Starting /dee2/code/volunteer_pipeline.sh SRR7169894 current disk space = 3051053096960 free memory = 1487178600 SRR7169894 SRAfilesize f977b7192ff71936bbd7a43b56d8a80a SRR7169894.sra SRR7169894.sra file validated SRR7169894 is paired end SRR7169894 is conventional basespace SRR7169894 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169894_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.09825 32.0 18.0 33.0 18.0 33.0 2 25.63675 27.0 18.0 31.0 18.0 33.0 3 29.808 31.0 29.0 33.0 27.0 33.0 4 31.853 33.0 31.0 33.0 29.0 33.0 5 32.3105 33.0 33.0 33.0 31.0 33.0 6 36.541 38.0 36.0 38.0 34.0 38.0 7 37.3085 38.0 38.0 38.0 36.0 38.0 8 37.65375 38.0 38.0 38.0 37.0 38.0 9 37.63375 38.0 38.0 38.0 38.0 38.0 10-14 37.7712 38.0 38.0 38.0 38.0 38.0 15-19 37.791650000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.7922 38.0 38.0 38.0 38.0 38.0 25-29 37.780449999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.7447 38.0 38.0 38.0 38.0 38.0 35-39 37.61495 38.0 38.0 38.0 37.8 38.0 40-44 37.69615 38.0 38.0 38.0 38.0 38.0 45-49 37.690000000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.61665 38.0 38.0 38.0 38.0 38.0 55-59 37.52735 38.0 38.0 38.0 37.6 38.0 60-64 37.43845 38.0 38.0 38.0 37.2 38.0 65-69 37.43345 38.0 38.0 38.0 37.0 38.0 70-74 37.1579 38.0 38.0 38.0 36.4 38.0 75-79 37.021100000000004 38.0 38.0 38.0 35.8 38.0 80-84 37.0426 38.0 38.0 38.0 35.8 38.0 85-89 37.09159999999999 38.0 38.0 38.0 36.2 38.0 90-94 37.08605 38.0 38.0 38.0 36.0 38.0 95-99 36.942099999999996 38.0 38.0 38.0 36.0 38.0 100-104 36.68695 38.0 38.0 38.0 34.4 38.0 105-109 35.55105 38.0 36.4 38.0 29.2 38.0 110-114 35.84875 38.0 36.6 38.0 31.0 38.0 115-119 36.31725 38.0 37.4 38.0 33.8 38.0 120-124 36.182900000000004 38.0 37.0 38.0 34.0 38.0 125-129 35.69545 38.0 36.4 38.0 31.8 38.0 130-134 35.481899999999996 38.0 36.0 38.0 31.0 38.0 135-139 34.621449999999996 38.0 34.8 38.0 26.2 38.0 140-144 34.3602 38.0 33.4 38.0 25.8 38.0 145-149 33.3592 38.0 33.0 38.0 22.6 38.0 150-151 28.899375 34.5 24.0 37.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 4.0 17 2.0 18 2.0 19 2.0 20 1.0 21 5.0 22 4.0 23 3.0 24 4.0 25 5.0 26 6.0 27 13.0 28 13.0 29 22.0 30 29.0 31 34.0 32 47.0 33 75.0 34 152.0 35 355.0 36 1176.0 37 2044.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.17458729364682 10.855427713856928 7.753876938469234 32.21610805402702 2 23.625 12.55 35.225 28.599999999999998 3 20.599999999999998 19.25 26.05 34.1 4 23.799999999999997 26.525 24.675 25.0 5 23.599999999999998 31.75 24.375 20.275000000000002 6 19.175 37.4 23.974999999999998 19.45 7 14.649999999999999 26.125 42.025 17.2 8 17.224999999999998 26.650000000000002 32.125 24.0 9 17.840140315710347 25.00626409421198 33.024304685542475 24.129290904535207 10-14 20.064999999999998 30.865 26.705000000000002 22.365 15-19 19.925 29.115000000000002 27.82 23.14 20-24 20.495 29.595 27.339999999999996 22.57 25-29 20.05 29.485 27.73 22.735 30-34 19.89 29.575000000000003 27.58 22.955000000000002 35-39 19.919999999999998 29.265 27.685 23.13 40-44 20.59 28.910000000000004 27.915 22.585 45-49 20.365 30.014999999999997 26.619999999999997 23.0 50-54 20.544999999999998 29.18 27.034999999999997 23.24 55-59 20.035 29.505 27.675 22.785 60-64 19.36 29.54 27.77 23.330000000000002 65-69 19.755 29.080000000000002 27.68 23.485 70-74 20.150000000000002 29.154999999999998 27.634999999999998 23.06 75-79 20.105 28.744999999999997 28.18 22.97 80-84 19.605 28.884999999999998 27.900000000000002 23.61 85-89 20.080000000000002 28.910000000000004 27.889999999999997 23.119999999999997 90-94 20.119999999999997 28.775000000000002 27.584999999999997 23.52 95-99 19.830000000000002 28.560000000000002 28.005000000000003 23.605 100-104 20.785 28.775000000000002 27.750000000000004 22.689999999999998 105-109 20.505000000000003 28.57 27.810000000000002 23.115 110-114 20.655 28.865000000000002 27.165 23.315 115-119 21.075 29.299999999999997 27.045 22.58 120-124 20.612214274996248 28.750062521882658 27.629670384634625 23.008052818486473 125-129 20.94675740592474 28.132506004803844 27.717173738991193 23.203562850280225 130-134 20.93 28.549999999999997 26.919999999999998 23.599999999999998 135-139 21.055 29.580000000000002 26.41 22.955000000000002 140-144 21.025 28.605000000000004 26.545 23.825 145-149 20.810000000000002 28.38 26.729999999999997 24.08 150-151 20.474999999999998 28.962500000000002 26.674999999999997 23.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 1.5 22 2.0 23 2.0 24 2.0 25 4.0 26 6.0 27 7.5 28 9.5 29 13.5 30 23.5 31 31.0 32 37.0 33 47.0 34 61.0 35 85.5 36 102.5 37 119.0 38 132.5 39 144.0 40 186.0 41 221.0 42 251.0 43 279.5 44 286.5 45 285.5 46 284.0 47 255.0 48 231.0 49 197.0 50 141.5 51 126.5 52 115.0 53 88.5 54 58.0 55 38.0 56 30.0 57 21.5 58 13.0 59 13.0 60 10.0 61 5.5 62 7.0 63 7.5 64 6.5 65 3.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.22499999999999998 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.034999999999999996 125-129 0.08 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29506545820746 98.6 2 0.7049345417925479 1.4000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.2000000000000002 0.0 0.0 0.0 0.0 98-99 1.2625 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 2.1 0.0 0.0 0.0 0.0 108-109 2.4625000000000004 0.0 0.0 0.0 0.0 110-111 2.95 0.0 0.0 0.0 0.0 112-113 3.1625 0.0 0.0 0.0 0.0 114-115 3.4125 0.0 0.0 0.0 0.0 116-117 3.725 0.0 0.0 0.0 0.0 118-119 4.0625 0.0 0.0 0.0 0.0 120-121 4.4 0.0 0.0 0.0 0.0 122-123 4.825 0.0 0.0 0.0 0.0 124-125 5.2375 0.0 0.0 0.0 0.0 126-127 5.612500000000001 0.0 0.0 0.0 0.0 128-129 6.0125 0.0 0.0 0.0 0.0 130-131 6.4625 0.0 0.0 0.0 0.0 132-133 6.862500000000001 0.0 0.0 0.0 0.0 134-135 7.3125 0.0 0.0 0.0 0.0 136-137 7.875 0.0 0.0 0.0 0.0 138-139 8.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTCTT 10 0.006830828 145.0 1 >>END_MODULE SRR7169894 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169894_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.17325 34.0 33.0 34.0 33.0 34.0 2 33.33625 34.0 33.0 34.0 33.0 34.0 3 33.38225 34.0 33.0 34.0 33.0 34.0 4 33.404 34.0 33.0 34.0 33.0 34.0 5 33.42575 34.0 33.0 34.0 33.0 34.0 6 37.63 38.0 38.0 38.0 38.0 38.0 7 37.5765 38.0 38.0 38.0 38.0 38.0 8 37.6035 38.0 38.0 38.0 38.0 38.0 9 37.61675 38.0 38.0 38.0 38.0 38.0 10-14 37.558550000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.512299999999996 38.0 38.0 38.0 37.8 38.0 20-24 37.202099999999994 38.0 38.0 38.0 36.8 38.0 25-29 37.38555 38.0 38.0 38.0 37.6 38.0 30-34 37.2179 38.0 38.0 38.0 37.0 38.0 35-39 37.4573 38.0 38.0 38.0 38.0 38.0 40-44 37.3727 38.0 38.0 38.0 37.6 38.0 45-49 37.30105 38.0 38.0 38.0 37.0 38.0 50-54 37.380599999999994 38.0 38.0 38.0 37.8 38.0 55-59 37.44305 38.0 38.0 38.0 37.8 38.0 60-64 37.25595 38.0 38.0 38.0 37.2 38.0 65-69 37.261900000000004 38.0 38.0 38.0 37.0 38.0 70-74 36.634249999999994 38.0 37.8 38.0 33.4 38.0 75-79 36.80305 38.0 38.0 38.0 35.4 38.0 80-84 37.160349999999994 38.0 38.0 38.0 36.8 38.0 85-89 37.09015000000001 38.0 38.0 38.0 36.8 38.0 90-94 37.058350000000004 38.0 38.0 38.0 36.4 38.0 95-99 37.03405 38.0 38.0 38.0 36.0 38.0 100-104 36.92999999999999 38.0 38.0 38.0 36.0 38.0 105-109 36.770950000000006 38.0 38.0 38.0 35.2 38.0 110-114 36.07665 38.0 37.2 38.0 32.4 38.0 115-119 36.49405 38.0 38.0 38.0 34.4 38.0 120-124 36.355850000000004 38.0 38.0 38.0 34.0 38.0 125-129 36.166700000000006 38.0 37.8 38.0 33.6 38.0 130-134 35.78635 38.0 36.8 38.0 32.0 38.0 135-139 35.30995 38.0 36.0 38.0 30.4 38.0 140-144 31.42625 36.8 27.6 38.0 14.8 38.0 145-149 33.768449999999994 38.0 33.8 38.0 25.0 38.0 150-151 29.154125 34.5 18.5 38.0 11.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 1.0 5 1.0 6 1.0 7 1.0 8 0.0 9 2.0 10 0.0 11 0.0 12 2.0 13 1.0 14 0.0 15 1.0 16 2.0 17 3.0 18 0.0 19 5.0 20 6.0 21 1.0 22 3.0 23 6.0 24 10.0 25 6.0 26 11.0 27 18.0 28 9.0 29 26.0 30 30.0 31 40.0 32 56.0 33 68.0 34 129.0 35 260.0 36 829.0 37 2469.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.525 21.025 11.774999999999999 25.674999999999997 2 27.625 24.7 31.8 15.875 3 21.349999999999998 27.900000000000002 31.35 19.400000000000002 4 23.125 34.475 23.325000000000003 19.075 5 22.775000000000002 37.875 21.0 18.35 6 21.375 38.550000000000004 22.650000000000002 17.424999999999997 7 21.55 21.275 37.6 19.575 8 21.6 25.650000000000002 27.725 25.025 9 20.65 24.2 30.975 24.175 10-14 23.380000000000003 28.685 27.105 20.830000000000002 15-19 22.470000000000002 28.435 28.375 20.72 20-24 23.345 28.23 27.71 20.715 25-29 23.419999999999998 28.849999999999998 27.49 20.24 30-34 22.16 28.48 28.185 21.175 35-39 22.79 28.955 27.534999999999997 20.72 40-44 22.759999999999998 27.875 28.499999999999996 20.865000000000002 45-49 22.93 28.144999999999996 28.435 20.49 50-54 22.96614830741537 28.846442322116104 27.86639331966598 20.32101605080254 55-59 22.845 28.63 28.055000000000003 20.47 60-64 23.085 28.185 28.17 20.560000000000002 65-69 23.189999999999998 28.235 27.98 20.595 70-74 22.79 27.61 28.955 20.645 75-79 22.435 28.125 28.79 20.65 80-84 23.369999999999997 27.38 28.59 20.66 85-89 23.56 28.075 28.065 20.3 90-94 23.244999999999997 28.585 27.675 20.495 95-99 23.27 28.285 28.395 20.05 100-104 23.735 27.839999999999996 27.915 20.51 105-109 23.611180559027954 27.161358067903397 28.901445072253612 20.32601630081504 110-114 24.235 28.095 27.605 20.064999999999998 115-119 24.09 27.965 27.900000000000002 20.044999999999998 120-124 23.830000000000002 28.28 27.76 20.13 125-129 23.84 27.944999999999997 28.46 19.755 130-134 24.88 27.6 27.555000000000003 19.965 135-139 24.62 27.955000000000002 27.63 19.794999999999998 140-144 24.315 28.144999999999996 27.779999999999998 19.759999999999998 145-149 24.72 27.91 27.29 20.080000000000002 150-151 25.387500000000003 27.6875 27.762500000000003 19.162499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 3.0 26 3.0 27 2.0 28 2.0 29 6.5 30 13.0 31 18.0 32 22.0 33 31.0 34 48.0 35 65.0 36 91.0 37 130.5 38 156.5 39 191.5 40 230.5 41 240.0 42 264.5 43 288.0 44 291.0 45 278.0 46 269.0 47 250.5 48 219.5 49 198.0 50 167.0 51 136.0 52 102.0 53 75.0 54 52.0 55 38.5 56 34.0 57 24.5 58 16.0 59 10.5 60 6.0 61 4.0 62 6.0 63 4.5 64 1.5 65 1.0 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26970536388819 98.55000000000001 2 0.7302946361118107 1.4500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.11249999999999999 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 0.9874999999999999 0.0 0.0 0.0 0.0 96-97 1.1749999999999998 0.0 0.0 0.0 0.0 98-99 1.2625 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.8 0.0 0.0 0.0 0.0 106-107 2.0875 0.0 0.0 0.0 0.0 108-109 2.4 0.0 0.0 0.0 0.0 110-111 2.9000000000000004 0.0 0.0 0.0 0.0 112-113 3.1625 0.0 0.0 0.0 0.0 114-115 3.4125 0.0 0.0 0.0 0.0 116-117 3.725 0.0 0.0 0.0 0.0 118-119 4.075 0.0 0.0 0.0 0.0 120-121 4.425000000000001 0.0 0.0 0.0 0.0 122-123 4.9 0.0 0.0 0.0 0.0 124-125 5.3125 0.0 0.0 0.0 0.0 126-127 5.7 0.0 0.0 0.0 0.0 128-129 6.175000000000001 0.0 0.0 0.0 0.0 130-131 6.625 0.0 0.0 0.0 0.0 132-133 7.025 0.0 0.0 0.0 0.0 134-135 7.4125 0.0 0.0 0.0 0.0 136-137 7.975 0.0 0.0 0.0 0.0 138-139 8.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618422 spots for SRR7169894.sra Written 618422 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra Read 618420 spots for SRR7169894.sra Written 618420 spots for SRR7169894.sra SRR ids: ['SRR7169894.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wi75e9f4 SRR7169894.sra spots: 12368402 blocks: [[1, 618420], [618421, 1236840], [1236841, 1855260], [1855261, 2473680], [2473681, 3092100], [3092101, 3710520], [3710521, 4328940], [4328941, 4947360], [4947361, 5565780], [5565781, 6184200], [6184201, 6802620], [6802621, 7421040], [7421041, 8039460], [8039461, 8657880], [8657881, 9276300], [9276301, 9894720], [9894721, 10513140], [10513141, 11131560], [11131561, 11749980], [11749981, 12368402]] SRR7169894 file size 4169545 SRR7169894 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169894 SRR7169894_1.fastq SRR7169894_2.fastq Input file: SRR7169894_1.fastq Paired file: SRR7169894_2.fastq trimmed: SRR7169894-trimmed-pair1.fastq, SRR7169894-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:23:36 2025 >> started Wed Feb 12 01:23:50 2025 >> done (13.913s) 12368402 read pairs processed; of these: 9330 ( 0.08%) short read pairs filtered out after trimming by size control 6402 ( 0.05%) empty read pairs filtered out after trimming by size control 12352670 (99.87%) read pairs available; of these: 6037917 (48.88%) trimmed read pairs available after processing 6314753 (51.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 3 0.00% 21 6 0.00% 22 3 0.00% 23 5 0.00% 24 7 0.00% 25 3 0.00% 26 3 0.00% 27 5 0.00% 28 4 0.00% 29 3 0.00% 30 3 0.00% 31 9 0.00% 32 6 0.00% 33 4 0.00% 34 7 0.00% 35 4 0.00% 36 8 0.00% 37 14 0.00% 38 17 0.00% 39 15 0.00% 40 22 0.00% 41 25 0.00% 42 32 0.00% 43 37 0.00% 44 23 0.00% 45 44 0.00% 46 45 0.00% 47 29 0.00% 48 59 0.00% 49 50 0.00% 50 79 0.00% 51 86 0.00% 52 113 0.00% 53 121 0.00% 54 123 0.00% 55 149 0.00% 56 166 0.00% 57 174 0.00% 58 209 0.00% 59 252 0.00% 60 310 0.00% 61 371 0.00% 62 400 0.00% 63 487 0.00% 64 522 0.00% 65 611 0.00% 66 640 0.01% 67 719 0.01% 68 855 0.01% 69 986 0.01% 70 1107 0.01% 71 1429 0.01% 72 1507 0.01% 73 1754 0.01% 74 1919 0.02% 75 2156 0.02% 76 2272 0.02% 77 2545 0.02% 78 2889 0.02% 79 3263 0.03% 80 3551 0.03% 81 4026 0.03% 82 4595 0.04% 83 5152 0.04% 84 6007 0.05% 85 6449 0.05% 86 6930 0.06% 87 7446 0.06% 88 7938 0.06% 89 8259 0.07% 90 9018 0.07% 91 9917 0.08% 92 10605 0.09% 93 11601 0.09% 94 12243 0.10% 95 12904 0.10% 96 13386 0.11% 97 13985 0.11% 98 14274 0.12% 99 14875 0.12% 100 15791 0.13% 101 16629 0.13% 102 17594 0.14% 103 18477 0.15% 104 19234 0.16% 105 20566 0.17% 106 20890 0.17% 107 21326 0.17% 108 22008 0.18% 109 22224 0.18% 110 22720 0.18% 111 23751 0.19% 112 24948 0.20% 113 25825 0.21% 114 26690 0.22% 115 27714 0.22% 116 28374 0.23% 117 28890 0.23% 118 29342 0.24% 119 29704 0.24% 120 30192 0.24% 121 30864 0.25% 122 32122 0.26% 123 33349 0.27% 124 34562 0.28% 125 35984 0.29% 126 37161 0.30% 127 37865 0.31% 128 38429 0.31% 129 38805 0.31% 130 40494 0.33% 131 40983 0.33% 132 42879 0.35% 133 44545 0.36% 134 46255 0.37% 135 48797 0.40% 136 50754 0.41% 137 53923 0.44% 138 56514 0.46% 139 59306 0.48% 140 62732 0.51% 141 67895 0.55% 142 75014 0.61% 143 86674 0.70% 144 96357 0.78% 145 117670 0.95% 146 140115 1.13% 147 187890 1.52% 148 294436 2.38% 149 588870 4.77% 150 2811908 22.76% 151 6314753 51.12% 12352670 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=40 prefix-density=0.13 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=307.36 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=30.5 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=41 prefix-density=0.35 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=13 fanout-score=298.65 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=28.5 sequence=AAGAAGAAGAAG SRR7169894 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:24:32 Started mapping on | Feb 12 01:24:33 Finished on | Feb 12 01:25:42 Mapping speed, Million of reads per hour | 644.49 Number of input reads | 12352670 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11750983 Uniquely mapped reads % | 95.13% Average mapped length | 291.71 Number of splices: Total | 11374629 Number of splices: Annotated (sjdb) | 11187244 Number of splices: GT/AG | 11200747 Number of splices: GC/AG | 139606 Number of splices: AT/AC | 8911 Number of splices: Non-canonical | 25365 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 207167 % of reads mapped to multiple loci | 1.68% Number of reads mapped to too many loci | 34171 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.86% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 402439 402439 402439 N_multimapping 207167 207167 207167 N_noFeature 305578 11633039 364081 N_ambiguous 106808 735 46911 UnstrandedReadsAssigned:11338597 PositiveStrandReadsAssigned:117209 NegativeStrandReadsAssigned:11339991 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169894 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169894-trimmed-pair1.fastq SRR7169894-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,352,670 reads, 11,262,353 reads pseudoaligned [quant] estimated average fragment length: 229.537 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52401 SRR7169894.ke.tsv 34699 SRR7169894.se.tsv 87100 total ==> SRR7169894.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.46 184 9.77569 Potri.005G024800.1.v4.1 1035 806.463 40 4.7155 Potri.004G059700.1.v4.1 961 732.489 5 0.648965 Potri.007G009000.2.v4.1 1416 1187.46 0 0 Potri.003G141000.2.v4.1 2943 2714.46 230.125 8.05994 Potri.016G087400.1.v4.1 270 87.4379 940.082 1022.16 Potri.015G069301.1.v4.1 564 339.761 0 0 Potri.010G195200.1.v4.1 1773 1544.46 3 0.18467 Potri.012G127500.1.v4.1 977 748.484 4909 623.538 ==> SRR7169894.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 629 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 182 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169894 completed mapping pipeline successfully