Starting /dee2/code/volunteer_pipeline.sh SRR7169886 current disk space = 3051315331072 free memory = 1518391088 SRR7169886 SRAfilesize 0c34f89daab6f390809cd885dc164dcd SRR7169886.sra SRR7169886.sra file validated SRR7169886 is paired end SRR7169886 is conventional basespace SRR7169886 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169886_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.48675 30.0 18.0 33.0 18.0 33.0 2 27.5055 29.0 25.0 31.0 18.0 33.0 3 30.32025 31.0 29.0 33.0 27.0 33.0 4 32.192 33.0 33.0 33.0 31.0 33.0 5 32.66175 33.0 33.0 33.0 32.0 34.0 6 36.598 38.0 37.0 38.0 34.0 38.0 7 37.061 38.0 38.0 38.0 35.0 38.0 8 37.46025 38.0 38.0 38.0 37.0 38.0 9 37.62475 38.0 38.0 38.0 38.0 38.0 10-14 37.613 38.0 38.0 38.0 37.8 38.0 15-19 37.607549999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.51105 38.0 38.0 38.0 37.4 38.0 25-29 37.628949999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.573499999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.510949999999994 38.0 38.0 38.0 37.8 38.0 40-44 37.55905 38.0 38.0 38.0 38.0 38.0 45-49 37.546299999999995 38.0 38.0 38.0 38.0 38.0 50-54 37.51685 38.0 38.0 38.0 38.0 38.0 55-59 37.37815 38.0 38.0 38.0 37.0 38.0 60-64 37.36364999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.28465 38.0 38.0 38.0 37.0 38.0 70-74 37.2858 38.0 38.0 38.0 37.0 38.0 75-79 37.20989999999999 38.0 38.0 38.0 36.6 38.0 80-84 36.9461 38.0 38.0 38.0 35.6 38.0 85-89 36.9539 38.0 38.0 38.0 36.0 38.0 90-94 36.66465 38.0 37.8 38.0 34.4 38.0 95-99 36.812349999999995 38.0 38.0 38.0 35.4 38.0 100-104 36.59425 38.0 38.0 38.0 34.2 38.0 105-109 35.8077 38.0 36.6 38.0 30.8 38.0 110-114 35.76855 38.0 36.2 38.0 31.6 38.0 115-119 35.0665 38.0 34.8 38.0 28.4 38.0 120-124 35.895199999999996 38.0 36.8 38.0 32.2 38.0 125-129 34.91325 38.0 35.6 38.0 27.0 38.0 130-134 35.274 38.0 35.8 38.0 29.4 38.0 135-139 35.40745 38.0 36.0 38.0 30.4 38.0 140-144 34.5847 38.0 35.0 38.0 26.8 38.0 145-149 32.65725 37.6 32.4 38.0 17.0 38.0 150-151 28.328375 35.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 3.0 16 2.0 17 1.0 18 4.0 19 2.0 20 2.0 21 0.0 22 6.0 23 3.0 24 8.0 25 14.0 26 5.0 27 12.0 28 14.0 29 31.0 30 40.0 31 39.0 32 69.0 33 107.0 34 172.0 35 357.0 36 1097.0 37 2009.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.775 11.625 8.875 36.725 2 19.173967459324157 14.292866082603254 34.618272841051315 31.914893617021278 3 18.475 20.7 27.125 33.7 4 21.5 30.25 22.85 25.4 5 21.675 31.8 24.625 21.9 6 19.025 36.625 25.124999999999996 19.225 7 14.224999999999998 27.35 40.925 17.5 8 16.875 25.825 30.275000000000002 27.025 9 17.05 26.0 33.575 23.375 10-14 19.744999999999997 29.755 27.439999999999998 23.06 15-19 19.2 29.07 28.110000000000003 23.62 20-24 19.705000000000002 29.270000000000003 28.415000000000003 22.61 25-29 19.6 29.62 27.615000000000002 23.165 30-34 19.99 29.25 27.515 23.244999999999997 35-39 19.865 28.775000000000002 27.644999999999996 23.715 40-44 19.545 29.459999999999997 27.37 23.625 45-49 19.625 29.294999999999998 27.515 23.565 50-54 19.74 28.87 27.76 23.630000000000003 55-59 19.46 28.884999999999998 27.310000000000002 24.345 60-64 19.27 28.95 27.529999999999998 24.25 65-69 19.845 28.799999999999997 27.77 23.585 70-74 19.91 28.68 27.455000000000002 23.955000000000002 75-79 20.005 28.68 27.46 23.855 80-84 19.875 28.749999999999996 27.27 24.104999999999997 85-89 20.135 28.660000000000004 27.794999999999998 23.41 90-94 20.3 29.075 26.375 24.25 95-99 20.830000000000002 28.42 27.615000000000002 23.135 100-104 20.325 28.37 27.560000000000002 23.745 105-109 20.23 28.355000000000004 27.655 23.76 110-114 20.52 28.96 26.985 23.535 115-119 20.923015316848534 28.666533186505156 26.394033436780457 24.016418059865853 120-124 20.78 28.33 27.384999999999998 23.505000000000003 125-129 20.485 28.384999999999998 27.57 23.56 130-134 21.195 28.205000000000002 26.915 23.685000000000002 135-139 20.91 28.194999999999997 27.46 23.435 140-144 20.985 27.72 27.16 24.135 145-149 20.525 28.65 27.11 23.715 150-151 20.075000000000003 28.725 27.325 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 2.0 22 0.5 23 0.5 24 1.0 25 3.5 26 5.0 27 9.5 28 14.0 29 17.0 30 25.0 31 33.0 32 39.0 33 45.0 34 54.0 35 61.0 36 80.0 37 120.5 38 147.5 39 168.5 40 202.0 41 222.0 42 236.0 43 262.5 44 268.0 45 261.5 46 273.0 47 266.0 48 225.0 49 187.0 50 174.0 51 146.5 52 111.0 53 82.5 54 65.5 55 53.0 56 31.5 57 24.5 58 19.0 59 12.5 60 15.0 61 11.5 62 5.0 63 3.5 64 3.5 65 3.0 66 1.5 67 2.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.11 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.7875000000000001 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 0.9874999999999999 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.9500000000000002 0.0 0.0 0.0 0.0 112-113 2.1875 0.0 0.0 0.0 0.0 114-115 2.3375 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.375 0.0 0.0 0.0 0.0 122-123 3.5375 0.0 0.0 0.0 0.0 124-125 3.8 0.0 0.0 0.0 0.0 126-127 4.199999999999999 0.0 0.0 0.0 0.0 128-129 4.575 0.0 0.0 0.0 0.0 130-131 4.887499999999999 0.0 0.0 0.0 0.0 132-133 5.2 0.0 0.0 0.0 0.0 134-135 5.4625 0.0 0.0 0.0 0.0 136-137 5.8375 0.0 0.0 0.0 0.0 138-139 6.324999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169886 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169886_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.24625 34.0 33.0 34.0 33.0 34.0 2 33.33925 34.0 33.0 34.0 33.0 34.0 3 33.389 34.0 33.0 34.0 33.0 34.0 4 33.36525 34.0 33.0 34.0 33.0 34.0 5 33.346 34.0 33.0 34.0 33.0 34.0 6 37.45675 38.0 38.0 38.0 38.0 38.0 7 37.47375 38.0 38.0 38.0 38.0 38.0 8 37.5275 38.0 38.0 38.0 38.0 38.0 9 37.55375 38.0 38.0 38.0 38.0 38.0 10-14 37.528200000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.4697 38.0 38.0 38.0 38.0 38.0 20-24 37.405150000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.338800000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.36315 38.0 38.0 38.0 37.6 38.0 35-39 37.05035 38.0 38.0 38.0 36.6 38.0 40-44 37.2461 38.0 38.0 38.0 37.0 38.0 45-49 37.361450000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.36565 38.0 38.0 38.0 38.0 38.0 55-59 37.30395 38.0 38.0 38.0 37.8 38.0 60-64 37.12215 38.0 38.0 38.0 37.2 38.0 65-69 37.16074999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.2056 38.0 38.0 38.0 37.0 38.0 75-79 37.2053 38.0 38.0 38.0 37.0 38.0 80-84 37.02075000000001 38.0 38.0 38.0 36.8 38.0 85-89 36.760450000000006 38.0 38.0 38.0 35.6 38.0 90-94 36.927800000000005 38.0 38.0 38.0 35.8 38.0 95-99 36.91265 38.0 38.0 38.0 36.0 38.0 100-104 36.714999999999996 38.0 38.0 38.0 35.8 38.0 105-109 36.3215 38.0 37.8 38.0 33.4 38.0 110-114 36.185700000000004 38.0 37.4 38.0 32.8 38.0 115-119 36.33925 38.0 38.0 38.0 34.0 38.0 120-124 36.2251 38.0 38.0 38.0 34.0 38.0 125-129 35.32985 38.0 36.2 38.0 28.4 38.0 130-134 35.9045 38.0 37.8 38.0 33.2 38.0 135-139 35.51725 38.0 37.0 38.0 31.0 38.0 140-144 34.810199999999995 38.0 35.6 38.0 27.4 38.0 145-149 33.04185 38.0 32.6 38.0 20.0 38.0 150-151 29.932375 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 4.0 5 3.0 6 0.0 7 0.0 8 3.0 9 2.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 4.0 18 3.0 19 4.0 20 8.0 21 1.0 22 4.0 23 12.0 24 11.0 25 11.0 26 10.0 27 13.0 28 16.0 29 27.0 30 20.0 31 48.0 32 49.0 33 70.0 34 123.0 35 199.0 36 573.0 37 2775.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.225 21.175 12.65 22.95 2 26.974999999999998 26.25 29.475 17.299999999999997 3 20.4 29.2 31.75 18.65 4 23.599999999999998 34.150000000000006 23.575 18.675 5 23.724999999999998 37.2 22.175 16.900000000000002 6 22.3 37.0 23.775 16.925 7 20.349999999999998 21.775 38.3 19.575 8 22.05 26.0 27.200000000000003 24.75 9 20.7 25.124999999999996 30.175 24.0 10-14 23.565 28.904999999999998 26.584999999999997 20.945 15-19 23.294999999999998 28.505000000000003 27.595 20.605 20-24 22.814999999999998 27.884999999999998 28.43 20.87 25-29 23.35 27.92 27.77 20.96 30-34 23.69 27.839999999999996 28.24 20.23 35-39 23.605 28.24 28.23 19.925 40-44 24.474999999999998 28.48 27.275 19.77 45-49 23.54 27.894999999999996 27.955000000000002 20.61 50-54 23.41 27.665 28.65 20.275000000000002 55-59 23.575 27.785 27.794999999999998 20.845 60-64 23.215 27.765 28.405 20.615 65-69 23.335 27.32 28.315 21.029999999999998 70-74 24.005000000000003 27.584999999999997 27.650000000000002 20.76 75-79 23.035 28.065 28.694999999999997 20.205000000000002 80-84 23.605 27.975 28.225 20.195 85-89 23.544999999999998 27.865000000000002 28.315 20.275000000000002 90-94 23.835 28.144999999999996 28.04 19.98 95-99 24.18 27.915 27.57 20.335 100-104 24.275 27.345000000000002 27.689999999999998 20.69 105-109 24.2 27.765 28.015 20.02 110-114 24.01 28.075 27.815 20.1 115-119 24.47 27.644999999999996 28.01 19.875 120-124 24.535 27.894999999999996 27.860000000000003 19.71 125-129 24.87 27.750000000000004 27.615000000000002 19.765 130-134 25.240096038415366 27.485994397759107 27.566026410564227 19.707883153261303 135-139 24.95 27.644999999999996 27.91 19.495 140-144 24.740000000000002 27.315 27.975 19.97 145-149 25.245 28.16 27.11 19.485 150-151 25.674999999999997 27.925 27.275 19.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 2.0 25 2.0 26 3.5 27 5.0 28 5.0 29 8.0 30 9.5 31 13.5 32 24.5 33 36.0 34 43.5 35 58.5 36 82.0 37 100.0 38 133.5 39 167.5 40 196.5 41 245.5 42 271.5 43 271.5 44 292.5 45 296.5 46 283.5 47 269.0 48 242.0 49 202.0 50 156.5 51 135.0 52 113.0 53 89.0 54 65.5 55 44.5 56 33.0 57 23.5 58 21.5 59 17.0 60 6.5 61 4.5 62 5.0 63 3.5 64 2.5 65 2.0 66 3.5 67 3.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.04 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2257336343115124 0.44999999999999996 3 0.05016302984700275 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.7875000000000001 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.425 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.3375 0.0 0.0 0.0 0.0 114-115 2.5125 0.0 0.0 0.0 0.0 116-117 2.8 0.0 0.0 0.0 0.0 118-119 3.25 0.0 0.0 0.0 0.0 120-121 3.6625 0.0 0.0 0.0 0.0 122-123 3.8125 0.0 0.0 0.0 0.0 124-125 4.0375 0.0 0.0 0.0 0.0 126-127 4.4 0.0 0.0 0.0 0.0 128-129 4.775 0.0 0.0 0.0 0.0 130-131 5.0625 0.0 0.0 0.0 0.0 132-133 5.325 0.0 0.0 0.0 0.0 134-135 5.5625 0.0 0.0 0.0 0.0 136-137 5.925 0.0 0.0 0.0 0.0 138-139 6.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 80 0.0020131238 12.6875 35-39 >>END_MODULE Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929473 spots for SRR7169886.sra Written 929473 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra Read 929468 spots for SRR7169886.sra Written 929468 spots for SRR7169886.sra SRR ids: ['SRR7169886.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jsocl_dq SRR7169886.sra spots: 18589365 blocks: [[1, 929468], [929469, 1858936], [1858937, 2788404], [2788405, 3717872], [3717873, 4647340], [4647341, 5576808], [5576809, 6506276], [6506277, 7435744], [7435745, 8365212], [8365213, 9294680], [9294681, 10224148], [10224149, 11153616], [11153617, 12083084], [12083085, 13012552], [13012553, 13942020], [13942021, 14871488], [14871489, 15800956], [15800957, 16730424], [16730425, 17659892], [17659893, 18589365]] SRR7169886 file size 6277625 SRR7169886 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169886 SRR7169886_1.fastq SRR7169886_2.fastq Input file: SRR7169886_1.fastq Paired file: SRR7169886_2.fastq trimmed: SRR7169886-trimmed-pair1.fastq, SRR7169886-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:47:50 2025 >> started Wed Feb 12 00:48:09 2025 >> done (19.134s) 18589365 read pairs processed; of these: 20127 ( 0.11%) short read pairs filtered out after trimming by size control 19104 ( 0.10%) empty read pairs filtered out after trimming by size control 18550134 (99.79%) read pairs available; of these: 8310803 (44.80%) trimmed read pairs available after processing 10239331 (55.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 3 0.00% 21 6 0.00% 22 10 0.00% 23 10 0.00% 24 9 0.00% 25 4 0.00% 26 5 0.00% 27 5 0.00% 28 8 0.00% 29 8 0.00% 30 10 0.00% 31 9 0.00% 32 8 0.00% 33 6 0.00% 34 9 0.00% 35 4 0.00% 36 10 0.00% 37 19 0.00% 38 14 0.00% 39 17 0.00% 40 18 0.00% 41 34 0.00% 42 28 0.00% 43 29 0.00% 44 40 0.00% 45 43 0.00% 46 43 0.00% 47 56 0.00% 48 70 0.00% 49 75 0.00% 50 75 0.00% 51 106 0.00% 52 117 0.00% 53 137 0.00% 54 153 0.00% 55 167 0.00% 56 168 0.00% 57 231 0.00% 58 254 0.00% 59 297 0.00% 60 335 0.00% 61 359 0.00% 62 458 0.00% 63 554 0.00% 64 631 0.00% 65 597 0.00% 66 708 0.00% 67 792 0.00% 68 949 0.01% 69 1100 0.01% 70 1230 0.01% 71 1429 0.01% 72 1736 0.01% 73 1980 0.01% 74 2153 0.01% 75 2380 0.01% 76 2761 0.01% 77 3019 0.02% 78 3305 0.02% 79 3567 0.02% 80 4049 0.02% 81 4614 0.02% 82 5318 0.03% 83 5915 0.03% 84 7399 0.04% 85 8415 0.05% 86 8702 0.05% 87 9229 0.05% 88 9853 0.05% 89 10368 0.06% 90 11182 0.06% 91 11934 0.06% 92 13126 0.07% 93 14016 0.08% 94 14976 0.08% 95 15893 0.09% 96 16334 0.09% 97 16728 0.09% 98 17330 0.09% 99 17988 0.10% 100 19007 0.10% 101 19829 0.11% 102 21203 0.11% 103 22798 0.12% 104 24155 0.13% 105 25492 0.14% 106 25570 0.14% 107 26077 0.14% 108 26416 0.14% 109 26900 0.15% 110 27639 0.15% 111 28918 0.16% 112 30857 0.17% 113 32030 0.17% 114 34477 0.19% 115 35064 0.19% 116 35721 0.19% 117 36600 0.20% 118 36960 0.20% 119 37387 0.20% 120 37830 0.20% 121 39079 0.21% 122 40519 0.22% 123 42875 0.23% 124 44767 0.24% 125 46286 0.25% 126 47919 0.26% 127 48873 0.26% 128 49563 0.27% 129 50354 0.27% 130 51384 0.28% 131 53043 0.29% 132 55268 0.30% 133 58174 0.31% 134 61185 0.33% 135 64244 0.35% 136 66847 0.36% 137 70667 0.38% 138 73298 0.40% 139 76592 0.41% 140 80880 0.44% 141 87249 0.47% 142 94629 0.51% 143 106712 0.58% 144 123758 0.67% 145 146254 0.79% 146 181415 0.98% 147 242216 1.31% 148 364470 1.96% 149 753358 4.06% 150 4222258 22.76% 151 10239331 55.20% 18550134 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=28 prefix-density=0.13 prefix-fanout=2.9 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=291.01 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=29.9 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=36 prefix-density=0.28 prefix-fanout=3.0 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=9 fanout-score=329.05 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=29.9 sequence=AAGAAGAAGAAA SRR7169886 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:48:49 Started mapping on | Feb 12 00:48:50 Finished on | Feb 12 00:50:24 Mapping speed, Million of reads per hour | 710.43 Number of input reads | 18550134 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17613093 Uniquely mapped reads % | 94.95% Average mapped length | 293.27 Number of splices: Total | 16366462 Number of splices: Annotated (sjdb) | 16036664 Number of splices: GT/AG | 16094200 Number of splices: GC/AG | 218588 Number of splices: AT/AC | 14456 Number of splices: Non-canonical | 39218 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 309473 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 34809 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.15% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 646501 646501 646501 N_multimapping 309473 309473 309473 N_noFeature 572956 17435384 658230 N_ambiguous 166932 1068 73890 UnstrandedReadsAssigned:16873205 PositiveStrandReadsAssigned:176641 NegativeStrandReadsAssigned:16880973 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169886 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169886-trimmed-pair1.fastq SRR7169886-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,550,134 reads, 16,790,197 reads pseudoaligned [quant] estimated average fragment length: 236.385 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52401 SRR7169886.ke.tsv 34699 SRR7169886.se.tsv 87100 total ==> SRR7169886.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.61 410 13.5021 Potri.005G024800.1.v4.1 1035 799.615 93 6.82775 Potri.004G059700.1.v4.1 961 725.62 4 0.323613 Potri.007G009000.2.v4.1 1416 1180.61 0 0 Potri.003G141000.2.v4.1 2943 2707.61 345.044 7.48105 Potri.016G087400.1.v4.1 270 83.201 1931.6 1362.9 Potri.015G069301.1.v4.1 564 332.886 0 0 Potri.010G195200.1.v4.1 1773 1537.61 108 4.12336 Potri.012G127500.1.v4.1 977 741.615 13384 1059.46 ==> SRR7169886.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1090 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 598 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 3 SRR7169886 completed mapping pipeline successfully