Starting /dee2/code/volunteer_pipeline.sh SRR7169887 current disk space = 3051300343808 free memory = 1190758568 SRR7169887 SRAfilesize fa3b688ccd238deb23b14f36ff489068 SRR7169887.sra SRR7169887.sra file validated SRR7169887 is paired end SRR7169887 is conventional basespace SRR7169887 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169887_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.80375 30.0 18.0 33.0 18.0 33.0 2 27.436 29.0 25.0 31.0 18.0 33.0 3 30.62875 31.0 29.0 33.0 27.0 33.0 4 32.198 33.0 31.0 33.0 30.0 33.0 5 32.72725 33.0 33.0 33.0 31.0 34.0 6 37.0415 38.0 37.0 38.0 35.0 38.0 7 37.4415 38.0 38.0 38.0 37.0 38.0 8 37.69375 38.0 38.0 38.0 38.0 38.0 9 37.73275 38.0 38.0 38.0 38.0 38.0 10-14 37.72315 38.0 38.0 38.0 38.0 38.0 15-19 37.73015 38.0 38.0 38.0 38.0 38.0 20-24 37.7128 38.0 38.0 38.0 38.0 38.0 25-29 37.6514 38.0 38.0 38.0 38.0 38.0 30-34 37.59355 38.0 38.0 38.0 38.0 38.0 35-39 37.6414 38.0 38.0 38.0 38.0 38.0 40-44 37.596349999999994 38.0 38.0 38.0 38.0 38.0 45-49 37.547549999999994 38.0 38.0 38.0 38.0 38.0 50-54 37.378949999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.2858 38.0 38.0 38.0 36.8 38.0 60-64 37.12089999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.7444 38.0 37.8 38.0 34.2 38.0 70-74 36.991049999999994 38.0 38.0 38.0 35.6 38.0 75-79 37.00375 38.0 38.0 38.0 35.8 38.0 80-84 36.7473 38.0 37.8 38.0 35.2 38.0 85-89 36.347 38.0 37.4 38.0 33.6 38.0 90-94 36.4156 38.0 37.4 38.0 34.0 38.0 95-99 36.340799999999994 38.0 37.0 38.0 34.0 38.0 100-104 36.0406 38.0 36.8 38.0 33.0 38.0 105-109 35.6669 38.0 36.6 38.0 31.2 38.0 110-114 35.43745 38.0 36.0 38.0 29.8 38.0 115-119 34.478750000000005 38.0 34.4 38.0 25.4 38.0 120-124 34.086149999999996 38.0 33.8 38.0 23.0 38.0 125-129 32.679500000000004 37.2 31.0 38.0 16.8 38.0 130-134 33.164699999999996 37.6 32.2 38.0 21.0 38.0 135-139 32.835950000000004 37.6 32.2 38.0 17.6 38.0 140-144 31.931850000000004 37.0 30.8 38.0 14.4 38.0 145-149 29.91685 36.0 28.0 38.0 6.0 38.0 150-151 23.355125 29.0 11.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 2.0 15 1.0 16 1.0 17 5.0 18 1.0 19 5.0 20 4.0 21 4.0 22 4.0 23 10.0 24 8.0 25 14.0 26 16.0 27 12.0 28 26.0 29 20.0 30 54.0 31 87.0 32 109.0 33 182.0 34 318.0 35 686.0 36 1361.0 37 1066.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.45283018867924 10.566037735849058 8.40251572327044 32.57861635220126 2 26.900000000000002 12.049999999999999 33.375 27.675 3 18.825 20.125 27.025 34.025 4 22.45 27.3 24.474999999999998 25.775 5 23.400000000000002 32.875 23.0 20.724999999999998 6 18.325 36.7 24.625 20.349999999999998 7 15.1 27.05 40.375 17.474999999999998 8 17.375 27.625 31.474999999999998 23.525 9 17.75 24.375 33.475 24.4 10-14 19.625 30.330000000000002 27.529999999999998 22.515 15-19 20.29 29.24 27.6 22.869999999999997 20-24 20.05 29.505 27.775 22.67 25-29 20.135 29.64 27.57 22.655 30-34 20.665 29.195 27.55 22.59 35-39 19.81 29.24 27.96 22.99 40-44 21.09 29.244999999999997 27.18 22.485 45-49 20.48 28.825 27.515 23.18 50-54 19.81 28.955 28.28 22.955000000000002 55-59 20.595 28.82 27.505000000000003 23.080000000000002 60-64 20.11 29.110000000000003 27.544999999999998 23.235 65-69 19.955000000000002 28.64 27.939999999999998 23.465 70-74 20.465 28.910000000000004 27.71 22.915 75-79 20.61 29.104999999999997 27.515 22.770000000000003 80-84 20.14 28.244999999999997 27.765 23.849999999999998 85-89 19.985 28.849999999999998 27.560000000000002 23.605 90-94 20.355 29.335 26.755000000000003 23.555 95-99 20.549999999999997 28.410000000000004 27.485 23.555 100-104 20.51 28.38 27.99 23.119999999999997 105-109 20.71 28.660000000000004 27.555000000000003 23.075000000000003 110-114 20.789104746645304 28.32966152613659 27.59363108351692 23.287602643701184 115-119 21.165213906422203 28.59933874361286 27.67758741609057 22.55785993387436 120-124 20.490613266583228 28.565707133917396 27.549436795994993 23.39424280350438 125-129 21.052104709945443 28.219630612142748 27.083437609489962 23.644827068421844 130-134 20.794999999999998 28.57 27.35 23.285 135-139 20.945 28.37 27.435 23.25 140-144 21.02 27.715 27.825 23.44 145-149 20.735 28.315 27.525 23.425 150-151 20.4375 28.712500000000002 27.900000000000002 22.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.5 22 1.5 23 2.0 24 3.0 25 4.0 26 5.5 27 5.5 28 8.5 29 18.0 30 21.5 31 24.0 32 30.0 33 35.5 34 54.0 35 77.0 36 94.5 37 123.0 38 140.5 39 158.5 40 196.5 41 229.5 42 261.5 43 261.5 44 271.5 45 276.0 46 240.5 47 248.5 48 240.0 49 211.5 50 194.0 51 145.0 52 103.0 53 82.5 54 63.5 55 44.5 56 27.0 57 20.5 58 18.5 59 11.0 60 8.0 61 8.0 62 8.0 63 5.5 64 2.5 65 1.5 66 3.0 67 2.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.13999999999999999 115-119 0.19 120-124 0.125 125-129 0.105 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09182643794148 98.2 2 0.9081735620585267 1.7999999999999998 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.075 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.2625 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.5125000000000002 0.0 0.0 0.0 0.0 128-129 1.625 0.0 0.0 0.0 0.0 130-131 1.825 0.0 0.0 0.0 0.0 132-133 1.9874999999999998 0.0 0.0 0.0 0.0 134-135 2.25 0.0 0.0 0.0 0.0 136-137 2.6125 0.0 0.0 0.0 0.0 138-139 2.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169887 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169887_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3175 34.0 33.0 34.0 33.0 34.0 2 33.39525 34.0 33.0 34.0 33.0 34.0 3 33.43775 34.0 33.0 34.0 33.0 34.0 4 33.37575 34.0 33.0 34.0 33.0 34.0 5 33.40275 34.0 33.0 34.0 33.0 34.0 6 37.61875 38.0 38.0 38.0 38.0 38.0 7 37.53075 38.0 38.0 38.0 38.0 38.0 8 37.53525 38.0 38.0 38.0 38.0 38.0 9 37.4835 38.0 38.0 38.0 38.0 38.0 10-14 37.1225 38.0 38.0 38.0 36.6 38.0 15-19 37.50725 38.0 38.0 38.0 38.0 38.0 20-24 37.3159 38.0 38.0 38.0 37.2 38.0 25-29 37.40705 38.0 38.0 38.0 37.8 38.0 30-34 37.47985 38.0 38.0 38.0 38.0 38.0 35-39 37.2207 38.0 38.0 38.0 37.2 38.0 40-44 37.34675 38.0 38.0 38.0 37.6 38.0 45-49 37.41265 38.0 38.0 38.0 37.8 38.0 50-54 37.352500000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.3139 38.0 38.0 38.0 37.0 38.0 60-64 37.23845 38.0 38.0 38.0 37.0 38.0 65-69 36.972249999999995 38.0 38.0 38.0 36.2 38.0 70-74 37.1075 38.0 38.0 38.0 36.4 38.0 75-79 37.1593 38.0 38.0 38.0 36.8 38.0 80-84 37.0621 38.0 38.0 38.0 36.4 38.0 85-89 36.658049999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.67555 38.0 38.0 38.0 35.0 38.0 95-99 36.6842 38.0 38.0 38.0 35.2 38.0 100-104 35.4306 38.0 36.6 38.0 29.0 38.0 105-109 35.95739999999999 38.0 37.0 38.0 32.2 38.0 110-114 35.8298 38.0 37.2 38.0 32.0 38.0 115-119 34.826649999999994 38.0 35.2 38.0 26.6 38.0 120-124 34.9901 38.0 35.8 38.0 28.0 38.0 125-129 33.891000000000005 38.0 33.8 38.0 22.6 38.0 130-134 33.397650000000006 38.0 33.0 38.0 20.4 38.0 135-139 33.41615 38.0 33.0 38.0 20.8 38.0 140-144 32.828799999999994 37.6 32.0 38.0 19.0 38.0 145-149 30.742700000000003 36.6 29.6 38.0 7.8 38.0 150-151 25.539125 33.0 16.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 0.0 5 2.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 2.0 13 1.0 14 2.0 15 2.0 16 3.0 17 3.0 18 1.0 19 5.0 20 6.0 21 6.0 22 5.0 23 7.0 24 5.0 25 15.0 26 12.0 27 21.0 28 27.0 29 27.0 30 39.0 31 52.0 32 98.0 33 130.0 34 241.0 35 436.0 36 1010.0 37 1832.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.55 20.075000000000003 13.325000000000001 25.05 2 26.875 25.95 30.0 17.175 3 20.375 27.975 31.674999999999997 19.975 4 23.799999999999997 33.425 23.674999999999997 19.1 5 24.425 36.449999999999996 22.325 16.8 6 20.825 37.85 23.3 18.025 7 20.75 21.825 38.9 18.525 8 20.8 26.900000000000002 27.325 24.975 9 20.674999999999997 25.224999999999998 29.849999999999998 24.25 10-14 23.22 28.83 26.740000000000002 21.21 15-19 23.055 27.41 28.485 21.05 20-24 22.785 28.360000000000003 27.98 20.875 25-29 22.935 28.23 27.825 21.01 30-34 22.835 27.85 28.87 20.445 35-39 22.720000000000002 28.849999999999998 27.925 20.505000000000003 40-44 23.175 28.515 27.975 20.335 45-49 23.23 27.955000000000002 28.000000000000004 20.815 50-54 23.080000000000002 27.644999999999996 28.345 20.93 55-59 23.5 28.28 27.744999999999997 20.474999999999998 60-64 22.705000000000002 27.845 28.655 20.794999999999998 65-69 22.895 27.700000000000003 28.634999999999998 20.77 70-74 22.935 27.46 28.7 20.905 75-79 23.189999999999998 27.685 28.17 20.955 80-84 23.75 27.82 28.355000000000004 20.075000000000003 85-89 23.095 27.35 28.73 20.825 90-94 23.625 28.144999999999996 27.750000000000004 20.48 95-99 23.13 27.47 28.360000000000003 21.04 100-104 23.565 28.73 27.26 20.445 105-109 23.155 27.99 28.15 20.705000000000002 110-114 23.549999999999997 27.705000000000002 28.27 20.474999999999998 115-119 23.45 28.1 27.865000000000002 20.585 120-124 23.73 27.589999999999996 27.584999999999997 21.095 125-129 23.48291560358197 27.75026264445445 28.02541397768773 20.741407774275853 130-134 24.3 28.205000000000002 27.49 20.005 135-139 24.169999999999998 27.365000000000002 27.815 20.65 140-144 23.47 28.32 27.750000000000004 20.46 145-149 23.995 27.400000000000002 27.975 20.630000000000003 150-151 24.525 26.937499999999996 28.525 20.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 2.0 26 4.0 27 6.0 28 6.5 29 10.0 30 13.5 31 12.0 32 18.0 33 28.0 34 42.0 35 63.0 36 83.5 37 113.5 38 141.0 39 171.0 40 194.0 41 226.0 42 264.5 43 287.0 44 296.5 45 293.0 46 292.5 47 300.0 48 265.5 49 199.0 50 164.5 51 134.5 52 107.5 53 77.5 54 48.5 55 36.0 56 27.0 57 20.5 58 13.0 59 8.5 60 8.5 61 5.0 62 3.5 63 4.5 64 3.0 65 1.0 66 0.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.055 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01515151515152 98.02499999999999 2 0.9595959595959596 1.9 3 0.025252525252525252 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.7875 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.2625 0.0 0.0 0.0 0.0 122-123 1.3 0.0 0.0 0.0 0.0 124-125 1.3875000000000002 0.0 0.0 0.0 0.0 126-127 1.5125000000000002 0.0 0.0 0.0 0.0 128-129 1.625 0.0 0.0 0.0 0.0 130-131 1.825 0.0 0.0 0.0 0.0 132-133 1.9874999999999998 0.0 0.0 0.0 0.0 134-135 2.25 0.0 0.0 0.0 0.0 136-137 2.6125 0.0 0.0 0.0 0.0 138-139 2.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTGGTT 10 0.006830828 145.0 6 >>END_MODULE Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654607 spots for SRR7169887.sra Written 654607 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra Read 654600 spots for SRR7169887.sra Written 654600 spots for SRR7169887.sra SRR ids: ['SRR7169887.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h8icbtsu SRR7169887.sra spots: 13092007 blocks: [[1, 654600], [654601, 1309200], [1309201, 1963800], [1963801, 2618400], [2618401, 3273000], [3273001, 3927600], [3927601, 4582200], [4582201, 5236800], [5236801, 5891400], [5891401, 6546000], [6546001, 7200600], [7200601, 7855200], [7855201, 8509800], [8509801, 9164400], [9164401, 9819000], [9819001, 10473600], [10473601, 11128200], [11128201, 11782800], [11782801, 12437400], [12437401, 13092007]] SRR7169887 file size 4414751 SRR7169887 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169887 SRR7169887_1.fastq SRR7169887_2.fastq Input file: SRR7169887_1.fastq Paired file: SRR7169887_2.fastq trimmed: SRR7169887-trimmed-pair1.fastq, SRR7169887-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:44:59 2025 >> started Wed Feb 12 00:45:14 2025 >> done (14.406s) 13092007 read pairs processed; of these: 10233 ( 0.08%) short read pairs filtered out after trimming by size control 8973 ( 0.07%) empty read pairs filtered out after trimming by size control 13072801 (99.85%) read pairs available; of these: 6929873 (53.01%) trimmed read pairs available after processing 6142928 (46.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 3 0.00% 21 2 0.00% 22 4 0.00% 23 5 0.00% 24 3 0.00% 25 5 0.00% 26 7 0.00% 27 2 0.00% 28 2 0.00% 29 2 0.00% 30 7 0.00% 31 6 0.00% 32 7 0.00% 33 3 0.00% 34 7 0.00% 35 7 0.00% 36 7 0.00% 37 12 0.00% 38 4 0.00% 39 10 0.00% 40 10 0.00% 41 10 0.00% 42 6 0.00% 43 11 0.00% 44 16 0.00% 45 10 0.00% 46 18 0.00% 47 23 0.00% 48 26 0.00% 49 22 0.00% 50 24 0.00% 51 30 0.00% 52 39 0.00% 53 40 0.00% 54 43 0.00% 55 57 0.00% 56 63 0.00% 57 61 0.00% 58 52 0.00% 59 81 0.00% 60 88 0.00% 61 109 0.00% 62 114 0.00% 63 157 0.00% 64 149 0.00% 65 157 0.00% 66 170 0.00% 67 205 0.00% 68 261 0.00% 69 261 0.00% 70 272 0.00% 71 339 0.00% 72 407 0.00% 73 463 0.00% 74 536 0.00% 75 546 0.00% 76 660 0.01% 77 730 0.01% 78 808 0.01% 79 857 0.01% 80 907 0.01% 81 1126 0.01% 82 1265 0.01% 83 1465 0.01% 84 2033 0.02% 85 2510 0.02% 86 2479 0.02% 87 2502 0.02% 88 2641 0.02% 89 2838 0.02% 90 3030 0.02% 91 3111 0.02% 92 3482 0.03% 93 3694 0.03% 94 3889 0.03% 95 4030 0.03% 96 4450 0.03% 97 4614 0.04% 98 4696 0.04% 99 4953 0.04% 100 5263 0.04% 101 5578 0.04% 102 6039 0.05% 103 6303 0.05% 104 6563 0.05% 105 7015 0.05% 106 7423 0.06% 107 7820 0.06% 108 7944 0.06% 109 8263 0.06% 110 8582 0.07% 111 9026 0.07% 112 9557 0.07% 113 9985 0.08% 114 10643 0.08% 115 11220 0.09% 116 11757 0.09% 117 12295 0.09% 118 12656 0.10% 119 13146 0.10% 120 13717 0.10% 121 14628 0.11% 122 15492 0.12% 123 16270 0.12% 124 17110 0.13% 125 18413 0.14% 126 19658 0.15% 127 20867 0.16% 128 22047 0.17% 129 23383 0.18% 130 24872 0.19% 131 26794 0.20% 132 29057 0.22% 133 31595 0.24% 134 34749 0.27% 135 37797 0.29% 136 41762 0.32% 137 45832 0.35% 138 51225 0.39% 139 57183 0.44% 140 63838 0.49% 141 72230 0.55% 142 84134 0.64% 143 99889 0.76% 144 121664 0.93% 145 153441 1.17% 146 201096 1.54% 147 288541 2.21% 148 463349 3.54% 149 909542 6.96% 150 3664862 28.03% 151 6142928 46.99% 13072801 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=30 prefix-density=0.21 prefix-fanout=2.8 sequence=AAAGAAGTCAAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=320.84 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=16.6 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=38 prefix-density=0.34 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.04 sequence-density-rank=38 fanout-score=165.08 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=15.8 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169887 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:46:07 Started mapping on | Feb 12 00:46:07 Finished on | Feb 12 00:47:13 Mapping speed, Million of reads per hour | 713.06 Number of input reads | 13072801 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12424457 Uniquely mapped reads % | 95.04% Average mapped length | 295.85 Number of splices: Total | 12221601 Number of splices: Annotated (sjdb) | 12032268 Number of splices: GT/AG | 12045281 Number of splices: GC/AG | 144298 Number of splices: AT/AC | 9381 Number of splices: Non-canonical | 22641 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 214472 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 30764 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.04% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 446092 446092 446092 N_multimapping 214472 214472 214472 N_noFeature 272850 12304091 326992 N_ambiguous 118784 981 51845 UnstrandedReadsAssigned:12032823 PositiveStrandReadsAssigned:119385 NegativeStrandReadsAssigned:12045620 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169887 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169887-trimmed-pair1.fastq SRR7169887-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,072,801 reads, 11,943,186 reads pseudoaligned [quant] estimated average fragment length: 277.04 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,037 rounds 52401 SRR7169887.ke.tsv 34699 SRR7169887.se.tsv 87100 total ==> SRR7169887.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1741.96 184 8.7057 Potri.005G024800.1.v4.1 1035 758.96 50 5.42969 Potri.004G059700.1.v4.1 961 685.027 1 0.120314 Potri.007G009000.2.v4.1 1416 1139.96 0 0 Potri.003G141000.2.v4.1 2943 2666.96 287.04 8.87055 Potri.016G087400.1.v4.1 270 66.5921 1094 1354 Potri.015G069301.1.v4.1 564 294.393 0 0 Potri.010G195200.1.v4.1 1773 1496.96 8 0.440457 Potri.012G127500.1.v4.1 977 700.994 5364 630.664 ==> SRR7169887.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 782 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 153 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169887 completed mapping pipeline successfully