Starting /dee2/code/volunteer_pipeline.sh SRR7169888 current disk space = 3051279081472 free memory = 1481586180 SRR7169888 SRAfilesize dcc163a21577a5e56bdfef7c7d257727 SRR7169888.sra SRR7169888.sra file validated SRR7169888 is paired end SRR7169888 is conventional basespace SRR7169888 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169888_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.2055 27.0 18.0 33.0 18.0 33.0 2 24.644 25.0 18.0 30.0 18.0 33.0 3 29.08725 29.0 27.0 31.0 25.0 33.0 4 31.41875 33.0 31.0 33.0 29.0 33.0 5 32.11375 33.0 31.0 33.0 31.0 33.0 6 36.2455 37.0 36.0 38.0 33.0 38.0 7 37.16625 38.0 37.0 38.0 35.0 38.0 8 37.5695 38.0 38.0 38.0 37.0 38.0 9 37.65175 38.0 38.0 38.0 38.0 38.0 10-14 37.70955 38.0 38.0 38.0 38.0 38.0 15-19 37.7172 38.0 38.0 38.0 38.0 38.0 20-24 37.74980000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.72745 38.0 38.0 38.0 38.0 38.0 30-34 37.6579 38.0 38.0 38.0 38.0 38.0 35-39 37.51545 38.0 38.0 38.0 37.6 38.0 40-44 37.5847 38.0 38.0 38.0 37.8 38.0 45-49 37.5822 38.0 38.0 38.0 38.0 38.0 50-54 37.4602 38.0 38.0 38.0 37.2 38.0 55-59 37.33635 38.0 38.0 38.0 37.0 38.0 60-64 37.23995 38.0 38.0 38.0 36.6 38.0 65-69 37.17575 38.0 38.0 38.0 36.0 38.0 70-74 36.918600000000005 38.0 38.0 38.0 35.4 38.0 75-79 36.7793 38.0 38.0 38.0 35.0 38.0 80-84 36.79285 38.0 38.0 38.0 35.2 38.0 85-89 36.7976 38.0 38.0 38.0 35.4 38.0 90-94 36.7569 38.0 38.0 38.0 35.0 38.0 95-99 36.605 38.0 38.0 38.0 34.4 38.0 100-104 36.31445 38.0 37.4 38.0 33.8 38.0 105-109 35.17265 38.0 36.0 38.0 28.2 38.0 110-114 35.34275 38.0 36.2 38.0 28.0 38.0 115-119 35.83315 38.0 36.8 38.0 32.0 38.0 120-124 35.631 38.0 36.2 38.0 31.4 38.0 125-129 35.13035 38.0 35.6 38.0 28.8 38.0 130-134 34.8297 38.0 34.8 38.0 28.2 38.0 135-139 33.91165 38.0 33.6 38.0 22.2 38.0 140-144 33.59765 38.0 33.2 38.0 22.6 38.0 145-149 32.2833 37.8 32.0 38.0 13.8 38.0 150-151 27.889499999999998 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 3.0 13 0.0 14 1.0 15 4.0 16 3.0 17 2.0 18 2.0 19 2.0 20 3.0 21 2.0 22 6.0 23 6.0 24 5.0 25 11.0 26 12.0 27 15.0 28 17.0 29 23.0 30 36.0 31 37.0 32 69.0 33 129.0 34 223.0 35 455.0 36 1261.0 37 1670.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.35 12.2 10.75 31.7 2 24.9 13.950000000000001 33.074999999999996 28.075 3 20.075000000000003 20.8 26.674999999999997 32.45 4 20.95 28.925 23.025000000000002 27.1 5 21.675 32.275 25.124999999999996 20.925 6 20.025000000000002 34.949999999999996 24.375 20.65 7 14.35 27.700000000000003 39.725 18.224999999999998 8 18.275 26.6 31.6 23.525 9 18.097622027534417 25.93241551939925 33.2415519399249 22.728410513141426 10-14 19.455 31.1 27.43 22.015 15-19 19.845 29.665000000000003 27.715 22.775000000000002 20-24 19.805 29.325000000000003 27.839999999999996 23.03 25-29 19.67 29.735 27.57 23.025000000000002 30-34 19.655 29.645 27.43 23.27 35-39 20.09 29.285 27.689999999999998 22.935 40-44 19.869999999999997 29.360000000000003 27.615000000000002 23.155 45-49 20.18 29.395 27.245 23.18 50-54 19.955000000000002 28.965000000000003 27.775 23.305 55-59 20.04 29.775000000000002 27.01 23.175 60-64 20.075000000000003 29.575000000000003 27.310000000000002 23.04 65-69 20.5 29.145 27.515 22.84 70-74 19.875 28.815 28.075 23.235 75-79 20.14 28.395 27.310000000000002 24.154999999999998 80-84 20.335 29.294999999999998 27.155 23.215 85-89 20.565 29.470000000000002 26.455000000000002 23.51 90-94 20.424999999999997 29.330000000000002 26.77 23.474999999999998 95-99 20.05 29.360000000000003 27.125 23.465 100-104 20.52 29.325000000000003 26.895000000000003 23.26 105-109 20.465 29.145 26.945000000000004 23.445 110-114 20.375 29.28 26.729999999999997 23.615 115-119 20.735 28.244999999999997 27.665 23.355 120-124 20.158023703555532 28.31424713707056 27.30409561434215 24.223633545031756 125-129 20.647550417855175 28.79947955762398 27.14807586448481 23.40489416003603 130-134 20.77 28.694999999999997 27.27 23.265 135-139 20.48 28.53 27.21 23.78 140-144 20.380000000000003 29.049999999999997 26.974999999999998 23.595 145-149 20.62 28.715000000000003 26.900000000000002 23.765 150-151 20.325 28.15 28.037499999999998 23.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 1.5 23 2.0 24 3.5 25 6.0 26 7.5 27 10.0 28 12.0 29 16.0 30 24.5 31 35.0 32 41.0 33 47.0 34 68.5 35 86.0 36 109.0 37 137.0 38 142.5 39 147.5 40 179.0 41 218.0 42 231.0 43 229.5 44 258.0 45 281.0 46 270.5 47 240.0 48 229.0 49 213.5 50 160.5 51 129.5 52 110.5 53 89.0 54 68.0 55 48.0 56 36.0 57 28.5 58 20.5 59 14.0 60 9.0 61 8.5 62 7.0 63 3.0 64 2.5 65 3.0 66 2.0 67 1.5 68 1.5 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.125 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.015 125-129 0.08499999999999999 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14228052472251 98.25 2 0.8072653884964682 1.6 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.6000000000000001 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.8374999999999999 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.35 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.6375000000000002 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 1.975 0.0 0.0 0.0 0.0 122-123 2.0625 0.0 0.0 0.0 0.0 124-125 2.3 0.0 0.0 0.0 0.0 126-127 2.525 0.0 0.0 0.0 0.0 128-129 2.8125 0.0 0.0 0.0 0.0 130-131 3.0250000000000004 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.4749999999999996 0.0 0.0 0.0 0.0 136-137 3.6875 0.0 0.0 0.0 0.0 138-139 3.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAACAT 10 0.006830828 145.0 3 CAGCAAC 10 0.006830828 145.0 1 AAACATT 10 0.006830828 145.0 4 ACATTCC 10 0.006830828 145.0 6 ATTCCAA 10 0.006830828 145.0 8 GGTAAAC 10 0.006830828 145.0 1 >>END_MODULE SRR7169888 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169888_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.18875 34.0 33.0 34.0 33.0 34.0 2 33.3305 34.0 33.0 34.0 33.0 34.0 3 33.3715 34.0 33.0 34.0 33.0 34.0 4 33.393 34.0 33.0 34.0 33.0 34.0 5 33.39375 34.0 33.0 34.0 33.0 34.0 6 37.56225 38.0 38.0 38.0 38.0 38.0 7 37.5275 38.0 38.0 38.0 38.0 38.0 8 37.5695 38.0 38.0 38.0 38.0 38.0 9 37.553 38.0 38.0 38.0 38.0 38.0 10-14 37.521300000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.49995 38.0 38.0 38.0 37.8 38.0 20-24 37.25449999999999 38.0 38.0 38.0 36.8 38.0 25-29 37.40525 38.0 38.0 38.0 37.6 38.0 30-34 37.2701 38.0 38.0 38.0 37.4 38.0 35-39 37.48315 38.0 38.0 38.0 38.0 38.0 40-44 37.4199 38.0 38.0 38.0 37.8 38.0 45-49 37.2959 38.0 38.0 38.0 37.2 38.0 50-54 37.40875 38.0 38.0 38.0 38.0 38.0 55-59 37.461 38.0 38.0 38.0 37.6 38.0 60-64 37.2998 38.0 38.0 38.0 37.0 38.0 65-69 37.28305 38.0 38.0 38.0 37.0 38.0 70-74 36.854499999999994 38.0 38.0 38.0 35.2 38.0 75-79 36.76545 38.0 38.0 38.0 35.4 38.0 80-84 37.171949999999995 38.0 38.0 38.0 36.8 38.0 85-89 37.109249999999996 38.0 38.0 38.0 36.4 38.0 90-94 37.10615 38.0 38.0 38.0 36.4 38.0 95-99 37.03099999999999 38.0 38.0 38.0 36.0 38.0 100-104 36.9228 38.0 38.0 38.0 36.0 38.0 105-109 36.81475 38.0 38.0 38.0 35.6 38.0 110-114 36.22090000000001 38.0 37.4 38.0 33.0 38.0 115-119 36.573 38.0 38.0 38.0 34.6 38.0 120-124 36.4662 38.0 38.0 38.0 34.0 38.0 125-129 36.27335 38.0 38.0 38.0 33.6 38.0 130-134 35.823949999999996 38.0 37.2 38.0 31.6 38.0 135-139 35.590700000000005 38.0 36.4 38.0 31.4 38.0 140-144 32.24355 37.6 30.2 38.0 16.2 38.0 145-149 34.072500000000005 38.0 34.8 38.0 26.4 38.0 150-151 29.573 35.5 27.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 4.0 10 1.0 11 0.0 12 2.0 13 1.0 14 1.0 15 2.0 16 2.0 17 1.0 18 2.0 19 4.0 20 6.0 21 1.0 22 1.0 23 5.0 24 7.0 25 7.0 26 8.0 27 7.0 28 10.0 29 11.0 30 29.0 31 30.0 32 61.0 33 86.0 34 130.0 35 246.0 36 747.0 37 2582.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.75 22.2 15.25 24.8 2 27.825 26.35 28.549999999999997 17.275 3 21.525 29.4 30.075000000000003 19.0 4 23.925 34.275 22.775000000000002 19.025 5 23.625 36.8 21.425 18.15 6 21.85 36.625 22.725 18.8 7 19.75 22.075 38.074999999999996 20.1 8 22.0 26.775 25.825 25.4 9 22.125 24.224999999999998 30.275000000000002 23.375 10-14 23.810000000000002 28.884999999999998 26.435 20.87 15-19 23.53 28.15 27.52 20.8 20-24 23.05 28.515 27.355 21.08 25-29 23.465 28.375 27.26 20.9 30-34 23.549999999999997 28.345 27.584999999999997 20.52 35-39 23.635 27.71 27.845 20.810000000000002 40-44 24.085 28.225 27.025 20.665 45-49 23.84 28.294999999999998 27.27 20.595 50-54 23.61 28.505000000000003 27.215 20.669999999999998 55-59 23.815 27.99 27.365000000000002 20.830000000000002 60-64 23.61 27.73 28.035 20.625 65-69 23.26 28.15 28.015 20.575 70-74 23.635 27.925 28.42 20.02 75-79 23.955000000000002 27.644999999999996 27.79 20.61 80-84 23.21 28.065 27.894999999999996 20.830000000000002 85-89 23.45 28.205000000000002 27.62 20.724999999999998 90-94 23.465 27.685 28.15 20.7 95-99 24.03 27.839999999999996 28.005000000000003 20.125 100-104 24.065 27.54 28.115000000000002 20.28 105-109 23.985 27.99 27.77 20.255000000000003 110-114 23.62 28.37 27.465 20.544999999999998 115-119 23.76 27.67 28.360000000000003 20.21 120-124 24.15 27.439999999999998 28.235 20.175 125-129 23.86 27.72 28.115000000000002 20.305 130-134 24.145 27.700000000000003 27.744999999999997 20.41 135-139 23.665 27.62 28.215 20.5 140-144 24.735 27.229999999999997 27.525 20.51 145-149 25.21 27.389999999999997 27.445000000000004 19.955000000000002 150-151 24.3875 27.462500000000002 27.462500000000002 20.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 2.0 25 1.5 26 1.5 27 1.5 28 3.0 29 5.5 30 9.0 31 14.0 32 20.5 33 24.0 34 27.0 35 50.5 36 75.0 37 89.0 38 121.5 39 179.5 40 208.5 41 223.0 42 262.5 43 283.5 44 298.0 45 312.5 46 293.0 47 269.0 48 243.5 49 220.0 50 192.5 51 147.0 52 115.0 53 85.5 54 56.0 55 42.0 56 33.0 57 25.0 58 20.5 59 13.0 60 8.5 61 7.5 62 6.0 63 3.0 64 1.0 65 0.5 66 0.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11705348133198 98.225 2 0.8577194752774974 1.7000000000000002 3 0.025227043390514632 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8374999999999999 0.0 0.0 0.0 0.0 106-107 0.9625 0.0 0.0 0.0 0.0 108-109 1.0499999999999998 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.0375 0.0 0.0 0.0 0.0 122-123 2.1375 0.0 0.0 0.0 0.0 124-125 2.375 0.0 0.0 0.0 0.0 126-127 2.6125 0.0 0.0 0.0 0.0 128-129 2.9125 0.0 0.0 0.0 0.0 130-131 3.0999999999999996 0.0 0.0 0.0 0.0 132-133 3.3375 0.0 0.0 0.0 0.0 134-135 3.5625 0.0 0.0 0.0 0.0 136-137 3.7625 0.0 0.0 0.0 0.0 138-139 3.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539107 spots for SRR7169888.sra Written 539107 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra Read 539104 spots for SRR7169888.sra Written 539104 spots for SRR7169888.sra SRR ids: ['SRR7169888.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gnesh30a SRR7169888.sra spots: 10782083 blocks: [[1, 539104], [539105, 1078208], [1078209, 1617312], [1617313, 2156416], [2156417, 2695520], [2695521, 3234624], [3234625, 3773728], [3773729, 4312832], [4312833, 4851936], [4851937, 5391040], [5391041, 5930144], [5930145, 6469248], [6469249, 7008352], [7008353, 7547456], [7547457, 8086560], [8086561, 8625664], [8625665, 9164768], [9164769, 9703872], [9703873, 10242976], [10242977, 10782083]] SRR7169888 file size 3631993 SRR7169888 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169888 SRR7169888_1.fastq SRR7169888_2.fastq Input file: SRR7169888_1.fastq Paired file: SRR7169888_2.fastq trimmed: SRR7169888-trimmed-pair1.fastq, SRR7169888-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:46:50 2025 >> started Wed Feb 12 00:47:11 2025 >> done (20.909s) 10782083 read pairs processed; of these: 11951 ( 0.11%) short read pairs filtered out after trimming by size control 9002 ( 0.08%) empty read pairs filtered out after trimming by size control 10761130 (99.81%) read pairs available; of these: 4962385 (46.11%) trimmed read pairs available after processing 5798745 (53.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 3 0.00% 24 0 0.00% 25 1 0.00% 26 2 0.00% 27 6 0.00% 28 5 0.00% 29 3 0.00% 30 0 0.00% 31 2 0.00% 32 3 0.00% 33 2 0.00% 34 4 0.00% 35 5 0.00% 36 5 0.00% 37 5 0.00% 38 5 0.00% 39 6 0.00% 40 4 0.00% 41 9 0.00% 42 7 0.00% 43 7 0.00% 44 11 0.00% 45 13 0.00% 46 14 0.00% 47 11 0.00% 48 20 0.00% 49 23 0.00% 50 26 0.00% 51 20 0.00% 52 32 0.00% 53 39 0.00% 54 38 0.00% 55 71 0.00% 56 71 0.00% 57 66 0.00% 58 75 0.00% 59 94 0.00% 60 104 0.00% 61 101 0.00% 62 125 0.00% 63 154 0.00% 64 167 0.00% 65 205 0.00% 66 193 0.00% 67 213 0.00% 68 293 0.00% 69 334 0.00% 70 350 0.00% 71 473 0.00% 72 503 0.00% 73 536 0.00% 74 628 0.01% 75 761 0.01% 76 851 0.01% 77 915 0.01% 78 999 0.01% 79 1079 0.01% 80 1269 0.01% 81 1474 0.01% 82 1647 0.02% 83 1895 0.02% 84 2569 0.02% 85 2874 0.03% 86 3119 0.03% 87 3576 0.03% 88 3804 0.04% 89 3896 0.04% 90 4155 0.04% 91 4344 0.04% 92 4546 0.04% 93 5100 0.05% 94 5339 0.05% 95 5731 0.05% 96 6001 0.06% 97 6099 0.06% 98 6398 0.06% 99 6539 0.06% 100 7102 0.07% 101 7364 0.07% 102 7911 0.07% 103 8413 0.08% 104 8790 0.08% 105 9295 0.09% 106 9882 0.09% 107 10197 0.09% 108 10501 0.10% 109 10556 0.10% 110 10947 0.10% 111 11282 0.10% 112 11869 0.11% 113 12669 0.12% 114 13065 0.12% 115 13827 0.13% 116 14408 0.13% 117 14620 0.14% 118 14809 0.14% 119 15105 0.14% 120 15685 0.15% 121 15776 0.15% 122 16415 0.15% 123 17461 0.16% 124 18286 0.17% 125 19100 0.18% 126 20021 0.19% 127 20698 0.19% 128 20820 0.19% 129 21904 0.20% 130 22955 0.21% 131 23557 0.22% 132 24753 0.23% 133 26409 0.25% 134 27913 0.26% 135 29947 0.28% 136 31831 0.30% 137 34294 0.32% 138 36868 0.34% 139 39674 0.37% 140 42874 0.40% 141 48246 0.45% 142 55345 0.51% 143 67966 0.63% 144 75339 0.70% 145 97534 0.91% 146 120229 1.12% 147 168255 1.56% 148 277053 2.57% 149 569907 5.30% 150 2642579 24.56% 151 5798745 53.89% 10761130 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=33 prefix-density=0.25 prefix-fanout=2.4 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=16 fanout-score=92.58 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=18.2 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=45 prefix-density=0.22 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=135.29 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=13.2 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169888 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:47:57 Started mapping on | Feb 12 00:47:57 Finished on | Feb 12 00:49:13 Mapping speed, Million of reads per hour | 509.74 Number of input reads | 10761130 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10030363 Uniquely mapped reads % | 93.21% Average mapped length | 295.30 Number of splices: Total | 9025739 Number of splices: Annotated (sjdb) | 8872863 Number of splices: GT/AG | 8895355 Number of splices: GC/AG | 104366 Number of splices: AT/AC | 6871 Number of splices: Non-canonical | 19147 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 186702 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 20997 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.81% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 554166 554166 554166 N_multimapping 186702 186702 186702 N_noFeature 192364 9904015 231781 N_ambiguous 126609 500 39392 UnstrandedReadsAssigned:9711390 PositiveStrandReadsAssigned:125848 NegativeStrandReadsAssigned:9759190 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169888 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169888-trimmed-pair1.fastq SRR7169888-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,761,130 reads, 9,703,746 reads pseudoaligned [quant] estimated average fragment length: 261.203 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR7169888.ke.tsv 34699 SRR7169888.se.tsv 87100 total ==> SRR7169888.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.8 169 8.77896 Potri.005G024800.1.v4.1 1035 774.797 20 2.35704 Potri.004G059700.1.v4.1 961 700.808 1 0.130295 Potri.007G009000.2.v4.1 1416 1155.8 0 0 Potri.003G141000.2.v4.1 2943 2682.8 131.029 4.45969 Potri.016G087400.1.v4.1 270 72.4693 1215 1530.9 Potri.015G069301.1.v4.1 564 307.823 0 0 Potri.010G195200.1.v4.1 1773 1512.8 22 1.32791 Potri.012G127500.1.v4.1 977 716.803 4107 523.179 ==> SRR7169888.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1089 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 313 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169888 completed mapping pipeline successfully