Starting /dee2/code/volunteer_pipeline.sh SRR7169889 current disk space = 3051140222976 free memory = 1505787800 SRR7169889 SRAfilesize da04e0fccce08e9e7164ac41cc4502e6 SRR7169889.sra SRR7169889.sra file validated SRR7169889 is paired end SRR7169889 is conventional basespace SRR7169889 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169889_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.343 30.0 18.0 33.0 18.0 33.0 2 26.91775 28.0 25.0 31.0 18.0 33.0 3 30.29225 31.0 29.0 33.0 27.0 33.0 4 32.026 33.0 31.0 33.0 30.0 33.0 5 32.712 33.0 33.0 33.0 31.0 34.0 6 36.9145 38.0 37.0 38.0 35.0 38.0 7 37.3515 38.0 38.0 38.0 36.0 38.0 8 37.694 38.0 38.0 38.0 37.0 38.0 9 37.6475 38.0 38.0 38.0 38.0 38.0 10-14 37.6588 38.0 38.0 38.0 37.8 38.0 15-19 37.6667 38.0 38.0 38.0 38.0 38.0 20-24 37.66415 38.0 38.0 38.0 38.0 38.0 25-29 37.62405 38.0 38.0 38.0 38.0 38.0 30-34 37.5268 38.0 38.0 38.0 37.4 38.0 35-39 37.5659 38.0 38.0 38.0 37.8 38.0 40-44 37.53195000000001 38.0 38.0 38.0 37.4 38.0 45-49 37.46125 38.0 38.0 38.0 37.0 38.0 50-54 37.29745 38.0 38.0 38.0 36.6 38.0 55-59 37.1439 38.0 38.0 38.0 36.0 38.0 60-64 36.9487 38.0 38.0 38.0 35.8 38.0 65-69 36.57880000000001 38.0 37.6 38.0 33.8 38.0 70-74 36.85385 38.0 38.0 38.0 35.2 38.0 75-79 36.7809 38.0 38.0 38.0 35.0 38.0 80-84 36.574799999999996 38.0 37.8 38.0 34.6 38.0 85-89 36.173199999999994 38.0 37.0 38.0 32.8 38.0 90-94 36.2357 38.0 37.0 38.0 33.4 38.0 95-99 36.2063 38.0 37.0 38.0 33.4 38.0 100-104 35.8077 38.0 36.6 38.0 31.8 38.0 105-109 35.3779 38.0 35.8 38.0 29.6 38.0 110-114 35.1571 38.0 35.6 38.0 28.8 38.0 115-119 34.32685 37.8 34.2 38.0 24.8 38.0 120-124 33.638200000000005 37.6 33.2 38.0 21.6 38.0 125-129 32.47665 37.2 30.8 38.0 16.2 38.0 130-134 32.863 37.2 31.8 38.0 18.6 38.0 135-139 32.48915 37.4 31.8 38.0 15.2 38.0 140-144 31.67955 36.6 30.0 38.0 13.6 38.0 145-149 29.642350000000004 36.0 28.0 38.0 5.8 38.0 150-151 22.812375 27.5 7.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 1.0 12 4.0 13 1.0 14 1.0 15 0.0 16 2.0 17 3.0 18 1.0 19 1.0 20 6.0 21 7.0 22 4.0 23 10.0 24 8.0 25 12.0 26 16.0 27 24.0 28 32.0 29 25.0 30 49.0 31 81.0 32 127.0 33 236.0 34 384.0 35 702.0 36 1370.0 37 891.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.733668341708544 12.28643216080402 9.246231155778894 31.733668341708544 2 27.275 13.225000000000001 32.4 27.1 3 20.674999999999997 21.099999999999998 27.05 31.175000000000004 4 23.175 28.65 24.0 24.175 5 22.225 32.875 24.65 20.25 6 20.275000000000002 35.325 24.95 19.45 7 13.950000000000001 26.700000000000003 41.55 17.8 8 17.974999999999998 27.05 29.925 25.05 9 17.0 25.724999999999998 33.625 23.65 10-14 20.18 29.9 27.32 22.6 15-19 20.65 29.304999999999996 27.750000000000004 22.295 20-24 20.115 29.23 27.779999999999998 22.875 25-29 20.11 29.53 27.42 22.939999999999998 30-34 20.21 29.34 27.389999999999997 23.06 35-39 20.405 28.515 28.015 23.064999999999998 40-44 20.645 29.39 27.105 22.86 45-49 20.285 29.03 28.01 22.675 50-54 20.695 28.689999999999998 27.744999999999997 22.869999999999997 55-59 20.1 29.48 26.965 23.455000000000002 60-64 20.21 28.575 27.639999999999997 23.575 65-69 20.345 28.999999999999996 27.08 23.575 70-74 20.155 29.395 27.089999999999996 23.36 75-79 20.47 28.83 27.365000000000002 23.335 80-84 20.119999999999997 28.78 27.48 23.62 85-89 20.525 28.185 28.634999999999998 22.655 90-94 20.76 29.115000000000002 27.255000000000003 22.869999999999997 95-99 20.064999999999998 29.37 27.700000000000003 22.865 100-104 21.26 28.675 27.27 22.795 105-109 20.48 28.915000000000003 27.43 23.175 110-114 20.827075197757082 28.932612396114948 27.455692400120157 22.78462000600781 115-119 20.39559339008513 29.369053580370558 27.44616925388082 22.789183775663496 120-124 21.036036036036034 28.783783783783782 27.28728728728729 22.892892892892895 125-129 20.5124355702347 28.178952109292897 27.733573537506878 23.57503878296552 130-134 20.62 28.765 27.495000000000005 23.119999999999997 135-139 21.255 28.095 27.279999999999998 23.369999999999997 140-144 20.73 27.875 27.755000000000003 23.64 145-149 20.375 28.544999999999998 27.200000000000003 23.880000000000003 150-151 20.3125 28.000000000000004 28.1625 23.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 2.0 25 2.0 26 4.5 27 9.0 28 14.5 29 20.0 30 22.0 31 25.5 32 34.5 33 52.5 34 73.0 35 83.0 36 82.5 37 104.0 38 136.0 39 164.0 40 183.5 41 207.0 42 249.5 43 259.0 44 258.5 45 275.0 46 261.5 47 257.0 48 242.5 49 207.0 50 179.0 51 137.5 52 120.0 53 98.5 54 64.5 55 43.5 56 28.0 57 21.5 58 19.5 59 13.5 60 6.5 61 5.5 62 7.5 63 4.5 64 3.0 65 2.5 66 2.0 67 2.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.13 115-119 0.15 120-124 0.1 125-129 0.08499999999999999 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06612821807168 98.125 2 0.9086320040383644 1.7999999999999998 3 0.025239777889954566 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.4249999999999998 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.8 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.2249999999999996 0.0 0.0 0.0 0.0 122-123 2.425 0.0 0.0 0.0 0.0 124-125 2.4875 0.0 0.0 0.0 0.0 126-127 2.65 0.0 0.0 0.0 0.0 128-129 2.8 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.2 0.0 0.0 0.0 0.0 134-135 3.425 0.0 0.0 0.0 0.0 136-137 3.6 0.0 0.0 0.0 0.0 138-139 3.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAAACT 10 0.006830828 145.0 3 >>END_MODULE SRR7169889 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169889_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.33125 34.0 33.0 34.0 33.0 34.0 2 33.4045 34.0 33.0 34.0 33.0 34.0 3 33.4655 34.0 33.0 34.0 33.0 34.0 4 33.41775 34.0 33.0 34.0 33.0 34.0 5 33.3855 34.0 33.0 34.0 33.0 34.0 6 37.61575 38.0 38.0 38.0 38.0 38.0 7 37.52675 38.0 38.0 38.0 38.0 38.0 8 37.5465 38.0 38.0 38.0 38.0 38.0 9 37.5685 38.0 38.0 38.0 38.0 38.0 10-14 37.161750000000005 38.0 38.0 38.0 36.6 38.0 15-19 37.5224 38.0 38.0 38.0 37.8 38.0 20-24 37.38265 38.0 38.0 38.0 37.2 38.0 25-29 37.433550000000004 38.0 38.0 38.0 37.8 38.0 30-34 37.4698 38.0 38.0 38.0 37.8 38.0 35-39 37.2992 38.0 38.0 38.0 37.2 38.0 40-44 37.30755 38.0 38.0 38.0 37.0 38.0 45-49 37.37195 38.0 38.0 38.0 37.0 38.0 50-54 37.36895 38.0 38.0 38.0 37.0 38.0 55-59 37.33265 38.0 38.0 38.0 37.0 38.0 60-64 37.26585 38.0 38.0 38.0 37.0 38.0 65-69 36.923500000000004 38.0 38.0 38.0 35.6 38.0 70-74 37.15475 38.0 38.0 38.0 36.8 38.0 75-79 37.1328 38.0 38.0 38.0 36.4 38.0 80-84 37.015550000000005 38.0 38.0 38.0 35.8 38.0 85-89 36.6674 38.0 38.0 38.0 35.0 38.0 90-94 36.67525 38.0 38.0 38.0 34.8 38.0 95-99 36.618399999999994 38.0 38.0 38.0 34.4 38.0 100-104 35.4537 38.0 36.6 38.0 29.2 38.0 105-109 35.96495 38.0 36.8 38.0 32.6 38.0 110-114 35.7842 38.0 36.8 38.0 31.6 38.0 115-119 34.79625 38.0 35.0 38.0 26.4 38.0 120-124 34.8953 38.0 35.0 38.0 27.4 38.0 125-129 33.80765 38.0 33.6 38.0 22.4 38.0 130-134 33.26925 38.0 32.8 38.0 19.8 38.0 135-139 33.03349999999999 38.0 32.6 38.0 18.6 38.0 140-144 32.66135 37.6 32.0 38.0 18.2 38.0 145-149 30.4475 36.6 28.8 38.0 7.8 38.0 150-151 25.150125 32.0 16.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 3.0 15 2.0 16 2.0 17 2.0 18 2.0 19 5.0 20 5.0 21 7.0 22 9.0 23 7.0 24 4.0 25 17.0 26 24.0 27 21.0 28 25.0 29 42.0 30 45.0 31 51.0 32 80.0 33 147.0 34 235.0 35 450.0 36 1067.0 37 1740.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.800000000000004 22.55 14.774999999999999 22.875 2 27.575 26.75 28.449999999999996 17.224999999999998 3 20.724999999999998 28.65 31.8 18.825 4 22.75 35.15 23.35 18.75 5 24.7 36.125 21.075 18.099999999999998 6 21.075 37.8 24.075 17.05 7 20.775 21.825 37.375 20.025000000000002 8 22.375 26.224999999999998 26.474999999999998 24.925 9 21.075 27.075 27.750000000000004 24.099999999999998 10-14 23.285 28.444999999999997 26.545 21.725 15-19 22.67 27.955000000000002 27.855 21.52 20-24 22.795 27.98 27.92 21.305 25-29 22.895 28.275 27.474999999999998 21.355 30-34 23.330000000000002 28.470000000000002 27.634999999999998 20.565 35-39 22.6 28.549999999999997 27.67 21.18 40-44 22.915 27.860000000000003 28.425 20.8 45-49 22.470000000000002 28.24 28.139999999999997 21.15 50-54 22.96 27.58 28.23 21.23 55-59 22.71 28.360000000000003 28.1 20.830000000000002 60-64 22.68 27.715 28.26 21.345 65-69 23.095 27.77 28.215 20.919999999999998 70-74 23.0 28.01 28.335 20.655 75-79 22.939999999999998 28.43 27.91 20.72 80-84 23.425 27.355 28.21 21.01 85-89 24.145 27.72 27.939999999999998 20.195 90-94 23.09 28.225 28.470000000000002 20.215 95-99 23.035 28.13 27.935 20.9 100-104 23.400000000000002 27.93 27.99 20.68 105-109 23.485 27.779999999999998 27.965 20.77 110-114 23.599999999999998 28.365000000000002 28.08 19.955000000000002 115-119 24.175 27.725 27.43 20.669999999999998 120-124 23.815 27.685 28.055000000000003 20.445 125-129 24.070831874343455 28.212695713070886 27.657445850632783 20.059026561952876 130-134 24.03 27.765 27.92 20.285 135-139 23.185 27.634999999999998 28.225 20.955 140-144 23.95 28.185 27.58 20.285 145-149 24.2 27.855 28.01 19.935 150-151 24.9375 27.425 27.6125 20.025000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.5 24 2.0 25 2.0 26 3.0 27 4.0 28 6.0 29 6.5 30 5.5 31 13.0 32 20.0 33 27.0 34 41.5 35 57.5 36 73.0 37 99.0 38 143.0 39 178.5 40 204.0 41 239.5 42 264.0 43 281.5 44 304.0 45 313.5 46 299.5 47 279.0 48 240.0 49 194.0 50 163.5 51 134.0 52 115.0 53 89.0 54 56.5 55 37.5 56 30.0 57 23.0 58 13.5 59 10.0 60 8.0 61 3.5 62 3.0 63 3.0 64 1.0 65 1.5 66 2.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.045 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96438494569337 97.95 2 1.035615054306643 2.0500000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.3250000000000002 0.0 0.0 0.0 0.0 108-109 1.4249999999999998 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.7 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.1125 0.0 0.0 0.0 0.0 120-121 2.3 0.0 0.0 0.0 0.0 122-123 2.475 0.0 0.0 0.0 0.0 124-125 2.525 0.0 0.0 0.0 0.0 126-127 2.675 0.0 0.0 0.0 0.0 128-129 2.825 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.2 0.0 0.0 0.0 0.0 134-135 3.45 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 3.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTAAT 10 0.006830828 145.0 1 >>END_MODULE Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573900 spots for SRR7169889.sra Written 573900 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra Read 573896 spots for SRR7169889.sra Written 573896 spots for SRR7169889.sra SRR ids: ['SRR7169889.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yw0xll0c SRR7169889.sra spots: 11477924 blocks: [[1, 573896], [573897, 1147792], [1147793, 1721688], [1721689, 2295584], [2295585, 2869480], [2869481, 3443376], [3443377, 4017272], [4017273, 4591168], [4591169, 5165064], [5165065, 5738960], [5738961, 6312856], [6312857, 6886752], [6886753, 7460648], [7460649, 8034544], [8034545, 8608440], [8608441, 9182336], [9182337, 9756232], [9756233, 10330128], [10330129, 10904024], [10904025, 11477924]] SRR7169889 file size 3867791 SRR7169889 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169889 SRR7169889_1.fastq SRR7169889_2.fastq Input file: SRR7169889_1.fastq Paired file: SRR7169889_2.fastq trimmed: SRR7169889-trimmed-pair1.fastq, SRR7169889-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:20:14 2025 >> started Wed Feb 12 01:20:28 2025 >> done (14.295s) 11477924 read pairs processed; of these: 8286 ( 0.07%) short read pairs filtered out after trimming by size control 7934 ( 0.07%) empty read pairs filtered out after trimming by size control 11461704 (99.86%) read pairs available; of these: 5856644 (51.10%) trimmed read pairs available after processing 5605060 (48.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 2 0.00% 22 0 0.00% 23 2 0.00% 24 4 0.00% 25 4 0.00% 26 3 0.00% 27 3 0.00% 28 3 0.00% 29 3 0.00% 30 2 0.00% 31 6 0.00% 32 5 0.00% 33 6 0.00% 34 4 0.00% 35 8 0.00% 36 6 0.00% 37 12 0.00% 38 8 0.00% 39 11 0.00% 40 14 0.00% 41 14 0.00% 42 14 0.00% 43 13 0.00% 44 19 0.00% 45 24 0.00% 46 10 0.00% 47 27 0.00% 48 36 0.00% 49 44 0.00% 50 48 0.00% 51 51 0.00% 52 70 0.00% 53 64 0.00% 54 83 0.00% 55 88 0.00% 56 95 0.00% 57 119 0.00% 58 118 0.00% 59 164 0.00% 60 193 0.00% 61 230 0.00% 62 249 0.00% 63 266 0.00% 64 301 0.00% 65 327 0.00% 66 374 0.00% 67 402 0.00% 68 476 0.00% 69 533 0.00% 70 606 0.01% 71 725 0.01% 72 831 0.01% 73 928 0.01% 74 1054 0.01% 75 1162 0.01% 76 1328 0.01% 77 1446 0.01% 78 1509 0.01% 79 1697 0.01% 80 1843 0.02% 81 2113 0.02% 82 2404 0.02% 83 2673 0.02% 84 3279 0.03% 85 3876 0.03% 86 4147 0.04% 87 4191 0.04% 88 4491 0.04% 89 4594 0.04% 90 4927 0.04% 91 5258 0.05% 92 5724 0.05% 93 6057 0.05% 94 6308 0.06% 95 6680 0.06% 96 7227 0.06% 97 7072 0.06% 98 7457 0.07% 99 7856 0.07% 100 8421 0.07% 101 8459 0.07% 102 9044 0.08% 103 9529 0.08% 104 9752 0.09% 105 10429 0.09% 106 10802 0.09% 107 11141 0.10% 108 11243 0.10% 109 11271 0.10% 110 11663 0.10% 111 12405 0.11% 112 12611 0.11% 113 13231 0.12% 114 13845 0.12% 115 14525 0.13% 116 14672 0.13% 117 15202 0.13% 118 15336 0.13% 119 15573 0.14% 120 16094 0.14% 121 16680 0.15% 122 17190 0.15% 123 18362 0.16% 124 19316 0.17% 125 20064 0.18% 126 21200 0.18% 127 21830 0.19% 128 23134 0.20% 129 23902 0.21% 130 24938 0.22% 131 26705 0.23% 132 28265 0.25% 133 30097 0.26% 134 32728 0.29% 135 35903 0.31% 136 38507 0.34% 137 41799 0.36% 138 45985 0.40% 139 50082 0.44% 140 55311 0.48% 141 62586 0.55% 142 70980 0.62% 143 82343 0.72% 144 99340 0.87% 145 123089 1.07% 146 158892 1.39% 147 223913 1.95% 148 353896 3.09% 149 703918 6.14% 150 3016418 26.32% 151 5605060 48.90% 11461704 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=29 prefix-density=0.25 prefix-fanout=2.5 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=268.26 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=17.6 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=43 prefix-density=0.23 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=41 fanout-score=147.67 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=14.6 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169889 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:21:11 Started mapping on | Feb 12 01:21:11 Finished on | Feb 12 01:22:14 Mapping speed, Million of reads per hour | 654.95 Number of input reads | 11461704 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 10742857 Uniquely mapped reads % | 93.73% Average mapped length | 294.58 Number of splices: Total | 9986378 Number of splices: Annotated (sjdb) | 9826088 Number of splices: GT/AG | 9845496 Number of splices: GC/AG | 113002 Number of splices: AT/AC | 7140 Number of splices: Non-canonical | 20740 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 187134 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 30438 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.33% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 543818 543818 543818 N_multimapping 187134 187134 187134 N_noFeature 218792 10610545 265253 N_ambiguous 133117 677 46827 UnstrandedReadsAssigned:10390948 PositiveStrandReadsAssigned:131635 NegativeStrandReadsAssigned:10430777 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169889 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169889-trimmed-pair1.fastq SRR7169889-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,461,704 reads, 10,345,333 reads pseudoaligned [quant] estimated average fragment length: 282.959 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 976 rounds 52401 SRR7169889.ke.tsv 34699 SRR7169889.se.tsv 87100 total ==> SRR7169889.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.04 208 11.8002 Potri.005G024800.1.v4.1 1035 753.041 16 2.09261 Potri.004G059700.1.v4.1 961 679.093 4 0.58012 Potri.007G009000.2.v4.1 1416 1134.04 0 0 Potri.003G141000.2.v4.1 2943 2661.04 211 7.80941 Potri.016G087400.1.v4.1 270 75.4103 1011 1320.41 Potri.015G069301.1.v4.1 564 290.039 0 0 Potri.010G195200.1.v4.1 1773 1491.04 19 1.25502 Potri.012G127500.1.v4.1 977 695.059 2582 365.866 ==> SRR7169889.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1391 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 254 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169889 completed mapping pipeline successfully