Starting /dee2/code/volunteer_pipeline.sh SRR7169893 current disk space = 3050135789568 free memory = 1573059000 SRR7169893 SRAfilesize ebec910fef896f08414875a40a0bba6c SRR7169893.sra SRR7169893.sra file validated SRR7169893 is paired end SRR7169893 is conventional basespace SRR7169893 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169893_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.00275 30.0 18.0 33.0 18.0 33.0 2 30.45325 31.0 29.0 33.0 27.0 33.0 3 31.62175 33.0 31.0 33.0 29.0 33.0 4 32.006 33.0 31.0 33.0 29.0 33.0 5 32.5585 33.0 33.0 33.0 32.0 34.0 6 36.85975 38.0 37.0 38.0 35.0 38.0 7 37.3855 38.0 38.0 38.0 37.0 38.0 8 37.6155 38.0 38.0 38.0 38.0 38.0 9 37.63375 38.0 38.0 38.0 38.0 38.0 10-14 37.61245 38.0 38.0 38.0 38.0 38.0 15-19 37.58265 38.0 38.0 38.0 38.0 38.0 20-24 37.50125 38.0 38.0 38.0 37.4 38.0 25-29 37.56985 38.0 38.0 38.0 38.0 38.0 30-34 37.478 38.0 38.0 38.0 37.8 38.0 35-39 37.45615 38.0 38.0 38.0 37.6 38.0 40-44 37.5073 38.0 38.0 38.0 37.4 38.0 45-49 37.52135 38.0 38.0 38.0 37.6 38.0 50-54 37.41780000000001 38.0 38.0 38.0 37.2 38.0 55-59 37.30085 38.0 38.0 38.0 36.8 38.0 60-64 37.2744 38.0 38.0 38.0 37.0 38.0 65-69 37.182100000000005 38.0 38.0 38.0 36.2 38.0 70-74 37.1589 38.0 38.0 38.0 36.0 38.0 75-79 37.046949999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.81215 38.0 38.0 38.0 35.4 38.0 85-89 36.831849999999996 38.0 38.0 38.0 35.4 38.0 90-94 36.3947 38.0 37.8 38.0 34.0 38.0 95-99 36.61495 38.0 38.0 38.0 34.8 38.0 100-104 36.336 38.0 37.6 38.0 34.0 38.0 105-109 35.6474 38.0 36.6 38.0 30.2 38.0 110-114 35.55565 38.0 36.2 38.0 31.0 38.0 115-119 34.8241 38.0 34.6 38.0 27.8 38.0 120-124 35.610949999999995 38.0 36.6 38.0 31.4 38.0 125-129 34.61705 38.0 34.8 38.0 26.2 38.0 130-134 35.04729999999999 38.0 35.6 38.0 28.6 38.0 135-139 35.0901 38.0 35.6 38.0 29.0 38.0 140-144 34.441250000000004 38.0 35.0 38.0 26.6 38.0 145-149 32.16775 37.6 31.6 38.0 14.2 38.0 150-151 27.778875 34.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 2.0 15 3.0 16 1.0 17 2.0 18 1.0 19 13.0 20 4.0 21 6.0 22 4.0 23 7.0 24 9.0 25 10.0 26 11.0 27 10.0 28 14.0 29 28.0 30 33.0 31 49.0 32 84.0 33 111.0 34 224.0 35 356.0 36 1017.0 37 2000.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.55 13.0 9.775 33.675 2 21.233391827525697 16.846327400350965 32.79017297568313 29.130107796440214 3 18.825 23.799999999999997 27.85 29.525000000000002 4 21.875 29.299999999999997 25.374999999999996 23.45 5 20.625 34.75 23.575 21.05 6 18.65 36.375 25.575 19.400000000000002 7 14.025000000000002 26.0 42.675000000000004 17.299999999999997 8 18.2 25.224999999999998 30.475 26.1 9 17.2 25.674999999999997 32.550000000000004 24.575 10-14 19.8 31.009999999999998 26.174999999999997 23.015 15-19 19.259999999999998 29.93 27.35 23.46 20-24 19.775000000000002 30.135 26.590000000000003 23.5 25-29 19.89 29.93 26.745 23.435 30-34 19.555 29.439999999999998 26.855 24.15 35-39 19.655 29.985 26.87 23.49 40-44 19.675 29.705 27.04 23.580000000000002 45-49 19.84 29.595 26.729999999999997 23.835 50-54 19.725 29.21 26.790000000000003 24.275 55-59 20.015 29.505 27.165 23.315 60-64 19.67 29.330000000000002 27.66 23.34 65-69 20.095 28.95 26.939999999999998 24.015 70-74 19.86 30.285 26.265 23.59 75-79 19.77 29.630000000000003 27.21 23.39 80-84 19.535 29.01 26.72 24.735 85-89 19.84 28.77 27.525 23.865 90-94 20.015 28.605000000000004 27.01 24.37 95-99 20.255000000000003 28.735 27.034999999999997 23.974999999999998 100-104 20.22 29.085 26.755000000000003 23.94 105-109 20.205000000000002 29.160000000000004 26.995 23.64 110-114 20.79 28.335 27.255000000000003 23.62 115-119 20.761141712568854 28.382573860791187 27.43114672008012 23.42513770655984 120-124 20.5 28.73 26.75 24.02 125-129 20.794999999999998 28.42 26.540000000000003 24.245 130-134 20.810000000000002 28.54 27.060000000000002 23.59 135-139 21.32 28.955 26.435 23.29 140-144 20.73 28.799999999999997 26.75 23.72 145-149 20.580000000000002 28.24 27.37 23.810000000000002 150-151 20.575 28.3125 26.437500000000004 24.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 2.5 21 1.5 22 1.5 23 2.5 24 2.0 25 5.5 26 8.5 27 14.0 28 18.5 29 24.0 30 31.0 31 29.5 32 39.5 33 51.5 34 68.0 35 91.5 36 100.0 37 108.5 38 119.5 39 149.0 40 183.5 41 212.0 42 231.0 43 241.5 44 257.0 45 264.0 46 248.5 47 225.0 48 219.0 49 203.5 50 183.5 51 154.5 52 125.0 53 102.0 54 74.5 55 49.5 56 31.5 57 30.5 58 25.5 59 17.0 60 14.0 61 8.5 62 7.0 63 4.5 64 4.0 65 5.0 66 2.0 67 2.0 68 2.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.15 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47156517362859 98.825 2 0.5032712632108707 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025163563160543533 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.3875000000000002 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.8250000000000002 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.2125 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 3.0 0.0 0.0 0.0 0.0 130-131 3.2625 0.0 0.0 0.0 0.0 132-133 3.5 0.0 0.0 0.0 0.0 134-135 3.625 0.0 0.0 0.0 0.0 136-137 3.8375 0.0 0.0 0.0 0.0 138-139 4.137499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTAC 10 0.006830828 145.0 5 >>END_MODULE SRR7169893 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169893_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15375 34.0 33.0 34.0 33.0 34.0 2 33.14675 34.0 33.0 34.0 33.0 34.0 3 33.19575 34.0 33.0 34.0 33.0 34.0 4 33.194 34.0 33.0 34.0 33.0 34.0 5 33.1255 34.0 33.0 34.0 33.0 34.0 6 37.21175 38.0 38.0 38.0 38.0 38.0 7 37.18825 38.0 38.0 38.0 37.0 38.0 8 37.3595 38.0 38.0 38.0 38.0 38.0 9 37.3515 38.0 38.0 38.0 38.0 38.0 10-14 37.263549999999995 38.0 38.0 38.0 37.8 38.0 15-19 37.177600000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.0759 38.0 38.0 38.0 37.0 38.0 25-29 37.058 38.0 38.0 38.0 37.0 38.0 30-34 37.0715 38.0 38.0 38.0 36.6 38.0 35-39 36.73375 38.0 38.0 38.0 35.0 38.0 40-44 37.015 38.0 38.0 38.0 36.4 38.0 45-49 37.1611 38.0 38.0 38.0 37.0 38.0 50-54 37.1546 38.0 38.0 38.0 37.0 38.0 55-59 37.09310000000001 38.0 38.0 38.0 37.0 38.0 60-64 36.87115000000001 38.0 38.0 38.0 36.2 38.0 65-69 36.992149999999995 38.0 38.0 38.0 36.4 38.0 70-74 36.96275 38.0 38.0 38.0 36.4 38.0 75-79 37.02655 38.0 38.0 38.0 36.6 38.0 80-84 36.79475 38.0 38.0 38.0 35.8 38.0 85-89 36.42145000000001 38.0 38.0 38.0 34.2 38.0 90-94 36.6118 38.0 38.0 38.0 35.0 38.0 95-99 36.556 38.0 38.0 38.0 35.0 38.0 100-104 36.4773 38.0 38.0 38.0 34.8 38.0 105-109 35.8972 38.0 37.6 38.0 32.4 38.0 110-114 35.7224 38.0 37.2 38.0 31.0 38.0 115-119 35.95885 38.0 38.0 38.0 33.4 38.0 120-124 35.784000000000006 38.0 37.8 38.0 32.8 38.0 125-129 34.9348 38.0 35.8 38.0 27.2 38.0 130-134 35.440850000000005 38.0 36.4 38.0 31.4 38.0 135-139 34.9662 38.0 36.0 38.0 29.6 38.0 140-144 34.26885 38.0 35.4 38.0 26.2 38.0 145-149 32.5518 38.0 32.2 38.0 15.8 38.0 150-151 29.360625 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 3.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 5.0 16 5.0 17 3.0 18 4.0 19 5.0 20 14.0 21 7.0 22 9.0 23 11.0 24 12.0 25 9.0 26 18.0 27 15.0 28 36.0 29 27.0 30 31.0 31 38.0 32 60.0 33 97.0 34 165.0 35 241.0 36 622.0 37 2548.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.875 21.475 14.224999999999998 20.424999999999997 2 26.55 25.775 28.275 19.400000000000002 3 21.275 28.225 32.25 18.25 4 24.375 35.025 22.45 18.15 5 24.85 35.725 20.875 18.55 6 20.875 36.9 24.075 18.15 7 20.974999999999998 20.974999999999998 37.35 20.7 8 22.275 26.05 26.375 25.3 9 21.25 26.375 27.900000000000002 24.474999999999998 10-14 23.445 28.294999999999998 26.695 21.565 15-19 23.815 27.02 27.584999999999997 21.58 20-24 23.48 27.41 28.015 21.095 25-29 23.385 28.32 27.68 20.615 30-34 23.195 27.63 28.27 20.905 35-39 23.775 26.939999999999998 27.58 21.705 40-44 23.72 27.284999999999997 28.13 20.865000000000002 45-49 22.985 27.765 28.15 21.099999999999998 50-54 23.455000000000002 27.800000000000004 27.37 21.375 55-59 24.38 27.26 27.500000000000004 20.86 60-64 22.735 27.900000000000002 28.52 20.845 65-69 23.13 27.405 28.525 20.94 70-74 23.43 27.46 28.199999999999996 20.91 75-79 23.580000000000002 27.935 27.965 20.52 80-84 23.549999999999997 27.355 28.115000000000002 20.979999999999997 85-89 24.145 27.61 27.54 20.705000000000002 90-94 23.810000000000002 27.32 28.54 20.330000000000002 95-99 25.025 27.48 27.515 19.98 100-104 24.745 26.889999999999997 27.21 21.154999999999998 105-109 23.995 27.305 28.055000000000003 20.645 110-114 24.165 27.284999999999997 27.810000000000002 20.74 115-119 24.325 27.405 27.800000000000004 20.47 120-124 24.085 27.67 28.015 20.23 125-129 23.95 27.384999999999998 27.725 20.94 130-134 24.787351145802063 27.514259981987394 27.199039327529274 20.499349544681277 135-139 23.845 27.200000000000003 28.29 20.665 140-144 24.3 27.584999999999997 28.015 20.1 145-149 24.495 27.43 27.565 20.51 150-151 25.0 26.674999999999997 28.375 19.950000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 4.0 28 6.5 29 6.5 30 9.5 31 13.0 32 14.5 33 20.0 34 38.0 35 55.5 36 83.0 37 111.0 38 121.5 39 152.0 40 188.0 41 213.0 42 244.0 43 263.5 44 268.5 45 288.0 46 287.0 47 276.0 48 266.5 49 226.5 50 181.0 51 155.0 52 134.5 53 99.5 54 70.5 55 55.0 56 45.5 57 29.5 58 15.0 59 12.5 60 11.0 61 6.5 62 4.5 63 4.0 64 3.0 65 2.0 66 2.0 67 3.5 68 3.0 69 2.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.06999999999999999 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54728370221329 98.95 2 0.4024144869215292 0.8 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025150905432595575 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 7 0.17500000000000002 Illumina Single End PCR Primer 1 (96% over 33bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.1375 0.0 0.0 0.0 0.0 104-105 1.2000000000000002 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.325 0.0 0.0 0.0 0.0 124-125 2.475 0.0 0.0 0.0 0.0 126-127 2.7875 0.0 0.0 0.0 0.0 128-129 2.9749999999999996 0.0 0.0 0.0 0.0 130-131 3.2125 0.0 0.0 0.0 0.0 132-133 3.45 0.0 0.0 0.0 0.0 134-135 3.5875000000000004 0.0 0.0 0.0 0.0 136-137 3.875 0.0 0.0 0.0 0.0 138-139 4.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCACTCT 10 0.006830828 145.0 6 >>END_MODULE Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854633 spots for SRR7169893.sra Written 854633 spots for SRR7169893.sra Read 854647 spots for SRR7169893.sra Written 854647 spots for SRR7169893.sra SRR ids: ['SRR7169893.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__ks_ok_w SRR7169893.sra spots: 17092674 blocks: [[1, 854633], [854634, 1709266], [1709267, 2563899], [2563900, 3418532], [3418533, 4273165], [4273166, 5127798], [5127799, 5982431], [5982432, 6837064], [6837065, 7691697], [7691698, 8546330], [8546331, 9400963], [9400964, 10255596], [10255597, 11110229], [11110230, 11964862], [11964863, 12819495], [12819496, 13674128], [13674129, 14528761], [14528762, 15383394], [15383395, 16238027], [16238028, 17092674]] SRR7169893 file size 5770445 SRR7169893 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169893 SRR7169893_1.fastq SRR7169893_2.fastq Input file: SRR7169893_1.fastq Paired file: SRR7169893_2.fastq trimmed: SRR7169893-trimmed-pair1.fastq, SRR7169893-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:15:29 2025 >> started Wed Feb 12 02:15:50 2025 >> done (21.708s) 17092674 read pairs processed; of these: 28728 ( 0.17%) short read pairs filtered out after trimming by size control 36028 ( 0.21%) empty read pairs filtered out after trimming by size control 17027918 (99.62%) read pairs available; of these: 7573848 (44.48%) trimmed read pairs available after processing 9454070 (55.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 11 0.00% 21 7 0.00% 22 9 0.00% 23 13 0.00% 24 10 0.00% 25 11 0.00% 26 17 0.00% 27 9 0.00% 28 11 0.00% 29 10 0.00% 30 14 0.00% 31 22 0.00% 32 25 0.00% 33 25 0.00% 34 20 0.00% 35 39 0.00% 36 13 0.00% 37 17 0.00% 38 43 0.00% 39 25 0.00% 40 35 0.00% 41 47 0.00% 42 51 0.00% 43 52 0.00% 44 49 0.00% 45 83 0.00% 46 61 0.00% 47 96 0.00% 48 82 0.00% 49 121 0.00% 50 143 0.00% 51 159 0.00% 52 161 0.00% 53 175 0.00% 54 227 0.00% 55 255 0.00% 56 270 0.00% 57 317 0.00% 58 326 0.00% 59 422 0.00% 60 455 0.00% 61 575 0.00% 62 595 0.00% 63 724 0.00% 64 743 0.00% 65 857 0.01% 66 847 0.00% 67 976 0.01% 68 1136 0.01% 69 1351 0.01% 70 1557 0.01% 71 1773 0.01% 72 1976 0.01% 73 2264 0.01% 74 2472 0.01% 75 2737 0.02% 76 3373 0.02% 77 3815 0.02% 78 3432 0.02% 79 3644 0.02% 80 4044 0.02% 81 4604 0.03% 82 5168 0.03% 83 5698 0.03% 84 7418 0.04% 85 8466 0.05% 86 8772 0.05% 87 9236 0.05% 88 9491 0.06% 89 9738 0.06% 90 10414 0.06% 91 10680 0.06% 92 11464 0.07% 93 12139 0.07% 94 12380 0.07% 95 12839 0.08% 96 13238 0.08% 97 13337 0.08% 98 13488 0.08% 99 13780 0.08% 100 14666 0.09% 101 15165 0.09% 102 16198 0.10% 103 16765 0.10% 104 17630 0.10% 105 18240 0.11% 106 18588 0.11% 107 18444 0.11% 108 19113 0.11% 109 19078 0.11% 110 19775 0.12% 111 20111 0.12% 112 21267 0.12% 113 22231 0.13% 114 23185 0.14% 115 23923 0.14% 116 24214 0.14% 117 24785 0.15% 118 24895 0.15% 119 24659 0.14% 120 25309 0.15% 121 25659 0.15% 122 27003 0.16% 123 28491 0.17% 124 29732 0.17% 125 30873 0.18% 126 31829 0.19% 127 32647 0.19% 128 33375 0.20% 129 34437 0.20% 130 35794 0.21% 131 37121 0.22% 132 39572 0.23% 133 41826 0.25% 134 44129 0.26% 135 47348 0.28% 136 50016 0.29% 137 53537 0.31% 138 56782 0.33% 139 60973 0.36% 140 66257 0.39% 141 73014 0.43% 142 81690 0.48% 143 93866 0.55% 144 112811 0.66% 145 138808 0.82% 146 176098 1.03% 147 244447 1.44% 148 375470 2.21% 149 780733 4.59% 150 4026085 23.64% 151 9454070 55.52% 17027918 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=37 prefix-density=0.26 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=32 fanout-score=128.76 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=14.4 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=44 prefix-density=0.22 prefix-fanout=2.1 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=46 fanout-score=155.30 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=15.1 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTTCTCGAGAAGATCAAGGAGA SRR7169893 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:16:32 Started mapping on | Feb 12 02:16:32 Finished on | Feb 12 02:18:02 Mapping speed, Million of reads per hour | 681.12 Number of input reads | 17027918 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15764794 Uniquely mapped reads % | 92.58% Average mapped length | 294.19 Number of splices: Total | 14379619 Number of splices: Annotated (sjdb) | 14146059 Number of splices: GT/AG | 14174289 Number of splices: GC/AG | 162546 Number of splices: AT/AC | 11151 Number of splices: Non-canonical | 31633 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283444 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 17161 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.62% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1008665 1008665 1008665 N_multimapping 283444 283444 283444 N_noFeature 314227 15583160 377478 N_ambiguous 185285 1048 66170 UnstrandedReadsAssigned:15265282 PositiveStrandReadsAssigned:180586 NegativeStrandReadsAssigned:15321146 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169893 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169893-trimmed-pair1.fastq SRR7169893-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,027,918 reads, 15,221,318 reads pseudoaligned [quant] estimated average fragment length: 276.675 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR7169893.ke.tsv 34699 SRR7169893.se.tsv 87100 total ==> SRR7169893.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.33 265 9.29467 Potri.005G024800.1.v4.1 1035 759.325 38 3.05825 Potri.004G059700.1.v4.1 961 685.347 6 0.535005 Potri.007G009000.2.v4.1 1416 1140.33 0 0 Potri.003G141000.2.v4.1 2943 2667.33 295.069 6.7603 Potri.016G087400.1.v4.1 270 77.5051 1644 1296.25 Potri.015G069301.1.v4.1 564 296.631 0 0 Potri.010G195200.1.v4.1 1773 1497.33 17 0.693826 Potri.012G127500.1.v4.1 977 701.336 8803 767.047 ==> SRR7169893.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1289 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 318 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169893 completed mapping pipeline successfully