.sh SRR7169885 current disk space = 3051241283584 free memory = 1497271396 SRR7169885 SRAfilesize 2a087cf0fb35ba6085ff5e617c51c91a SRR7169885.sra SRR7169885.sra file validated SRR7169885 is paired end SRR7169885 is conventional basespace SRR7169885 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169885_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.0055 18.0 18.0 18.0 18.0 32.0 2 26.56825 27.0 27.0 27.0 25.0 30.0 3 27.9655 29.0 27.0 30.0 25.0 33.0 4 30.9725 31.0 30.0 33.0 29.0 33.0 5 31.977 33.0 32.0 33.0 31.0 33.0 6 36.40725 37.0 36.0 38.0 34.0 38.0 7 37.2705 38.0 38.0 38.0 36.0 38.0 8 37.40175 38.0 38.0 38.0 36.0 38.0 9 37.503 38.0 38.0 38.0 37.0 38.0 10-14 37.4156 38.0 38.0 38.0 36.8 38.0 15-19 37.1868 38.0 38.0 38.0 36.0 38.0 20-24 37.6465 38.0 38.0 38.0 37.8 38.0 25-29 37.6697 38.0 38.0 38.0 38.0 38.0 30-34 37.4692 38.0 38.0 38.0 37.4 38.0 35-39 37.560900000000004 38.0 38.0 38.0 37.6 38.0 40-44 37.4346 38.0 38.0 38.0 37.2 38.0 45-49 37.326100000000004 38.0 38.0 38.0 36.8 38.0 50-54 37.165350000000004 38.0 38.0 38.0 36.4 38.0 55-59 36.9094 38.0 38.0 38.0 35.4 38.0 60-64 37.08245 38.0 38.0 38.0 35.6 38.0 65-69 37.196799999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.8818 38.0 37.8 38.0 35.0 38.0 75-79 37.0008 38.0 38.0 38.0 35.6 38.0 80-84 36.9459 38.0 38.0 38.0 35.4 38.0 85-89 36.904900000000005 38.0 38.0 38.0 35.2 38.0 90-94 36.65945000000001 38.0 38.0 38.0 34.2 38.0 95-99 36.4433 38.0 37.2 38.0 34.0 38.0 100-104 36.36445 38.0 37.0 38.0 33.8 38.0 105-109 35.504949999999994 38.0 36.0 38.0 30.0 38.0 110-114 35.92995 38.0 36.6 38.0 32.6 38.0 115-119 35.7461 38.0 36.0 38.0 31.4 38.0 120-124 35.66455 38.0 36.0 38.0 31.2 38.0 125-129 35.2175 38.0 35.4 38.0 29.2 38.0 130-134 34.6343 38.0 35.0 38.0 27.2 38.0 135-139 34.37485 38.0 34.6 38.0 25.2 38.0 140-144 33.239549999999994 37.6 33.0 38.0 20.4 38.0 145-149 32.2769 36.2 31.4 38.0 14.0 38.0 150-151 27.9465 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 1.0 17 1.0 18 1.0 19 1.0 20 3.0 21 1.0 22 1.0 23 4.0 24 7.0 25 10.0 26 14.0 27 12.0 28 14.0 29 27.0 30 34.0 31 47.0 32 83.0 33 133.0 34 272.0 35 587.0 36 1473.0 37 1272.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.2 38.45 9.049999999999999 31.3 2 22.6 15.4 31.7 30.3 3 20.525 22.275 25.974999999999998 31.225 4 22.6 28.999999999999996 22.775000000000002 25.624999999999996 5 23.05 34.4 22.675 19.875 6 19.2 37.225 24.425 19.15 7 15.45 27.474999999999998 40.525 16.55 8 17.95 25.324999999999996 30.9 25.825 9 17.75 25.374999999999996 33.45 23.425 10-14 19.645000000000003 30.564999999999998 26.945000000000004 22.845 15-19 19.695 29.595 27.355 23.355 20-24 19.545 30.005 27.334999999999997 23.115 25-29 19.665 30.36 26.584999999999997 23.39 30-34 19.67 29.84 27.255000000000003 23.235 35-39 19.52 30.085 27.0 23.395 40-44 19.775000000000002 29.37 27.24 23.615 45-49 19.855 29.39 27.205000000000002 23.549999999999997 50-54 19.485 29.220000000000002 27.79 23.505000000000003 55-59 19.89 29.805 26.919999999999998 23.385 60-64 19.525000000000002 29.18 27.47 23.825 65-69 19.685 29.310000000000002 27.48 23.525 70-74 20.365 29.220000000000002 26.93 23.485 75-79 20.26 28.7 27.625 23.415 80-84 20.525 28.939999999999998 26.75 23.785 85-89 20.4 29.585 26.640000000000004 23.375 90-94 20.369999999999997 28.804999999999996 27.67 23.155 95-99 20.0 28.945 27.534999999999997 23.52 100-104 19.955000000000002 29.020000000000003 27.529999999999998 23.494999999999997 105-109 20.5 28.53 27.01 23.96 110-114 20.325 28.955 27.255000000000003 23.465 115-119 20.65 28.93 27.589999999999996 22.830000000000002 120-124 20.549999999999997 28.82 27.245 23.385 125-129 20.830000000000002 29.2 26.465 23.505000000000003 130-134 20.86 27.965 27.74 23.435 135-139 21.099999999999998 28.694999999999997 26.784999999999997 23.419999999999998 140-144 20.65 28.63 27.075 23.645 145-149 20.915 28.28 27.045 23.76 150-151 20.7375 28.025 26.4125 24.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.5 23 3.0 24 4.0 25 3.0 26 5.5 27 8.5 28 12.5 29 17.0 30 21.0 31 33.0 32 46.0 33 55.5 34 66.0 35 85.0 36 118.0 37 135.0 38 146.5 39 162.0 40 193.5 41 223.5 42 236.5 43 266.5 44 279.5 45 264.0 46 248.0 47 226.5 48 208.5 49 190.0 50 163.5 51 133.5 52 104.5 53 95.5 54 70.0 55 41.5 56 32.5 57 21.0 58 20.0 59 18.0 60 8.5 61 6.0 62 5.0 63 3.0 64 2.5 65 3.5 66 3.0 67 1.5 68 0.5 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.175 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.6124999999999998 0.0 0.0 0.0 0.0 118-119 1.775 0.0 0.0 0.0 0.0 120-121 1.875 0.0 0.0 0.0 0.0 122-123 2.075 0.0 0.0 0.0 0.0 124-125 2.325 0.0 0.0 0.0 0.0 126-127 2.625 0.0 0.0 0.0 0.0 128-129 2.8375 0.0 0.0 0.0 0.0 130-131 3.1375 0.0 0.0 0.0 0.0 132-133 3.4125 0.0 0.0 0.0 0.0 134-135 3.625 0.0 0.0 0.0 0.0 136-137 3.9625 0.0 0.0 0.0 0.0 138-139 4.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169885 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169885_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.29525 34.0 33.0 34.0 33.0 34.0 2 33.35 34.0 33.0 34.0 33.0 34.0 3 33.3435 34.0 33.0 34.0 33.0 34.0 4 33.29875 34.0 33.0 34.0 33.0 34.0 5 33.28825 34.0 33.0 34.0 33.0 34.0 6 37.466 38.0 38.0 38.0 38.0 38.0 7 37.43725 38.0 38.0 38.0 38.0 38.0 8 37.50525 38.0 38.0 38.0 38.0 38.0 9 36.958 38.0 38.0 38.0 36.0 38.0 10-14 37.38680000000001 38.0 38.0 38.0 37.8 38.0 15-19 37.38325 38.0 38.0 38.0 38.0 38.0 20-24 37.2827 38.0 38.0 38.0 37.6 38.0 25-29 37.07215 38.0 38.0 38.0 36.8 38.0 30-34 37.341300000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.167249999999996 38.0 38.0 38.0 37.2 38.0 40-44 37.24465 38.0 38.0 38.0 37.4 38.0 45-49 37.1933 38.0 38.0 38.0 37.6 38.0 50-54 36.793699999999994 38.0 38.0 38.0 35.4 38.0 55-59 37.214850000000006 38.0 38.0 38.0 37.2 38.0 60-64 37.195750000000004 38.0 38.0 38.0 37.0 38.0 65-69 36.89489999999999 38.0 38.0 38.0 35.8 38.0 70-74 36.295950000000005 38.0 37.8 38.0 32.8 38.0 75-79 36.76025 38.0 38.0 38.0 35.8 38.0 80-84 36.25285 38.0 37.8 38.0 33.6 38.0 85-89 36.83505 38.0 38.0 38.0 36.0 38.0 90-94 36.89444999999999 38.0 38.0 38.0 36.0 38.0 95-99 36.8666 38.0 38.0 38.0 36.0 38.0 100-104 36.48485 38.0 38.0 38.0 34.8 38.0 105-109 36.46585 38.0 38.0 38.0 34.6 38.0 110-114 36.509299999999996 38.0 38.0 38.0 34.6 38.0 115-119 36.29385 38.0 38.0 38.0 34.2 38.0 120-124 36.00485 38.0 37.8 38.0 33.2 38.0 125-129 35.999399999999994 38.0 38.0 38.0 33.4 38.0 130-134 35.83135 38.0 37.4 38.0 33.2 38.0 135-139 35.3981 38.0 36.2 38.0 31.4 38.0 140-144 35.07190000000001 38.0 36.0 38.0 31.0 38.0 145-149 34.6835 38.0 36.0 38.0 29.8 38.0 150-151 30.178125 35.5 28.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 2.0 5 2.0 6 1.0 7 2.0 8 0.0 9 2.0 10 3.0 11 1.0 12 3.0 13 0.0 14 3.0 15 3.0 16 2.0 17 2.0 18 4.0 19 3.0 20 1.0 21 6.0 22 5.0 23 6.0 24 8.0 25 6.0 26 17.0 27 13.0 28 16.0 29 13.0 30 36.0 31 28.0 32 51.0 33 59.0 34 116.0 35 248.0 36 578.0 37 2749.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.75 20.9 13.700000000000001 22.650000000000002 2 27.500000000000004 26.474999999999998 27.525 18.5 3 21.3 29.325000000000003 30.55 18.825 4 23.95 33.225 24.0 18.825 5 25.3 35.5 20.925 18.275 6 21.9 36.225 23.599999999999998 18.275 7 21.075 20.75 38.0 20.175 8 21.65 24.975 27.800000000000004 25.575 9 22.625 25.525 28.749999999999996 23.1 10-14 23.655 28.765 26.35 21.23 15-19 23.655 28.62 27.134999999999998 20.59 20-24 23.465 28.115000000000002 27.229999999999997 21.19 25-29 23.375 28.08 27.21 21.335 30-34 23.235 28.060000000000002 27.810000000000002 20.895 35-39 23.51 28.02 27.644999999999996 20.825 40-44 23.380000000000003 27.915 28.17 20.535 45-49 22.945 27.925 27.57 21.560000000000002 50-54 24.0 27.529999999999998 28.060000000000002 20.41 55-59 23.91 27.715 27.765 20.61 60-64 23.055 27.505000000000003 28.325 21.115000000000002 65-69 23.119999999999997 27.889999999999997 27.85 21.14 70-74 23.830000000000002 27.42 27.68 21.07 75-79 23.995 27.22 28.235 20.549999999999997 80-84 23.115 27.529999999999998 28.285 21.07 85-89 23.849999999999998 27.779999999999998 27.555000000000003 20.815 90-94 23.73 27.88 28.27 20.119999999999997 95-99 23.54 27.98 27.955000000000002 20.525 100-104 23.875 27.794999999999998 27.51 20.82 105-109 23.575 27.534999999999997 28.215 20.674999999999997 110-114 23.115 28.43 27.195000000000004 21.26 115-119 23.93 28.09 27.47 20.51 120-124 23.674999999999997 27.43 27.839999999999996 21.055 125-129 24.060000000000002 27.365000000000002 28.12 20.455000000000002 130-134 24.099999999999998 27.915 28.050000000000004 19.935 135-139 24.224999999999998 27.725 27.639999999999997 20.41 140-144 24.55 27.834999999999997 27.455000000000002 20.16 145-149 24.099999999999998 27.834999999999997 27.68 20.385 150-151 24.4125 27.650000000000002 27.1625 20.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 1.5 25 2.0 26 3.5 27 4.0 28 4.0 29 7.0 30 9.0 31 8.5 32 14.5 33 27.5 34 41.0 35 51.5 36 66.5 37 92.5 38 131.5 39 172.0 40 187.0 41 198.0 42 231.0 43 289.5 44 313.0 45 296.5 46 288.0 47 275.0 48 242.0 49 209.0 50 188.5 51 165.5 52 132.0 53 95.0 54 68.0 55 50.0 56 35.0 57 24.5 58 21.5 59 12.5 60 7.0 61 7.5 62 7.0 63 4.5 64 2.5 65 2.5 66 1.0 67 1.0 68 2.0 69 1.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.2 0.0 0.0 0.0 0.0 114-115 1.4874999999999998 0.0 0.0 0.0 0.0 116-117 1.6375000000000002 0.0 0.0 0.0 0.0 118-119 1.7999999999999998 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.0625 0.0 0.0 0.0 0.0 124-125 2.3125 0.0 0.0 0.0 0.0 126-127 2.625 0.0 0.0 0.0 0.0 128-129 2.8375 0.0 0.0 0.0 0.0 130-131 3.1375 0.0 0.0 0.0 0.0 132-133 3.4125 0.0 0.0 0.0 0.0 134-135 3.625 0.0 0.0 0.0 0.0 136-137 3.95 0.0 0.0 0.0 0.0 138-139 4.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563320 spots for SRR7169885.sra Written 563320 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra Read 563318 spots for SRR7169885.sra Written 563318 spots for SRR7169885.sra SRR ids: ['SRR7169885.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nrrc97i_ SRR7169885.sra spots: 11266362 blocks: [[1, 563318], [563319, 1126636], [1126637, 1689954], [1689955, 2253272], [2253273, 2816590], [2816591, 3379908], [3379909, 3943226], [3943227, 4506544], [4506545, 5069862], [5069863, 5633180], [5633181, 6196498], [6196499, 6759816], [6759817, 7323134], [7323135, 7886452], [7886453, 8449770], [8449771, 9013088], [9013089, 9576406], [9576407, 10139724], [10139725, 10703042], [10703043, 11266362]] SRR7169885 file size 3796100 SRR7169885 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169885 SRR7169885_1.fastq SRR7169885_2.fastq Input file: SRR7169885_1.fastq Paired file: SRR7169885_2.fastq trimmed: SRR7169885-trimmed-pair1.fastq, SRR7169885-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:00:26 2025 >> started Wed Feb 12 01:00:45 2025 >> done (18.362s) 11266362 read pairs processed; of these: 13515 ( 0.12%) short read pairs filtered out after trimming by size control 17648 ( 0.16%) empty read pairs filtered out after trimming by size control 11235199 (99.72%) read pairs available; of these: 5079432 (45.21%) trimmed read pairs available after processing 6155767 (54.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 3 0.00% 21 2 0.00% 22 4 0.00% 23 4 0.00% 24 1 0.00% 25 3 0.00% 26 2 0.00% 27 4 0.00% 28 2 0.00% 29 2 0.00% 30 3 0.00% 31 4 0.00% 32 2 0.00% 33 3 0.00% 34 2 0.00% 35 7 0.00% 36 3 0.00% 37 7 0.00% 38 4 0.00% 39 7 0.00% 40 5 0.00% 41 8 0.00% 42 5 0.00% 43 7 0.00% 44 14 0.00% 45 12 0.00% 46 10 0.00% 47 14 0.00% 48 16 0.00% 49 19 0.00% 50 17 0.00% 51 18 0.00% 52 28 0.00% 53 31 0.00% 54 27 0.00% 55 37 0.00% 56 44 0.00% 57 51 0.00% 58 53 0.00% 59 88 0.00% 60 79 0.00% 61 94 0.00% 62 120 0.00% 63 116 0.00% 64 128 0.00% 65 135 0.00% 66 151 0.00% 67 168 0.00% 68 210 0.00% 69 210 0.00% 70 258 0.00% 71 297 0.00% 72 384 0.00% 73 437 0.00% 74 503 0.00% 75 514 0.00% 76 668 0.01% 77 752 0.01% 78 750 0.01% 79 777 0.01% 80 926 0.01% 81 1011 0.01% 82 1204 0.01% 83 1366 0.01% 84 2022 0.02% 85 2476 0.02% 86 2486 0.02% 87 2798 0.02% 88 3087 0.03% 89 3160 0.03% 90 3318 0.03% 91 3502 0.03% 92 3688 0.03% 93 3933 0.04% 94 4246 0.04% 95 4450 0.04% 96 4679 0.04% 97 4877 0.04% 98 5039 0.04% 99 5292 0.05% 100 5573 0.05% 101 5978 0.05% 102 6416 0.06% 103 6907 0.06% 104 7395 0.07% 105 7556 0.07% 106 7971 0.07% 107 8370 0.07% 108 8703 0.08% 109 9159 0.08% 110 9658 0.09% 111 9850 0.09% 112 10352 0.09% 113 11243 0.10% 114 11837 0.11% 115 12571 0.11% 116 13018 0.12% 117 13526 0.12% 118 14023 0.12% 119 14112 0.13% 120 14854 0.13% 121 15191 0.14% 122 16129 0.14% 123 16970 0.15% 124 18140 0.16% 125 19355 0.17% 126 20483 0.18% 127 20933 0.19% 128 22002 0.20% 129 22672 0.20% 130 23682 0.21% 131 24839 0.22% 132 26043 0.23% 133 27768 0.25% 134 29320 0.26% 135 31825 0.28% 136 34023 0.30% 137 36233 0.32% 138 39170 0.35% 139 41863 0.37% 140 45734 0.41% 141 50543 0.45% 142 56003 0.50% 143 65085 0.58% 144 78789 0.70% 145 99644 0.89% 146 126935 1.13% 147 174843 1.56% 148 273534 2.43% 149 558690 4.97% 150 2783031 24.77% 151 6155767 54.79% 11235199 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=38 prefix-density=0.24 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=32 fanout-score=41.48 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=8.8 sequence=CAAAGATCATGCCACCAAAAGCCCAAGCAATGCCTTGAATACCAACAGTGGAACATT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=6.05 fanout-score-rank=19 prefix-density=0.33 prefix-fanout=4.3 sequence=CAGTTTGTTGACTGGTGCCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=162.84 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=15.6 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTTCTCGAGAAGATCAAGGAGA SRR7169885 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:01:32 Started mapping on | Feb 12 01:01:32 Finished on | Feb 12 01:02:52 Mapping speed, Million of reads per hour | 505.58 Number of input reads | 11235199 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10521548 Uniquely mapped reads % | 93.65% Average mapped length | 295.74 Number of splices: Total | 9618046 Number of splices: Annotated (sjdb) | 9458935 Number of splices: GT/AG | 9479406 Number of splices: GC/AG | 109150 Number of splices: AT/AC | 7822 Number of splices: Non-canonical | 21668 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 186493 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 14176 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.53% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 539306 539306 539306 N_multimapping 186493 186493 186493 N_noFeature 204350 10394199 250005 N_ambiguous 123803 490 41805 UnstrandedReadsAssigned:10193395 PositiveStrandReadsAssigned:126859 NegativeStrandReadsAssigned:10229738 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169885 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169885-trimmed-pair1.fastq SRR7169885-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,235,199 reads, 10,145,202 reads pseudoaligned [quant] estimated average fragment length: 249.597 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR7169885.ke.tsv 34699 SRR7169885.se.tsv 87100 total ==> SRR7169885.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.4 165 7.77899 Potri.005G024800.1.v4.1 1035 786.403 39 4.137 Potri.004G059700.1.v4.1 961 712.409 1 0.117095 Potri.007G009000.2.v4.1 1416 1167.4 0 0 Potri.003G141000.2.v4.1 2943 2694.4 174 5.38707 Potri.016G087400.1.v4.1 270 73.6933 1220 1381.01 Potri.015G069301.1.v4.1 564 319.328 0 0 Potri.010G195200.1.v4.1 1773 1524.4 6 0.328335 Potri.012G127500.1.v4.1 977 728.403 3852 441.144 ==> SRR7169885.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 436 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 152 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169885 completed mapping pipeline successfully