Starting /dee2/code/volunteer_pipeline.sh SRR7169891 current disk space = 3050835054592 free memory = 1547097760 SRR7169891 SRAfilesize cc0c515aa804c77dc71000d9bb52c9d2 SRR7169891.sra SRR7169891.sra file validated SRR7169891 is paired end SRR7169891 is conventional basespace SRR7169891 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169891_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.7795 32.0 25.0 33.0 18.0 33.0 2 27.34175 29.0 25.0 31.0 18.0 33.0 3 30.42825 31.0 29.0 33.0 27.0 33.0 4 32.11375 33.0 31.0 33.0 30.0 33.0 5 32.69375 33.0 33.0 33.0 32.0 34.0 6 36.80925 38.0 37.0 38.0 35.0 38.0 7 36.08725 38.0 37.0 38.0 33.0 38.0 8 37.26 38.0 38.0 38.0 36.0 38.0 9 37.48675 38.0 38.0 38.0 37.0 38.0 10-14 37.639 38.0 38.0 38.0 37.8 38.0 15-19 37.657799999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.60985 38.0 38.0 38.0 37.8 38.0 25-29 37.669700000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.60730000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.5813 38.0 38.0 38.0 38.0 38.0 40-44 37.4358 38.0 38.0 38.0 37.2 38.0 45-49 37.58155 38.0 38.0 38.0 38.0 38.0 50-54 37.42995 38.0 38.0 38.0 37.2 38.0 55-59 37.37415 38.0 38.0 38.0 37.0 38.0 60-64 37.3303 38.0 38.0 38.0 37.0 38.0 65-69 37.24485 38.0 38.0 38.0 36.4 38.0 70-74 37.1894 38.0 38.0 38.0 36.0 38.0 75-79 37.14295 38.0 38.0 38.0 36.0 38.0 80-84 37.05219999999999 38.0 38.0 38.0 35.8 38.0 85-89 36.6514 38.0 38.0 38.0 34.6 38.0 90-94 36.47955 38.0 37.6 38.0 33.8 38.0 95-99 36.49315 38.0 37.6 38.0 33.8 38.0 100-104 35.526799999999994 38.0 36.4 38.0 30.0 38.0 105-109 36.2672 38.0 37.0 38.0 33.4 38.0 110-114 36.22255 38.0 37.0 38.0 33.6 38.0 115-119 35.73479999999999 38.0 36.4 38.0 31.6 38.0 120-124 34.9307 38.0 35.0 38.0 25.8 38.0 125-129 35.44 38.0 36.0 38.0 31.0 38.0 130-134 34.25615 38.0 34.4 38.0 24.2 38.0 135-139 34.84295000000001 38.0 35.0 38.0 28.0 38.0 140-144 33.8277 38.0 34.2 38.0 22.4 38.0 145-149 32.6223 37.2 32.4 38.0 18.8 38.0 150-151 29.00025 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 4.0 13 0.0 14 0.0 15 2.0 16 1.0 17 2.0 18 1.0 19 2.0 20 5.0 21 1.0 22 3.0 23 6.0 24 2.0 25 5.0 26 3.0 27 12.0 28 19.0 29 15.0 30 30.0 31 45.0 32 78.0 33 123.0 34 216.0 35 502.0 36 1191.0 37 1731.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.8 11.675 10.325 34.2 2 25.4 13.5 33.875 27.224999999999998 3 20.775 19.8 25.05 34.375 4 21.525 27.6 24.275 26.6 5 23.375 32.275 23.474999999999998 20.875 6 21.925 34.325 24.025 19.725 7 14.475 28.125 41.475 15.925 8 19.025 26.700000000000003 30.55 23.724999999999998 9 16.675 25.224999999999998 33.375 24.725 10-14 19.81 30.490000000000002 27.32 22.38 15-19 20.5 28.444999999999997 27.605 23.45 20-24 20.375 28.845 27.595 23.185 25-29 20.76 28.470000000000002 27.88 22.89 30-34 19.85 29.04 27.73 23.380000000000003 35-39 20.66 29.15 27.150000000000002 23.04 40-44 20.025000000000002 29.799999999999997 27.575 22.6 45-49 20.09 28.68 27.32 23.91 50-54 20.635 28.64 27.565 23.16 55-59 20.61 27.88 27.96 23.549999999999997 60-64 20.349999999999998 29.020000000000003 27.279999999999998 23.35 65-69 20.305 28.1 27.57 24.025 70-74 20.405 28.475 27.625 23.494999999999997 75-79 20.485 28.16 27.639999999999997 23.715 80-84 20.41 28.294999999999998 27.85 23.445 85-89 20.825 28.244999999999997 28.04 22.89 90-94 20.73 28.075 27.650000000000002 23.544999999999998 95-99 20.36 28.355000000000004 27.625 23.66 100-104 20.74 28.28 27.495000000000005 23.485 105-109 20.69 27.915 27.825 23.57 110-114 20.935000000000002 28.075 27.485 23.505000000000003 115-119 20.810000000000002 28.555000000000003 27.605 23.03 120-124 20.62 28.955 27.015 23.41 125-129 21.044999999999998 28.105000000000004 27.255000000000003 23.595 130-134 20.19 28.694999999999997 27.485 23.630000000000003 135-139 20.794999999999998 28.165000000000003 27.455000000000002 23.585 140-144 21.54 28.244999999999997 26.43 23.785 145-149 20.745 27.395000000000003 27.644999999999996 24.215 150-151 19.9875 28.799999999999997 27.6 23.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 2.0 24 4.0 25 5.0 26 4.5 27 6.0 28 7.5 29 13.0 30 16.5 31 22.5 32 34.0 33 46.5 34 52.5 35 70.0 36 94.0 37 101.5 38 119.5 39 152.0 40 176.5 41 203.0 42 234.0 43 260.0 44 275.5 45 273.0 46 273.0 47 265.0 48 243.5 49 218.5 50 182.0 51 149.0 52 127.5 53 102.5 54 80.5 55 62.5 56 37.5 57 22.0 58 17.5 59 11.5 60 7.5 61 6.0 62 3.5 63 3.5 64 3.0 65 1.5 66 1.5 67 0.5 68 0.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.3625 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.6124999999999998 0.0 0.0 0.0 0.0 120-121 1.85 0.0 0.0 0.0 0.0 122-123 2.1125 0.0 0.0 0.0 0.0 124-125 2.2750000000000004 0.0 0.0 0.0 0.0 126-127 2.525 0.0 0.0 0.0 0.0 128-129 2.7375 0.0 0.0 0.0 0.0 130-131 3.0250000000000004 0.0 0.0 0.0 0.0 132-133 3.3499999999999996 0.0 0.0 0.0 0.0 134-135 3.6125 0.0 0.0 0.0 0.0 136-137 3.8 0.0 0.0 0.0 0.0 138-139 3.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169891 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169891_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.21 34.0 33.0 34.0 33.0 34.0 2 33.343 34.0 33.0 34.0 33.0 34.0 3 33.373 34.0 33.0 34.0 33.0 34.0 4 33.34775 34.0 33.0 34.0 33.0 34.0 5 33.35525 34.0 33.0 34.0 33.0 34.0 6 37.4195 38.0 38.0 38.0 38.0 38.0 7 37.4655 38.0 38.0 38.0 38.0 38.0 8 37.511 38.0 38.0 38.0 38.0 38.0 9 37.43875 38.0 38.0 38.0 38.0 38.0 10-14 37.4692 38.0 38.0 38.0 38.0 38.0 15-19 37.4188 38.0 38.0 38.0 38.0 38.0 20-24 37.1807 38.0 38.0 38.0 36.8 38.0 25-29 36.682 38.0 37.8 38.0 34.6 38.0 30-34 36.4536 38.0 37.8 38.0 33.6 38.0 35-39 37.108 38.0 38.0 38.0 36.2 38.0 40-44 36.980900000000005 38.0 38.0 38.0 35.8 38.0 45-49 36.996249999999996 38.0 38.0 38.0 36.0 38.0 50-54 37.2033 38.0 38.0 38.0 36.8 38.0 55-59 37.29705 38.0 38.0 38.0 37.0 38.0 60-64 37.15845 38.0 38.0 38.0 36.8 38.0 65-69 37.1488 38.0 38.0 38.0 36.8 38.0 70-74 37.186249999999994 38.0 38.0 38.0 37.0 38.0 75-79 37.1841 38.0 38.0 38.0 36.8 38.0 80-84 37.009699999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.96075 38.0 38.0 38.0 36.0 38.0 90-94 37.0034 38.0 38.0 38.0 36.0 38.0 95-99 36.8844 38.0 38.0 38.0 36.0 38.0 100-104 36.712 38.0 38.0 38.0 34.8 38.0 105-109 36.67569999999999 38.0 38.0 38.0 34.8 38.0 110-114 36.5961 38.0 38.0 38.0 34.6 38.0 115-119 36.3004 38.0 38.0 38.0 34.2 38.0 120-124 36.1262 38.0 37.6 38.0 33.4 38.0 125-129 36.00675 38.0 37.4 38.0 33.2 38.0 130-134 35.68835 38.0 36.6 38.0 32.2 38.0 135-139 35.387649999999994 38.0 36.0 38.0 31.0 38.0 140-144 35.29195 38.0 36.0 38.0 30.6 38.0 145-149 34.654999999999994 38.0 35.4 38.0 29.0 38.0 150-151 30.314124999999997 35.5 28.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 2.0 14 3.0 15 1.0 16 2.0 17 2.0 18 0.0 19 4.0 20 4.0 21 5.0 22 7.0 23 6.0 24 9.0 25 7.0 26 18.0 27 13.0 28 15.0 29 19.0 30 29.0 31 38.0 32 64.0 33 66.0 34 139.0 35 227.0 36 639.0 37 2674.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.55 21.55 14.975 25.924999999999997 2 28.307076769192296 25.63140785196299 29.75743935983996 16.30407601900475 3 20.45 28.7 30.65 20.200000000000003 4 22.85571392848212 34.08352088022005 24.656164041010253 18.404601150287572 5 25.18129532383096 35.783945986496626 21.280320080020005 17.75443860965241 6 20.625 37.7 21.975 19.7 7 19.75 22.925 37.675 19.650000000000002 8 21.125 25.124999999999996 27.975 25.775 9 21.05 25.874999999999996 29.5 23.575 10-14 22.935 29.5 26.279999999999998 21.285 15-19 23.04 27.860000000000003 28.18 20.919999999999998 20-24 23.09 27.305 28.095 21.51 25-29 22.775000000000002 28.01 27.794999999999998 21.42 30-34 22.545 28.76 27.735 20.96 35-39 22.509999999999998 28.09 27.975 21.425 40-44 23.225 28.42 27.375 20.979999999999997 45-49 22.575 28.21 27.815 21.4 50-54 23.580000000000002 27.860000000000003 28.02 20.54 55-59 23.09 27.525 28.599999999999998 20.785 60-64 22.95 28.310000000000002 27.395000000000003 21.345 65-69 23.35 27.91 27.82 20.919999999999998 70-74 23.455000000000002 27.6 28.105000000000004 20.84 75-79 23.03 27.79 28.125 21.055 80-84 23.669999999999998 27.985 27.775 20.57 85-89 23.244999999999997 28.43 27.794999999999998 20.53 90-94 23.105 28.349999999999998 27.88 20.665 95-99 23.62 28.110000000000003 27.275 20.995 100-104 23.62 27.845 27.765 20.77 105-109 23.599999999999998 27.834999999999997 27.889999999999997 20.674999999999997 110-114 23.47 28.29 27.189999999999998 21.05 115-119 23.685000000000002 27.465 27.689999999999998 21.16 120-124 23.835 28.02 27.345000000000002 20.8 125-129 23.45 28.37 27.450000000000003 20.73 130-134 24.035 27.955000000000002 27.55 20.46 135-139 23.95 27.72 27.595 20.735 140-144 23.835 28.395 26.855 20.915 145-149 24.375 27.775 27.555000000000003 20.294999999999998 150-151 24.9125 27.325 28.0625 19.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.5 25 2.0 26 3.5 27 3.0 28 3.0 29 5.5 30 7.5 31 15.5 32 29.0 33 35.5 34 48.0 35 63.5 36 75.5 37 97.5 38 127.5 39 158.5 40 202.0 41 240.5 42 252.0 43 273.0 44 292.5 45 300.5 46 304.0 47 268.5 48 229.0 49 199.0 50 162.5 51 147.5 52 126.0 53 93.0 54 67.5 55 49.5 56 37.0 57 22.5 58 14.5 59 13.5 60 9.5 61 4.0 62 2.5 63 2.0 64 2.0 65 2.0 66 1.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.4874999999999998 0.0 0.0 0.0 0.0 118-119 1.6375000000000002 0.0 0.0 0.0 0.0 120-121 1.875 0.0 0.0 0.0 0.0 122-123 2.1624999999999996 0.0 0.0 0.0 0.0 124-125 2.3499999999999996 0.0 0.0 0.0 0.0 126-127 2.6 0.0 0.0 0.0 0.0 128-129 2.8125 0.0 0.0 0.0 0.0 130-131 3.0999999999999996 0.0 0.0 0.0 0.0 132-133 3.425 0.0 0.0 0.0 0.0 134-135 3.7125 0.0 0.0 0.0 0.0 136-137 3.9749999999999996 0.0 0.0 0.0 0.0 138-139 4.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTAAC 10 0.006830828 145.0 4 >>END_MODULE Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627424 spots for SRR7169891.sra Written 627424 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra Read 627406 spots for SRR7169891.sra Written 627406 spots for SRR7169891.sra SRR ids: ['SRR7169891.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8uawonu4 SRR7169891.sra spots: 12548138 blocks: [[1, 627406], [627407, 1254812], [1254813, 1882218], [1882219, 2509624], [2509625, 3137030], [3137031, 3764436], [3764437, 4391842], [4391843, 5019248], [5019249, 5646654], [5646655, 6274060], [6274061, 6901466], [6901467, 7528872], [7528873, 8156278], [8156279, 8783684], [8783685, 9411090], [9411091, 10038496], [10038497, 10665902], [10665903, 11293308], [11293309, 11920714], [11920715, 12548138]] SRR7169891 file size 4230451 SRR7169891 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169891 SRR7169891_1.fastq SRR7169891_2.fastq Input file: SRR7169891_1.fastq Paired file: SRR7169891_2.fastq trimmed: SRR7169891-trimmed-pair1.fastq, SRR7169891-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:47:01 2025 >> started Wed Feb 12 01:47:16 2025 >> done (14.750s) 12548138 read pairs processed; of these: 9023 ( 0.07%) short read pairs filtered out after trimming by size control 7951 ( 0.06%) empty read pairs filtered out after trimming by size control 12531164 (99.86%) read pairs available; of these: 5416486 (43.22%) trimmed read pairs available after processing 7114678 (56.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 2 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 5 0.00% 25 2 0.00% 26 0 0.00% 27 2 0.00% 28 2 0.00% 29 0 0.00% 30 6 0.00% 31 1 0.00% 32 4 0.00% 33 3 0.00% 34 4 0.00% 35 5 0.00% 36 8 0.00% 37 5 0.00% 38 7 0.00% 39 11 0.00% 40 12 0.00% 41 18 0.00% 42 15 0.00% 43 9 0.00% 44 15 0.00% 45 19 0.00% 46 14 0.00% 47 36 0.00% 48 37 0.00% 49 37 0.00% 50 41 0.00% 51 44 0.00% 52 63 0.00% 53 66 0.00% 54 80 0.00% 55 73 0.00% 56 105 0.00% 57 105 0.00% 58 96 0.00% 59 127 0.00% 60 150 0.00% 61 212 0.00% 62 234 0.00% 63 258 0.00% 64 282 0.00% 65 322 0.00% 66 341 0.00% 67 372 0.00% 68 429 0.00% 69 514 0.00% 70 585 0.00% 71 649 0.01% 72 805 0.01% 73 868 0.01% 74 943 0.01% 75 1085 0.01% 76 1189 0.01% 77 1323 0.01% 78 1395 0.01% 79 1547 0.01% 80 1742 0.01% 81 2014 0.02% 82 2260 0.02% 83 2493 0.02% 84 3286 0.03% 85 3540 0.03% 86 3788 0.03% 87 4081 0.03% 88 4362 0.03% 89 4524 0.04% 90 4820 0.04% 91 5206 0.04% 92 5525 0.04% 93 6051 0.05% 94 6353 0.05% 95 6746 0.05% 96 6818 0.05% 97 7048 0.06% 98 7235 0.06% 99 7539 0.06% 100 8125 0.06% 101 8395 0.07% 102 8595 0.07% 103 9301 0.07% 104 9840 0.08% 105 10236 0.08% 106 10448 0.08% 107 10661 0.09% 108 10879 0.09% 109 11052 0.09% 110 11612 0.09% 111 11881 0.09% 112 12573 0.10% 113 13126 0.10% 114 13708 0.11% 115 14221 0.11% 116 14748 0.12% 117 14858 0.12% 118 15356 0.12% 119 15252 0.12% 120 15732 0.13% 121 16340 0.13% 122 16766 0.13% 123 17747 0.14% 124 18205 0.15% 125 19380 0.15% 126 20164 0.16% 127 20964 0.17% 128 21970 0.18% 129 22963 0.18% 130 23739 0.19% 131 24812 0.20% 132 26452 0.21% 133 28272 0.23% 134 29550 0.24% 135 32003 0.26% 136 34026 0.27% 137 36947 0.29% 138 40103 0.32% 139 43444 0.35% 140 47714 0.38% 141 53695 0.43% 142 60301 0.48% 143 68754 0.55% 144 83325 0.66% 145 103548 0.83% 146 133110 1.06% 147 184553 1.47% 148 291716 2.33% 149 600500 4.79% 150 2934799 23.42% 151 7114678 56.78% 12531164 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=40 prefix-density=0.19 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=704.44 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=22.7 sequence=AAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=36 prefix-density=0.28 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=37 fanout-score=57.61 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=11.6 sequence=AGAAAATGGAAACCTTTCTATTCAC SRR7169891 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:48:00 Started mapping on | Feb 12 01:48:00 Finished on | Feb 12 01:49:20 Mapping speed, Million of reads per hour | 563.90 Number of input reads | 12531164 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11861750 Uniquely mapped reads % | 94.66% Average mapped length | 295.68 Number of splices: Total | 11292720 Number of splices: Annotated (sjdb) | 11110729 Number of splices: GT/AG | 11135393 Number of splices: GC/AG | 125641 Number of splices: AT/AC | 8574 Number of splices: Non-canonical | 23112 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 221798 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 13174 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.44% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 456403 456403 456403 N_multimapping 221798 221798 221798 N_noFeature 270975 11725084 320316 N_ambiguous 137162 715 49327 UnstrandedReadsAssigned:11453613 PositiveStrandReadsAssigned:135951 NegativeStrandReadsAssigned:11492107 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169891 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169891-trimmed-pair1.fastq SRR7169891-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,531,164 reads, 11,380,090 reads pseudoaligned [quant] estimated average fragment length: 289.627 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52401 SRR7169891.ke.tsv 34699 SRR7169891.se.tsv 87100 total ==> SRR7169891.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1729.37 241 12.6099 Potri.005G024800.1.v4.1 1035 746.373 20 2.4247 Potri.004G059700.1.v4.1 961 672.415 3 0.403709 Potri.007G009000.2.v4.1 1416 1127.37 0 0 Potri.003G141000.2.v4.1 2943 2654.37 193.117 6.5833 Potri.016G087400.1.v4.1 270 74.1103 1105 1349.17 Potri.015G069301.1.v4.1 564 283.634 0 0 Potri.010G195200.1.v4.1 1773 1484.37 9 0.548635 Potri.012G127500.1.v4.1 977 688.391 2574 338.343 ==> SRR7169891.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1049 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 217 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169891 completed mapping pipeline successfully