Starting /dee2/code/volunteer_pipeline.sh SRR7169890 current disk space = 3051186069504 free memory = 1485996192 SRR7169890 SRAfilesize fc41e06e6a3f9f3a90e08dc4b32404fc SRR7169890.sra SRR7169890.sra file validated SRR7169890 is paired end SRR7169890 is conventional basespace SRR7169890 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169890_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.13375 32.0 25.0 33.0 18.0 33.0 2 26.796 29.0 25.0 31.0 18.0 33.0 3 30.304 31.0 29.0 33.0 27.0 33.0 4 32.23425 33.0 33.0 33.0 31.0 33.0 5 32.29625 33.0 33.0 33.0 32.0 34.0 6 36.6385 38.0 37.0 38.0 34.0 38.0 7 37.315 38.0 38.0 38.0 36.0 38.0 8 37.63225 38.0 38.0 38.0 37.0 38.0 9 37.7295 38.0 38.0 38.0 38.0 38.0 10-14 37.7354 38.0 38.0 38.0 38.0 38.0 15-19 37.7127 38.0 38.0 38.0 38.0 38.0 20-24 37.6269 38.0 38.0 38.0 37.8 38.0 25-29 37.66345 38.0 38.0 38.0 38.0 38.0 30-34 37.64055 38.0 38.0 38.0 38.0 38.0 35-39 37.5852 38.0 38.0 38.0 37.8 38.0 40-44 37.61805 38.0 38.0 38.0 38.0 38.0 45-49 37.62195 38.0 38.0 38.0 38.0 38.0 50-54 37.5674 38.0 38.0 38.0 38.0 38.0 55-59 37.43005000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.434450000000005 38.0 38.0 38.0 37.2 38.0 65-69 37.318650000000005 38.0 38.0 38.0 37.0 38.0 70-74 37.34805 38.0 38.0 38.0 37.0 38.0 75-79 37.241749999999996 38.0 38.0 38.0 36.8 38.0 80-84 36.90755 38.0 38.0 38.0 35.6 38.0 85-89 36.913000000000004 38.0 38.0 38.0 35.6 38.0 90-94 36.5307 38.0 37.6 38.0 33.8 38.0 95-99 36.82875 38.0 38.0 38.0 35.4 38.0 100-104 36.6498 38.0 38.0 38.0 34.8 38.0 105-109 36.13539999999999 38.0 37.2 38.0 31.0 38.0 110-114 35.867149999999995 38.0 36.8 38.0 31.6 38.0 115-119 35.3962 38.0 36.0 38.0 28.6 38.0 120-124 36.11385 38.0 37.2 38.0 33.6 38.0 125-129 35.031499999999994 38.0 35.2 38.0 27.6 38.0 130-134 35.464099999999995 38.0 35.8 38.0 30.4 38.0 135-139 35.509699999999995 38.0 36.0 38.0 31.2 38.0 140-144 34.74875 38.0 35.0 38.0 27.8 38.0 145-149 32.43055 37.2 32.2 38.0 19.2 38.0 150-151 28.912875 35.5 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 0.0 13 2.0 14 1.0 15 1.0 16 1.0 17 3.0 18 2.0 19 3.0 20 5.0 21 3.0 22 3.0 23 3.0 24 6.0 25 2.0 26 10.0 27 5.0 28 9.0 29 23.0 30 33.0 31 39.0 32 45.0 33 105.0 34 175.0 35 365.0 36 1132.0 37 2022.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.1 12.1 10.100000000000001 31.7 2 22.7977977977978 14.264264264264265 34.48448448448448 28.453453453453452 3 20.424999999999997 20.200000000000003 26.674999999999997 32.7 4 22.825 26.400000000000002 23.674999999999997 27.1 5 23.549999999999997 31.225 24.224999999999998 21.0 6 19.825 35.0 25.474999999999998 19.7 7 15.2 27.175 40.475 17.150000000000002 8 17.724999999999998 26.55 30.7 25.025 9 16.650000000000002 26.1 33.6 23.65 10-14 19.66 29.845 27.67 22.825 15-19 19.765 29.145 27.839999999999996 23.25 20-24 19.67 29.854999999999997 27.115000000000002 23.36 25-29 19.975 29.49 27.555000000000003 22.98 30-34 20.044999999999998 29.349999999999998 27.095000000000002 23.51 35-39 19.75 29.755 27.3 23.195 40-44 20.07 29.485 27.560000000000002 22.884999999999998 45-49 20.599999999999998 29.13 26.75 23.52 50-54 20.419999999999998 29.37 26.740000000000002 23.47 55-59 20.349999999999998 28.71 27.35 23.59 60-64 20.169999999999998 28.68 27.595 23.555 65-69 20.32 29.220000000000002 26.805 23.655 70-74 20.515 29.335 27.02 23.13 75-79 20.225 28.585 27.465 23.724999999999998 80-84 20.615 28.634999999999998 27.034999999999997 23.715 85-89 20.73 28.605000000000004 27.515 23.150000000000002 90-94 21.224999999999998 28.235 27.32 23.22 95-99 20.495 28.71 27.18 23.615 100-104 21.105 28.985 26.900000000000002 23.01 105-109 21.375 28.315 27.37 22.939999999999998 110-114 21.355 28.439999999999998 27.18 23.025000000000002 115-119 21.60012008405884 28.009606724707297 27.154007805463827 23.23626538577004 120-124 21.25 28.78 26.47 23.5 125-129 20.89 28.384999999999998 26.705000000000002 24.02 130-134 20.865000000000002 28.375 26.919999999999998 23.84 135-139 20.7 28.04 27.485 23.775 140-144 20.849999999999998 28.299999999999997 26.674999999999997 24.175 145-149 21.46 27.794999999999998 27.215 23.53 150-151 20.5 28.3125 27.5875 23.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 1.5 20 1.5 21 1.0 22 2.0 23 2.0 24 2.5 25 4.5 26 8.0 27 10.5 28 11.5 29 17.0 30 24.5 31 31.5 32 40.0 33 52.0 34 69.0 35 79.0 36 84.0 37 104.0 38 136.5 39 151.5 40 179.0 41 210.0 42 230.5 43 256.5 44 253.0 45 246.5 46 255.5 47 241.0 48 224.0 49 198.5 50 168.0 51 160.5 52 128.5 53 91.5 54 81.5 55 66.5 56 44.0 57 29.0 58 21.5 59 18.5 60 15.5 61 11.5 62 8.0 63 6.0 64 3.5 65 3.0 66 2.0 67 0.5 68 1.5 69 2.5 70 2.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.06999999999999999 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29435483870968 98.5 2 0.655241935483871 1.3 3 0.025201612903225805 0.075 4 0.0 0.0 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 5 0.125 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.8250000000000002 0.0 0.0 0.0 0.0 112-113 1.975 0.0 0.0 0.0 0.0 114-115 2.175 0.0 0.0 0.0 0.0 116-117 2.5374999999999996 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0 0.0 0.0 120-121 2.9749999999999996 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.475 0.0 0.0 0.0 0.0 126-127 3.7750000000000004 0.0 0.0 0.0 0.0 128-129 4.1 0.0 0.0 0.0 0.0 130-131 4.3125 0.0 0.0 0.0 0.0 132-133 4.5875 0.0 0.0 0.0 0.0 134-135 4.725 0.0 0.0 0.0 0.0 136-137 5.075 0.0 0.0 0.0 0.0 138-139 5.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTGGC 10 0.006830828 145.0 7 TATTTTA 10 0.006830828 145.0 3 >>END_MODULE SRR7169890 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169890_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.309 34.0 33.0 34.0 33.0 34.0 2 33.362 34.0 33.0 34.0 33.0 34.0 3 33.38975 34.0 33.0 34.0 33.0 34.0 4 33.3675 34.0 33.0 34.0 33.0 34.0 5 33.31675 34.0 33.0 34.0 33.0 34.0 6 37.4335 38.0 38.0 38.0 38.0 38.0 7 37.49 38.0 38.0 38.0 38.0 38.0 8 37.5125 38.0 38.0 38.0 38.0 38.0 9 37.56675 38.0 38.0 38.0 38.0 38.0 10-14 37.50315 38.0 38.0 38.0 38.0 38.0 15-19 37.411950000000004 38.0 38.0 38.0 37.8 38.0 20-24 37.39375 38.0 38.0 38.0 38.0 38.0 25-29 37.28795 38.0 38.0 38.0 37.6 38.0 30-34 37.24955 38.0 38.0 38.0 37.2 38.0 35-39 36.82695 38.0 38.0 38.0 35.6 38.0 40-44 37.299350000000004 38.0 38.0 38.0 37.2 38.0 45-49 37.3932 38.0 38.0 38.0 38.0 38.0 50-54 37.36775 38.0 38.0 38.0 38.0 38.0 55-59 37.3574 38.0 38.0 38.0 37.6 38.0 60-64 37.18635 38.0 38.0 38.0 37.2 38.0 65-69 37.23905 38.0 38.0 38.0 37.0 38.0 70-74 37.25945 38.0 38.0 38.0 37.0 38.0 75-79 37.232899999999994 38.0 38.0 38.0 37.0 38.0 80-84 37.10635 38.0 38.0 38.0 36.8 38.0 85-89 36.571600000000004 38.0 37.8 38.0 35.0 38.0 90-94 36.887950000000004 38.0 38.0 38.0 35.6 38.0 95-99 36.92545 38.0 38.0 38.0 36.0 38.0 100-104 36.77525 38.0 38.0 38.0 35.6 38.0 105-109 36.473949999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.133599999999994 38.0 37.4 38.0 32.6 38.0 115-119 36.4317 38.0 38.0 38.0 34.2 38.0 120-124 36.3531 38.0 38.0 38.0 34.0 38.0 125-129 35.59205000000001 38.0 36.8 38.0 30.0 38.0 130-134 35.9956 38.0 38.0 38.0 33.4 38.0 135-139 35.5521 38.0 36.4 38.0 31.0 38.0 140-144 35.008700000000005 38.0 35.4 38.0 29.0 38.0 145-149 33.4139 38.0 32.6 38.0 21.4 38.0 150-151 30.203249999999997 35.5 28.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 2.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 1.0 13 0.0 14 2.0 15 1.0 16 3.0 17 2.0 18 2.0 19 7.0 20 6.0 21 4.0 22 2.0 23 1.0 24 10.0 25 8.0 26 8.0 27 10.0 28 18.0 29 23.0 30 20.0 31 30.0 32 56.0 33 67.0 34 123.0 35 229.0 36 642.0 37 2711.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.050000000000004 20.925 14.799999999999999 25.224999999999998 2 26.950000000000003 27.05 27.450000000000003 18.55 3 21.25 30.525000000000002 29.049999999999997 19.175 4 24.349999999999998 33.175 22.650000000000002 19.825 5 24.05 34.625 21.55 19.775000000000002 6 22.025 37.325 22.95 17.7 7 20.275000000000002 22.85 36.325 20.549999999999997 8 22.625 25.324999999999996 25.8 26.25 9 21.875 27.075 28.075 22.975 10-14 23.419999999999998 28.89 25.490000000000002 22.2 15-19 23.765 28.01 27.57 20.655 20-24 23.285 28.134999999999998 27.705000000000002 20.875 25-29 23.28 28.355000000000004 26.724999999999998 21.64 30-34 23.47 28.139999999999997 27.395000000000003 20.995 35-39 23.665 28.294999999999998 27.084999999999997 20.955 40-44 23.66 28.34 26.77 21.23 45-49 23.775 27.700000000000003 27.250000000000004 21.275 50-54 23.599999999999998 28.095 27.35 20.955 55-59 23.84 27.150000000000002 27.884999999999998 21.125 60-64 23.585 27.63 27.675 21.11 65-69 24.11 27.37 27.965 20.555 70-74 23.885 27.534999999999997 27.265 21.315 75-79 23.799999999999997 27.455000000000002 27.865000000000002 20.880000000000003 80-84 23.544999999999998 27.93 27.47 21.055 85-89 23.89 27.55 27.365000000000002 21.195 90-94 23.575 27.834999999999997 27.529999999999998 21.060000000000002 95-99 24.169999999999998 27.865000000000002 27.015 20.95 100-104 24.05 27.105 28.12 20.724999999999998 105-109 24.240000000000002 27.375 27.35 21.035 110-114 24.135 27.52 27.48 20.865000000000002 115-119 24.555 27.67 27.555000000000003 20.22 120-124 24.39 27.655 27.445000000000004 20.51 125-129 24.29 27.345000000000002 27.67 20.695 130-134 24.756189047261813 28.057014253563388 27.231807951987996 19.954988747186796 135-139 24.195 27.845 27.505000000000003 20.455000000000002 140-144 24.560000000000002 27.700000000000003 27.21 20.53 145-149 24.515 28.03 27.405 20.05 150-151 24.4875 28.4125 27.0875 20.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 1.0 24 1.0 25 1.0 26 2.0 27 3.0 28 4.0 29 5.0 30 7.0 31 11.0 32 13.0 33 15.5 34 30.0 35 39.5 36 48.0 37 77.5 38 110.5 39 155.5 40 195.5 41 230.0 42 256.0 43 274.5 44 302.0 45 300.0 46 279.0 47 272.0 48 258.5 49 227.0 50 200.0 51 161.5 52 127.5 53 99.5 54 77.5 55 60.5 56 38.0 57 29.0 58 21.5 59 12.5 60 9.5 61 7.5 62 8.0 63 6.0 64 3.5 65 4.0 66 2.5 67 2.5 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.025 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.4273504273504274 0.8500000000000001 3 0.025138260432378077 0.075 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.375 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.8125 0.0 0.0 0.0 0.0 122-123 3.0625 0.0 0.0 0.0 0.0 124-125 3.3 0.0 0.0 0.0 0.0 126-127 3.5999999999999996 0.0 0.0 0.0 0.0 128-129 3.9375 0.0 0.0 0.0 0.0 130-131 4.15 0.0 0.0 0.0 0.0 132-133 4.4 0.0 0.0 0.0 0.0 134-135 4.525 0.0 0.0 0.0 0.0 136-137 4.8375 0.0 0.0 0.0 0.0 138-139 5.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTCGA 10 0.006830828 145.0 7 >>END_MODULE Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806247 spots for SRR7169890.sra Written 806247 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra Read 806235 spots for SRR7169890.sra Written 806235 spots for SRR7169890.sra SRR ids: ['SRR7169890.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5ou5oo88 SRR7169890.sra spots: 16124712 blocks: [[1, 806235], [806236, 1612470], [1612471, 2418705], [2418706, 3224940], [3224941, 4031175], [4031176, 4837410], [4837411, 5643645], [5643646, 6449880], [6449881, 7256115], [7256116, 8062350], [8062351, 8868585], [8868586, 9674820], [9674821, 10481055], [10481056, 11287290], [11287291, 12093525], [12093526, 12899760], [12899761, 13705995], [13705996, 14512230], [14512231, 15318465], [15318466, 16124712]] SRR7169890 file size 5442435 SRR7169890 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169890 SRR7169890_1.fastq SRR7169890_2.fastq Input file: SRR7169890_1.fastq Paired file: SRR7169890_2.fastq trimmed: SRR7169890-trimmed-pair1.fastq, SRR7169890-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:17:41 2025 >> started Wed Feb 12 01:17:58 2025 >> done (17.047s) 16124712 read pairs processed; of these: 24494 ( 0.15%) short read pairs filtered out after trimming by size control 38237 ( 0.24%) empty read pairs filtered out after trimming by size control 16061981 (99.61%) read pairs available; of these: 7077742 (44.07%) trimmed read pairs available after processing 8984239 (55.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 7 0.00% 20 10 0.00% 21 6 0.00% 22 16 0.00% 23 5 0.00% 24 2 0.00% 25 11 0.00% 26 8 0.00% 27 12 0.00% 28 10 0.00% 29 9 0.00% 30 11 0.00% 31 9 0.00% 32 14 0.00% 33 17 0.00% 34 17 0.00% 35 14 0.00% 36 15 0.00% 37 13 0.00% 38 34 0.00% 39 19 0.00% 40 31 0.00% 41 34 0.00% 42 31 0.00% 43 22 0.00% 44 39 0.00% 45 41 0.00% 46 65 0.00% 47 64 0.00% 48 75 0.00% 49 97 0.00% 50 112 0.00% 51 132 0.00% 52 139 0.00% 53 169 0.00% 54 199 0.00% 55 196 0.00% 56 233 0.00% 57 230 0.00% 58 269 0.00% 59 326 0.00% 60 402 0.00% 61 459 0.00% 62 531 0.00% 63 586 0.00% 64 649 0.00% 65 685 0.00% 66 769 0.00% 67 827 0.01% 68 925 0.01% 69 1125 0.01% 70 1294 0.01% 71 1487 0.01% 72 1694 0.01% 73 1951 0.01% 74 2139 0.01% 75 2398 0.01% 76 2844 0.02% 77 3530 0.02% 78 3424 0.02% 79 3440 0.02% 80 3809 0.02% 81 4173 0.03% 82 4948 0.03% 83 5496 0.03% 84 6643 0.04% 85 7753 0.05% 86 8149 0.05% 87 8548 0.05% 88 9269 0.06% 89 9601 0.06% 90 10005 0.06% 91 10352 0.06% 92 11191 0.07% 93 12068 0.08% 94 12742 0.08% 95 13394 0.08% 96 13529 0.08% 97 13832 0.09% 98 14153 0.09% 99 14396 0.09% 100 15408 0.10% 101 15715 0.10% 102 16809 0.10% 103 17498 0.11% 104 18145 0.11% 105 19019 0.12% 106 19308 0.12% 107 19659 0.12% 108 20000 0.12% 109 20294 0.13% 110 20914 0.13% 111 21504 0.13% 112 22251 0.14% 113 23201 0.14% 114 24271 0.15% 115 25616 0.16% 116 25907 0.16% 117 26281 0.16% 118 26252 0.16% 119 26408 0.16% 120 26594 0.17% 121 27170 0.17% 122 28161 0.18% 123 29679 0.18% 124 30747 0.19% 125 31897 0.20% 126 33057 0.21% 127 33885 0.21% 128 34377 0.21% 129 35904 0.22% 130 36530 0.23% 131 37910 0.24% 132 39169 0.24% 133 41412 0.26% 134 43756 0.27% 135 46587 0.29% 136 48769 0.30% 137 51443 0.32% 138 54854 0.34% 139 58094 0.36% 140 62584 0.39% 141 68872 0.43% 142 75675 0.47% 143 85581 0.53% 144 101129 0.63% 145 123504 0.77% 146 156567 0.97% 147 215455 1.34% 148 331451 2.06% 149 695981 4.33% 150 3738513 23.28% 151 8984239 55.93% 16061981 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=38 prefix-density=0.26 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCCCGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=299.79 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=18.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=6.40 fanout-score-rank=23 prefix-density=0.34 prefix-fanout=4.4 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCAT criterion=fanout-score sequence-density=0.13 sequence-density-rank=14 fanout-score=47.67 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=12.0 sequence=TGTTGGTGGTGG SRR7169890 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:18:42 Started mapping on | Feb 12 01:18:42 Finished on | Feb 12 01:20:31 Mapping speed, Million of reads per hour | 530.49 Number of input reads | 16061981 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14864208 Uniquely mapped reads % | 92.54% Average mapped length | 294.09 Number of splices: Total | 13545871 Number of splices: Annotated (sjdb) | 13312150 Number of splices: GT/AG | 13347865 Number of splices: GC/AG | 156309 Number of splices: AT/AC | 10556 Number of splices: Non-canonical | 31141 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 278063 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 17405 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.59% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 941596 941596 941596 N_multimapping 278063 278063 278063 N_noFeature 283782 14689983 340521 N_ambiguous 181769 1043 63592 UnstrandedReadsAssigned:14398657 PositiveStrandReadsAssigned:173182 NegativeStrandReadsAssigned:14460095 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169890 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169890-trimmed-pair1.fastq SRR7169890-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,061,981 reads, 14,372,982 reads pseudoaligned [quant] estimated average fragment length: 259.766 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52401 SRR7169890.ke.tsv 34699 SRR7169890.se.tsv 87100 total ==> SRR7169890.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.23 291 10.2654 Potri.005G024800.1.v4.1 1035 776.234 39 3.11803 Potri.004G059700.1.v4.1 961 702.271 2 0.176739 Potri.007G009000.2.v4.1 1416 1157.23 0 0 Potri.003G141000.2.v4.1 2943 2684.23 235.033 5.43396 Potri.016G087400.1.v4.1 270 77.8989 1613 1285.02 Potri.015G069301.1.v4.1 564 309.563 0 0 Potri.010G195200.1.v4.1 1773 1514.23 15 0.614761 Potri.012G127500.1.v4.1 977 718.255 5276 455.863 ==> SRR7169890.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1311 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 279 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169890 completed mapping pipeline successfully