Starting /dee2/code/volunteer_pipeline.sh SRR7169892 current disk space = 3051225214976 free memory = 884507752 SRR7169892 SRAfilesize dfc9fbb5cbb3720cf52a9d9861016fcc SRR7169892.sra SRR7169892.sra file validated SRR7169892 is paired end SRR7169892 is conventional basespace SRR7169892 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169892_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.3 30.0 18.0 33.0 18.0 33.0 2 28.46475 30.0 27.0 31.0 18.0 33.0 3 31.4545 33.0 31.0 33.0 29.0 33.0 4 32.12925 33.0 33.0 33.0 30.0 34.0 5 32.75875 33.0 33.0 33.0 32.0 34.0 6 37.00575 38.0 37.0 38.0 35.0 38.0 7 37.4605 38.0 38.0 38.0 37.0 38.0 8 37.514 38.0 38.0 38.0 37.0 38.0 9 37.63625 38.0 38.0 38.0 38.0 38.0 10-14 37.6041 38.0 38.0 38.0 38.0 38.0 15-19 37.54365 38.0 38.0 38.0 38.0 38.0 20-24 37.523250000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.535250000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.5193 38.0 38.0 38.0 38.0 38.0 35-39 37.49485 38.0 38.0 38.0 37.8 38.0 40-44 37.4289 38.0 38.0 38.0 37.2 38.0 45-49 37.423350000000006 38.0 38.0 38.0 37.2 38.0 50-54 37.3031 38.0 38.0 38.0 37.0 38.0 55-59 37.226 38.0 38.0 38.0 36.4 38.0 60-64 37.19835 38.0 38.0 38.0 36.4 38.0 65-69 37.13205000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.98435 38.0 38.0 38.0 36.0 38.0 75-79 36.9041 38.0 38.0 38.0 36.0 38.0 80-84 36.820299999999996 38.0 38.0 38.0 35.8 38.0 85-89 36.7297 38.0 38.0 38.0 34.8 38.0 90-94 36.6591 38.0 38.0 38.0 34.8 38.0 95-99 36.537099999999995 38.0 38.0 38.0 34.2 38.0 100-104 36.232 38.0 38.0 38.0 34.0 38.0 105-109 35.9794 38.0 37.0 38.0 33.0 38.0 110-114 35.82764999999999 38.0 37.0 38.0 32.8 38.0 115-119 35.794149999999995 38.0 37.0 38.0 32.6 38.0 120-124 35.41205000000001 38.0 36.2 38.0 29.8 38.0 125-129 35.06495 38.0 36.0 38.0 28.2 38.0 130-134 34.891949999999994 38.0 35.8 38.0 27.8 38.0 135-139 34.7496 38.0 35.4 38.0 27.6 38.0 140-144 34.1734 38.0 35.0 38.0 24.4 38.0 145-149 33.75125 38.0 35.0 38.0 21.0 38.0 150-151 30.263 36.5 28.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 3.0 16 1.0 17 5.0 18 5.0 19 6.0 20 3.0 21 2.0 22 6.0 23 11.0 24 16.0 25 16.0 26 10.0 27 19.0 28 19.0 29 23.0 30 41.0 31 66.0 32 74.0 33 97.0 34 163.0 35 294.0 36 724.0 37 2390.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.13705583756345 14.340101522842641 9.568527918781726 31.95431472081218 2 22.95 15.075 32.9 29.075 3 18.75 22.375 26.75 32.125 4 20.625 29.049999999999997 23.275000000000002 27.05 5 23.0 29.799999999999997 24.525 22.675 6 19.575 34.9 23.75 21.775 7 14.45 27.05 40.050000000000004 18.45 8 18.275 27.675 29.825000000000003 24.224999999999998 9 16.2 26.875 32.375 24.55 10-14 19.255 29.794999999999998 27.400000000000002 23.549999999999997 15-19 19.575 29.395 27.205000000000002 23.825 20-24 19.34 29.720000000000002 27.13 23.810000000000002 25-29 20.075000000000003 29.235 27.24 23.45 30-34 19.68 28.945 27.37 24.005000000000003 35-39 20.05 29.9 26.179999999999996 23.87 40-44 19.75 29.38 26.979999999999997 23.89 45-49 20.175 28.705000000000002 27.055 24.065 50-54 20.26 29.695 26.674999999999997 23.369999999999997 55-59 19.445 29.145 27.27 24.14 60-64 19.625 28.645 27.279999999999998 24.45 65-69 19.62 29.285 26.58 24.515 70-74 19.88 29.599999999999998 26.625 23.895 75-79 19.91 29.189999999999998 26.82 24.08 80-84 19.98 28.33 27.075 24.615000000000002 85-89 20.630000000000003 27.71 27.450000000000003 24.21 90-94 20.28 28.999999999999996 26.615 24.104999999999997 95-99 20.32 28.265 27.134999999999998 24.279999999999998 100-104 20.175 28.38 26.640000000000004 24.805 105-109 20.465 27.825 27.415 24.295 110-114 20.635 29.099999999999998 26.584999999999997 23.68 115-119 19.81 28.595 26.77 24.825 120-124 20.369999999999997 28.24 26.889999999999997 24.5 125-129 20.674999999999997 27.884999999999998 27.41 24.03 130-134 20.26 28.165000000000003 27.565 24.01 135-139 20.46 28.299999999999997 26.71 24.529999999999998 140-144 19.775000000000002 28.57 26.590000000000003 25.064999999999998 145-149 20.565 28.465 26.985 23.985 150-151 21.0375 27.2625 27.2625 24.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 2.0 22 2.0 23 1.5 24 3.0 25 3.5 26 3.5 27 7.0 28 10.5 29 15.5 30 23.5 31 26.0 32 35.0 33 50.0 34 61.5 35 71.5 36 79.5 37 103.5 38 121.5 39 148.0 40 181.5 41 202.5 42 225.0 43 251.5 44 277.0 45 267.0 46 243.0 47 243.0 48 246.0 49 207.5 50 167.5 51 159.5 52 144.5 53 106.5 54 80.0 55 67.0 56 43.5 57 32.5 58 26.0 59 15.0 60 10.0 61 9.0 62 6.0 63 1.5 64 2.0 65 1.5 66 1.5 67 4.0 68 2.5 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62330487192365 99.175 2 0.3515821195379206 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.025113008538422906 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 5 0.125 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.7124999999999999 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.8624999999999998 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.2750000000000004 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.5875 0.0 0.0 0.0 0.0 120-121 2.7625 0.0 0.0 0.0 0.0 122-123 2.9749999999999996 0.0 0.0 0.0 0.0 124-125 3.1625 0.0 0.0 0.0 0.0 126-127 3.4625 0.0 0.0 0.0 0.0 128-129 3.625 0.0 0.0 0.0 0.0 130-131 3.75 0.0 0.0 0.0 0.0 132-133 4.0375 0.0 0.0 0.0 0.0 134-135 4.35 0.0 0.0 0.0 0.0 136-137 4.7375 0.0 0.0 0.0 0.0 138-139 5.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCTTT 10 0.006830828 145.0 9 GCACCTT 15 1.1411342E-4 145.0 8 >>END_MODULE SRR7169892 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169892_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5645 33.0 33.0 34.0 32.0 34.0 2 32.5445 33.0 33.0 34.0 32.0 34.0 3 32.5545 34.0 33.0 34.0 32.0 34.0 4 32.429 34.0 33.0 34.0 32.0 34.0 5 32.40225 34.0 33.0 34.0 32.0 34.0 6 36.52775 38.0 38.0 38.0 36.0 38.0 7 36.548 38.0 38.0 38.0 36.0 38.0 8 36.5695 38.0 38.0 38.0 36.0 38.0 9 36.52225 38.0 38.0 38.0 36.0 38.0 10-14 36.50105 38.0 38.0 38.0 36.0 38.0 15-19 36.42375 38.0 38.0 38.0 36.0 38.0 20-24 36.4687 38.0 38.0 38.0 36.0 38.0 25-29 36.43599999999999 38.0 38.0 38.0 36.0 38.0 30-34 36.358450000000005 38.0 38.0 38.0 35.6 38.0 35-39 36.3765 38.0 38.0 38.0 35.8 38.0 40-44 36.2608 38.0 38.0 38.0 35.2 38.0 45-49 36.160849999999996 38.0 38.0 38.0 34.6 38.0 50-54 36.21535 38.0 38.0 38.0 34.8 38.0 55-59 36.20245 38.0 38.0 38.0 35.2 38.0 60-64 36.1445 38.0 38.0 38.0 34.4 38.0 65-69 35.984449999999995 38.0 38.0 38.0 34.0 38.0 70-74 35.92229999999999 38.0 38.0 38.0 34.0 38.0 75-79 35.778549999999996 38.0 38.0 38.0 33.0 38.0 80-84 35.72895 38.0 38.0 38.0 33.0 38.0 85-89 35.626200000000004 38.0 38.0 38.0 33.0 38.0 90-94 35.5159 38.0 38.0 38.0 32.2 38.0 95-99 35.401799999999994 38.0 38.0 38.0 31.2 38.0 100-104 35.3022 38.0 38.0 38.0 30.6 38.0 105-109 35.1536 38.0 37.4 38.0 30.2 38.0 110-114 35.02735 38.0 37.0 38.0 29.0 38.0 115-119 34.848 38.0 37.0 38.0 28.2 38.0 120-124 34.59335 38.0 36.4 38.0 26.6 38.0 125-129 34.3714 38.0 36.0 38.0 25.0 38.0 130-134 34.036699999999996 38.0 35.6 38.0 23.0 38.0 135-139 33.675 38.0 35.0 38.0 19.8 38.0 140-144 33.2555 38.0 35.0 38.0 14.4 38.0 145-149 32.552800000000005 38.0 34.6 38.0 11.4 38.0 150-151 28.338124999999998 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 48.0 3 12.0 4 6.0 5 4.0 6 2.0 7 8.0 8 4.0 9 0.0 10 5.0 11 6.0 12 7.0 13 5.0 14 8.0 15 6.0 16 8.0 17 8.0 18 8.0 19 11.0 20 4.0 21 9.0 22 10.0 23 15.0 24 19.0 25 17.0 26 20.0 27 25.0 28 28.0 29 41.0 30 47.0 31 50.0 32 72.0 33 92.0 34 107.0 35 219.0 36 525.0 37 2544.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.51975987993997 22.26113056528264 16.50825412706353 21.710855427713856 2 27.95077850326469 27.046710195881467 27.850326469110996 17.152184831742844 3 21.608040201005025 29.47236180904523 28.79396984924623 20.125628140703515 4 24.47851218899221 32.822317165116864 23.498366423724555 19.200804222166372 5 24.729831615983915 35.41090726313144 21.563206835888415 18.29605428499623 6 22.414658634538153 35.79317269076305 22.71586345381526 19.076305220883537 7 21.129234629861983 23.663739021329988 35.33249686323714 19.87452948557089 8 21.982434127979925 25.395232120451695 27.50313676286073 25.119196988707653 9 23.393574297188753 25.502008032128515 28.012048192771083 23.09236947791165 10-14 24.767879548306148 28.707653701380174 25.19949811794228 21.324968632371395 15-19 23.824341279799246 28.516938519447933 27.267252195734002 20.39146800501882 20-24 23.98996235884567 28.642409033877037 26.770388958594733 20.59723964868256 25-29 23.844416562107902 28.426599749058973 26.39899623588457 21.329987452948558 30-34 24.030112923462987 28.1405269761606 26.659974905897116 21.169385194479297 35-39 23.673776662484318 28.99874529485571 26.409033877038894 20.91844416562108 40-44 23.92089941778759 28.10178678980125 27.188315599277253 20.78899819313391 45-49 23.64193192087559 28.004819761020183 27.67346119088262 20.67978712722161 50-54 24.249422632794456 28.200622552465106 27.040867556983635 20.509087257756804 55-59 24.628514056224898 27.309236947791167 27.59538152610442 20.466867469879517 60-64 23.902022787732772 27.917482306881492 26.803192290317725 21.37730261506801 65-69 24.41118867071762 27.454426756390298 27.58499472706272 20.549389845829356 70-74 23.85473176612417 27.963632710468154 27.004219409282697 21.177416114124973 75-79 24.321744372990352 27.3060691318328 27.76828778135048 20.603898713826364 80-84 24.18730844596292 27.558659498568055 27.618951916796462 20.635080138672564 85-89 23.65829145728643 28.155778894472363 27.391959798994975 20.79396984924623 90-94 23.606853926938346 27.576503693281744 28.07899100547711 20.7376513743028 95-99 24.88064726870697 27.644605256545557 27.378260214081106 20.096487260666365 100-104 24.587939698492463 26.934673366834172 27.82914572864322 20.648241206030153 105-109 23.982309779877376 27.53040506583576 27.75153281736858 20.735752336918285 110-114 24.023722169171233 27.406141629391367 28.01929939186812 20.55083680956928 115-119 24.39686369119421 28.13630880579011 26.79935665460394 20.66747084841174 120-124 24.203277370061326 28.189403840353876 27.540967125766564 20.066351663818235 125-129 24.83788267229679 27.39657165837229 27.471975066606348 20.293570602724575 130-134 25.350625848288345 27.62780877695672 27.074850449907 19.946714924847935 135-139 24.98868948876489 27.562459156487208 27.175388327552408 20.273463027195497 140-144 25.16213362827409 27.545120908953795 27.042380976320953 20.250364486451158 145-149 25.121914433663466 27.379216731184957 27.323915338595345 20.17495349655623 150-151 25.750911147417366 27.007666205856477 27.585773532738468 19.655649113987682 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 7.5 2 5.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 2.5 22 2.5 23 1.5 24 0.5 25 1.0 26 2.0 27 5.0 28 6.0 29 4.0 30 6.5 31 10.5 32 16.5 33 21.5 34 33.5 35 47.5 36 63.0 37 83.0 38 102.5 39 127.5 40 154.0 41 205.5 42 252.0 43 272.0 44 288.0 45 297.0 46 293.5 47 284.0 48 274.0 49 234.0 50 190.0 51 166.0 52 139.0 53 106.0 54 78.5 55 54.5 56 35.0 57 27.5 58 25.0 59 17.0 60 7.5 61 10.5 62 11.0 63 5.5 64 3.0 65 2.0 66 2.0 67 2.0 68 3.0 69 2.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.44999999999999996 3 0.5 4 0.525 5 0.525 6 0.4 7 0.375 8 0.375 9 0.4 10-14 0.375 15-19 0.375 20-24 0.375 25-29 0.375 30-34 0.375 35-39 0.375 40-44 0.38 45-49 0.41000000000000003 50-54 0.41000000000000003 55-59 0.4 60-64 0.385 65-69 0.43499999999999994 70-74 0.45999999999999996 75-79 0.48 80-84 0.485 85-89 0.5 90-94 0.49500000000000005 95-99 0.505 100-104 0.5 105-109 0.51 110-114 0.515 115-119 0.52 120-124 0.53 125-129 0.5349999999999999 130-134 0.5349999999999999 135-139 0.5349999999999999 140-144 0.545 145-149 0.545 150-151 0.5375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52153110047847 98.8 2 0.3777386048854193 0.75 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.02518257365902795 0.125 6 0.0 0.0 7 0.02518257365902795 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.6125 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.7249999999999996 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.1375 0.0 0.0 0.0 0.0 126-127 3.425 0.0 0.0 0.0 0.0 128-129 3.625 0.0 0.0 0.0 0.0 130-131 3.7750000000000004 0.0 0.0 0.0 0.0 132-133 4.0875 0.0 0.0 0.0 0.0 134-135 4.425 0.0 0.0 0.0 0.0 136-137 4.8375 0.0 0.0 0.0 0.0 138-139 5.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTACCG 10 0.006830828 145.0 1 >>END_MODULE Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613947 spots for SRR7169892.sra Written 613947 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra Read 613936 spots for SRR7169892.sra Written 613936 spots for SRR7169892.sra SRR ids: ['SRR7169892.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iw8zu_b9 SRR7169892.sra spots: 12278731 blocks: [[1, 613936], [613937, 1227872], [1227873, 1841808], [1841809, 2455744], [2455745, 3069680], [3069681, 3683616], [3683617, 4297552], [4297553, 4911488], [4911489, 5525424], [5525425, 6139360], [6139361, 6753296], [6753297, 7367232], [7367233, 7981168], [7981169, 8595104], [8595105, 9209040], [9209041, 9822976], [9822977, 10436912], [10436913, 11050848], [11050849, 11664784], [11664785, 12278731]] SRR7169892 file size 4139158 SRR7169892 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169892 SRR7169892_1.fastq SRR7169892_2.fastq Input file: SRR7169892_1.fastq Paired file: SRR7169892_2.fastq trimmed: SRR7169892-trimmed-pair1.fastq, SRR7169892-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:10:42 2025 >> started Wed Feb 12 01:10:55 2025 >> done (12.787s) 12278731 read pairs processed; of these: 55592 ( 0.45%) short read pairs filtered out after trimming by size control 95552 ( 0.78%) empty read pairs filtered out after trimming by size control 12127587 (98.77%) read pairs available; of these: 5182107 (42.73%) trimmed read pairs available after processing 6945480 (57.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 4 0.00% 21 4 0.00% 22 9 0.00% 23 12 0.00% 24 5 0.00% 25 17 0.00% 26 11 0.00% 27 12 0.00% 28 16 0.00% 29 6 0.00% 30 8 0.00% 31 11 0.00% 32 15 0.00% 33 14 0.00% 34 9 0.00% 35 15 0.00% 36 28 0.00% 37 16 0.00% 38 17 0.00% 39 22 0.00% 40 29 0.00% 41 24 0.00% 42 47 0.00% 43 45 0.00% 44 39 0.00% 45 48 0.00% 46 57 0.00% 47 55 0.00% 48 68 0.00% 49 79 0.00% 50 111 0.00% 51 125 0.00% 52 131 0.00% 53 149 0.00% 54 162 0.00% 55 200 0.00% 56 201 0.00% 57 246 0.00% 58 228 0.00% 59 314 0.00% 60 354 0.00% 61 349 0.00% 62 472 0.00% 63 502 0.00% 64 525 0.00% 65 550 0.00% 66 683 0.01% 67 768 0.01% 68 825 0.01% 69 973 0.01% 70 1082 0.01% 71 1217 0.01% 72 1443 0.01% 73 1658 0.01% 74 1853 0.02% 75 1976 0.02% 76 2342 0.02% 77 2775 0.02% 78 2656 0.02% 79 2756 0.02% 80 2995 0.02% 81 3414 0.03% 82 3774 0.03% 83 4279 0.04% 84 6283 0.05% 85 7457 0.06% 86 7649 0.06% 87 7814 0.06% 88 8029 0.07% 89 8039 0.07% 90 8345 0.07% 91 8574 0.07% 92 8920 0.07% 93 9366 0.08% 94 9859 0.08% 95 10253 0.08% 96 10265 0.08% 97 10506 0.09% 98 10547 0.09% 99 10992 0.09% 100 11204 0.09% 101 11346 0.09% 102 12163 0.10% 103 12649 0.10% 104 13215 0.11% 105 13664 0.11% 106 14071 0.12% 107 14435 0.12% 108 14653 0.12% 109 14544 0.12% 110 15259 0.13% 111 15456 0.13% 112 16297 0.13% 113 16981 0.14% 114 17256 0.14% 115 18224 0.15% 116 18772 0.15% 117 19302 0.16% 118 19517 0.16% 119 19730 0.16% 120 20332 0.17% 121 20716 0.17% 122 21745 0.18% 123 22581 0.19% 124 23547 0.19% 125 24358 0.20% 126 26208 0.22% 127 26221 0.22% 128 27101 0.22% 129 28087 0.23% 130 29086 0.24% 131 30230 0.25% 132 32015 0.26% 133 33441 0.28% 134 34987 0.29% 135 37531 0.31% 136 39332 0.32% 137 41877 0.35% 138 44699 0.37% 139 48588 0.40% 140 51593 0.43% 141 56189 0.46% 142 62508 0.52% 143 70654 0.58% 144 81108 0.67% 145 96915 0.80% 146 120987 1.00% 147 163000 1.34% 148 246056 2.03% 149 523907 4.32% 150 2602031 21.46% 151 6945480 57.27% 12127587 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=40 prefix-density=0.29 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=16 fanout-score=93.53 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=17.2 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.76 fanout-score-rank=23 prefix-density=0.35 prefix-fanout=3.9 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=63.11 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=14.4 sequence=TGTTGGTGGTGG SRR7169892 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:11:39 Started mapping on | Feb 12 01:11:40 Finished on | Feb 12 01:12:42 Mapping speed, Million of reads per hour | 704.18 Number of input reads | 12127587 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11284736 Uniquely mapped reads % | 93.05% Average mapped length | 293.78 Number of splices: Total | 10502141 Number of splices: Annotated (sjdb) | 10331257 Number of splices: GT/AG | 10352441 Number of splices: GC/AG | 120740 Number of splices: AT/AC | 7584 Number of splices: Non-canonical | 21376 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 220932 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 19057 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.93% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 654269 654269 654269 N_multimapping 220932 220932 220932 N_noFeature 190076 11161535 230525 N_ambiguous 129741 795 46433 UnstrandedReadsAssigned:10964919 PositiveStrandReadsAssigned:122406 NegativeStrandReadsAssigned:11007778 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169892 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169892-trimmed-pair1.fastq SRR7169892-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,127,587 reads, 10,949,880 reads pseudoaligned [quant] estimated average fragment length: 274.057 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR7169892.ke.tsv 34699 SRR7169892.se.tsv 87100 total ==> SRR7169892.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.94 194 9.13166 Potri.005G024800.1.v4.1 1035 761.943 16 1.72475 Potri.004G059700.1.v4.1 961 687.987 1 0.119385 Potri.007G009000.2.v4.1 1416 1142.94 0 0 Potri.003G141000.2.v4.1 2943 2669.94 193 5.93724 Potri.016G087400.1.v4.1 270 77.6199 1153 1220.07 Potri.015G069301.1.v4.1 564 297.292 0 0 Potri.010G195200.1.v4.1 1773 1499.94 22 1.20469 Potri.012G127500.1.v4.1 977 703.97 5861 683.827 ==> SRR7169892.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 909 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 175 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169892 completed mapping pipeline successfully