Starting /dee2/code/volunteer_pipeline.sh SRR7169895 current disk space = 3050256060416 free memory = 1345701920 SRR7169895 SRAfilesize ef14c3284700fa60586505c3681fdf3e SRR7169895.sra SRR7169895.sra file validated SRR7169895 is paired end SRR7169895 is conventional basespace SRR7169895 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169895_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.8135 18.0 18.0 18.0 18.0 32.0 2 25.8625 27.0 25.0 27.0 18.0 29.0 3 25.008 27.0 18.0 29.0 18.0 31.0 4 29.54675 30.0 29.0 31.0 27.0 33.0 5 30.43675 31.0 29.0 33.0 27.0 33.0 6 35.1695 37.0 34.0 38.0 29.0 38.0 7 36.846 38.0 37.0 38.0 35.0 38.0 8 37.09175 38.0 38.0 38.0 35.0 38.0 9 37.42525 38.0 38.0 38.0 36.0 38.0 10-14 37.616049999999994 38.0 38.0 38.0 37.4 38.0 15-19 37.589999999999996 38.0 38.0 38.0 37.4 38.0 20-24 37.7326 38.0 38.0 38.0 38.0 38.0 25-29 37.7771 38.0 38.0 38.0 38.0 38.0 30-34 37.70885 38.0 38.0 38.0 38.0 38.0 35-39 37.528549999999996 38.0 38.0 38.0 37.6 38.0 40-44 37.69155 38.0 38.0 38.0 38.0 38.0 45-49 37.64104999999999 38.0 38.0 38.0 38.0 38.0 50-54 37.556349999999995 38.0 38.0 38.0 37.4 38.0 55-59 37.454449999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.37095 38.0 38.0 38.0 37.0 38.0 65-69 37.27515 38.0 38.0 38.0 37.0 38.0 70-74 37.02475 38.0 38.0 38.0 35.8 38.0 75-79 36.823150000000005 38.0 38.0 38.0 35.2 38.0 80-84 37.02305 38.0 38.0 38.0 35.8 38.0 85-89 36.968399999999995 38.0 38.0 38.0 35.8 38.0 90-94 36.902750000000005 38.0 38.0 38.0 35.4 38.0 95-99 36.82065 38.0 38.0 38.0 35.0 38.0 100-104 36.5689 38.0 38.0 38.0 34.4 38.0 105-109 35.338150000000006 38.0 36.0 38.0 27.2 38.0 110-114 35.551249999999996 38.0 36.2 38.0 28.6 38.0 115-119 36.08135 38.0 37.0 38.0 33.4 38.0 120-124 35.929199999999994 38.0 37.0 38.0 32.8 38.0 125-129 35.336 38.0 36.0 38.0 29.4 38.0 130-134 35.0493 38.0 35.4 38.0 28.4 38.0 135-139 34.08215 38.0 33.8 38.0 22.6 38.0 140-144 33.828700000000005 38.0 33.2 38.0 23.0 38.0 145-149 32.76915 38.0 32.8 38.0 17.2 38.0 150-151 27.95675 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 1.0 17 2.0 18 3.0 19 4.0 20 0.0 21 4.0 22 7.0 23 4.0 24 8.0 25 3.0 26 13.0 27 16.0 28 18.0 29 26.0 30 28.0 31 40.0 32 74.0 33 112.0 34 211.0 35 462.0 36 1426.0 37 1536.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.444444444444446 40.01501501501502 7.6076076076076085 32.932932932932935 2 23.325000000000003 15.049999999999999 34.225 27.400000000000002 3 20.375 20.7 26.1 32.824999999999996 4 22.95 28.95 24.25 23.849999999999998 5 22.900000000000002 32.025 24.025 21.05 6 19.1 36.325 24.95 19.625 7 14.499999999999998 26.5 41.775 17.224999999999998 8 18.25 25.724999999999998 31.175000000000004 24.85 9 17.925 23.175 34.599999999999994 24.3 10-14 19.715 30.665 27.034999999999997 22.585 15-19 20.07 28.93 28.34 22.66 20-24 19.689999999999998 29.054999999999996 28.23 23.025000000000002 25-29 19.525000000000002 29.360000000000003 28.03 23.085 30-34 19.97 28.92 28.110000000000003 23.0 35-39 20.125 28.694999999999997 28.035 23.145 40-44 19.85 29.354999999999997 27.425 23.369999999999997 45-49 19.625 29.599999999999998 27.525 23.25 50-54 19.49 29.185 27.975 23.35 55-59 20.455000000000002 28.945 27.694999999999997 22.905 60-64 19.759999999999998 29.205 27.485 23.549999999999997 65-69 20.385 29.005 27.375 23.235 70-74 19.865 29.37 27.134999999999998 23.630000000000003 75-79 20.419999999999998 28.84 27.339999999999996 23.400000000000002 80-84 20.255000000000003 29.049999999999997 27.544999999999998 23.150000000000002 85-89 20.28 28.720000000000002 27.775 23.225 90-94 20.18 29.465000000000003 27.72 22.634999999999998 95-99 19.56 28.78 27.939999999999998 23.72 100-104 20.66 29.404999999999998 26.93 23.005 105-109 21.2 28.199999999999996 27.150000000000002 23.45 110-114 20.31 28.705000000000002 27.37 23.615 115-119 20.974999999999998 29.154999999999998 27.1 22.770000000000003 120-124 20.485 28.985 26.840000000000003 23.69 125-129 20.83771205524696 28.889556122704295 27.042986538557773 23.229745283490967 130-134 20.875 28.975 26.655 23.494999999999997 135-139 20.95 28.395 27.065 23.59 140-144 21.05 28.939999999999998 26.179999999999996 23.830000000000002 145-149 20.815 29.24 26.055 23.89 150-151 21.5625 28.5875 25.95 23.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.5 21 1.0 22 1.5 23 1.5 24 2.0 25 4.5 26 5.0 27 6.0 28 9.5 29 12.0 30 20.5 31 35.0 32 41.5 33 52.0 34 67.0 35 83.5 36 105.0 37 136.0 38 149.0 39 166.0 40 204.5 41 226.5 42 264.0 43 287.0 44 280.5 45 273.5 46 273.5 47 241.0 48 218.0 49 194.5 50 144.5 51 126.0 52 99.5 53 71.0 54 54.0 55 39.5 56 28.5 57 19.5 58 14.0 59 11.0 60 5.5 61 5.0 62 5.5 63 2.5 64 1.0 65 2.0 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.08499999999999999 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.7875 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 90-91 1.0375 0.0 0.0 0.0 0.0 92-93 1.25 0.0 0.0 0.0 0.0 94-95 1.575 0.0 0.0 0.0 0.0 96-97 1.775 0.0 0.0 0.0 0.0 98-99 1.9375 0.0 0.0 0.0 0.0 100-101 2.275 0.0 0.0 0.0 0.0 102-103 2.6125 0.0 0.0 0.0 0.0 104-105 2.925 0.0 0.0 0.0 0.0 106-107 3.2625 0.0 0.0 0.0 0.0 108-109 3.725 0.0 0.0 0.0 0.0 110-111 4.275 0.0 0.0 0.0 0.0 112-113 4.725 0.0 0.0 0.0 0.0 114-115 5.275 0.0 0.0 0.0 0.0 116-117 5.887499999999999 0.0 0.0 0.0 0.0 118-119 6.6 0.0 0.0 0.0 0.0 120-121 7.262499999999999 0.0 0.0 0.0 0.0 122-123 7.9125 0.0 0.0 0.0 0.0 124-125 8.55 0.0 0.0 0.0 0.0 126-127 9.1 0.0 0.0 0.0 0.0 128-129 9.7375 0.0 0.0 0.0 0.0 130-131 10.399999999999999 0.0 0.0 0.0 0.0 132-133 11.175 0.0 0.0 0.0 0.0 134-135 12.024999999999999 0.0 0.0 0.0 0.0 136-137 13.025 0.0 0.0 0.0 0.0 138-139 13.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCGTAT 10 0.006830828 145.0 145 >>END_MODULE SRR7169895 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169895_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.208 34.0 33.0 34.0 33.0 34.0 2 33.35825 34.0 33.0 34.0 33.0 34.0 3 33.388 34.0 33.0 34.0 33.0 34.0 4 33.45475 34.0 33.0 34.0 33.0 34.0 5 33.461 34.0 33.0 34.0 33.0 34.0 6 37.6595 38.0 38.0 38.0 38.0 38.0 7 37.6225 38.0 38.0 38.0 38.0 38.0 8 37.613 38.0 38.0 38.0 38.0 38.0 9 37.584 38.0 38.0 38.0 38.0 38.0 10-14 37.534850000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.530350000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.256299999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.40675 38.0 38.0 38.0 38.0 38.0 30-34 37.2185 38.0 38.0 38.0 36.8 38.0 35-39 37.5219 38.0 38.0 38.0 38.0 38.0 40-44 37.41025 38.0 38.0 38.0 37.8 38.0 45-49 37.3159 38.0 38.0 38.0 37.2 38.0 50-54 37.439499999999995 38.0 38.0 38.0 38.0 38.0 55-59 37.46 38.0 38.0 38.0 38.0 38.0 60-64 37.288599999999995 38.0 38.0 38.0 37.8 38.0 65-69 37.27329999999999 38.0 38.0 38.0 37.2 38.0 70-74 36.592650000000006 38.0 37.8 38.0 33.4 38.0 75-79 36.833299999999994 38.0 38.0 38.0 35.4 38.0 80-84 37.228 38.0 38.0 38.0 37.0 38.0 85-89 37.1212 38.0 38.0 38.0 37.0 38.0 90-94 37.15805 38.0 38.0 38.0 37.0 38.0 95-99 37.084199999999996 38.0 38.0 38.0 36.4 38.0 100-104 36.890699999999995 38.0 38.0 38.0 36.0 38.0 105-109 36.7787 38.0 38.0 38.0 35.6 38.0 110-114 36.107299999999995 38.0 37.2 38.0 32.4 38.0 115-119 36.57285 38.0 38.0 38.0 34.8 38.0 120-124 36.41255 38.0 38.0 38.0 34.2 38.0 125-129 36.261849999999995 38.0 38.0 38.0 33.8 38.0 130-134 35.84740000000001 38.0 37.4 38.0 32.0 38.0 135-139 35.4335 38.0 36.2 38.0 30.6 38.0 140-144 31.354750000000003 36.4 27.8 38.0 14.4 38.0 145-149 34.078900000000004 38.0 35.0 38.0 26.0 38.0 150-151 29.14225 34.5 18.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 2.0 5 0.0 6 0.0 7 0.0 8 3.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 2.0 15 1.0 16 1.0 17 1.0 18 2.0 19 5.0 20 3.0 21 7.0 22 2.0 23 4.0 24 3.0 25 8.0 26 9.0 27 9.0 28 22.0 29 21.0 30 28.0 31 27.0 32 55.0 33 63.0 34 127.0 35 258.0 36 789.0 37 2539.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.925 20.775 12.925 26.375 2 25.156289072268066 26.9567391847962 31.48287071767942 16.404101025256317 3 20.7551887971993 28.132033008252062 31.58289572393098 19.529882470617654 4 24.131032758189548 33.30832708177044 24.10602650662666 18.454613653413354 5 24.956239059764943 36.434108527131784 20.505126281570394 18.104526131532882 6 20.8 38.375 23.3 17.525 7 20.705176294073517 21.8304576144036 37.88447111777945 19.579894973743436 8 21.45536384096024 26.231557889472366 28.93223305826457 23.380845211302827 9 22.375 24.5 29.675 23.45 10-14 23.37116855842792 28.97644882244112 26.421321066053306 21.231061553077655 15-19 22.919999999999998 27.73 28.24 21.11 20-24 22.746137306865343 27.461373068653433 29.35646782339117 20.436021801090053 25-29 22.775000000000002 28.645 27.965 20.615 30-34 22.425 28.325 28.965000000000003 20.285 35-39 22.88 27.905 27.939999999999998 21.275 40-44 22.937293729372936 27.81278127812781 28.95789578957896 20.292029202920293 45-49 23.125 27.584999999999997 29.01 20.28 50-54 22.531126556327816 28.036401820091005 28.891444572228615 20.541027051352568 55-59 23.205000000000002 27.68 28.744999999999997 20.369999999999997 60-64 23.43 28.17 28.175 20.225 65-69 23.455000000000002 27.93 28.23 20.385 70-74 23.35 27.76 28.939999999999998 19.950000000000003 75-79 23.18 28.1 28.285 20.435 80-84 23.369999999999997 27.92 28.4 20.31 85-89 23.544999999999998 28.34 28.88 19.235 90-94 23.645 28.255000000000003 27.810000000000002 20.29 95-99 23.185 28.299999999999997 28.299999999999997 20.215 100-104 23.74 28.000000000000004 28.310000000000002 19.950000000000003 105-109 24.167416741674167 28.487848784878487 27.772777277727773 19.571957195719573 110-114 24.23 28.585 27.450000000000003 19.735 115-119 24.310000000000002 28.470000000000002 27.875 19.345000000000002 120-124 24.215 27.88 28.035 19.869999999999997 125-129 24.8 28.1 27.275 19.825 130-134 25.11 27.825 27.189999999999998 19.875 135-139 25.2 27.575 27.529999999999998 19.695 140-144 25.900000000000002 27.565 27.565 18.970000000000002 145-149 26.415 26.950000000000003 27.105 19.53 150-151 26.0375 27.325 27.250000000000004 19.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 2.0 25 1.5 26 1.5 27 3.0 28 4.5 29 7.0 30 13.0 31 16.0 32 25.5 33 43.5 34 54.0 35 73.5 36 94.5 37 110.0 38 150.5 39 189.5 40 213.5 41 243.0 42 263.5 43 281.0 44 301.0 45 299.5 46 291.5 47 264.0 48 220.0 49 193.0 50 149.5 51 111.5 52 101.0 53 81.0 54 56.5 55 41.5 56 30.5 57 19.0 58 12.5 59 9.5 60 5.5 61 4.0 62 2.5 63 2.0 64 2.0 65 1.0 66 1.5 67 1.5 68 0.5 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.025 8 0.025 9 0.0 10-14 0.005 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.01 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.5375 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.9125000000000001 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.225 0.0 0.0 0.0 0.0 94-95 1.55 0.0 0.0 0.0 0.0 96-97 1.75 0.0 0.0 0.0 0.0 98-99 1.9125 0.0 0.0 0.0 0.0 100-101 2.3125 0.0 0.0 0.0 0.0 102-103 2.6625 0.0 0.0 0.0 0.0 104-105 2.9749999999999996 0.0 0.0 0.0 0.0 106-107 3.325 0.0 0.0 0.0 0.0 108-109 3.8 0.0 0.0 0.0 0.0 110-111 4.3375 0.0 0.0 0.0 0.0 112-113 4.8 0.0 0.0 0.0 0.0 114-115 5.375 0.0 0.0 0.0 0.0 116-117 5.9625 0.0 0.0 0.0 0.0 118-119 6.65 0.0 0.0 0.0 0.0 120-121 7.3125 0.0 0.0 0.0 0.0 122-123 8.0125 0.0 0.0 0.0 0.0 124-125 8.625 0.0 0.0 0.0 0.0 126-127 9.15 0.0 0.0 0.0 0.0 128-129 9.8125 0.0 0.0 0.0 0.0 130-131 10.45 0.0 0.0 0.0 0.0 132-133 11.1875 0.0 0.0 0.0 0.0 134-135 12.0125 0.0 0.0 0.0 0.0 136-137 12.962499999999999 0.0 0.0 0.0 0.0 138-139 13.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTGTG 35 0.0033124194 62.14286 145 >>END_MODULE Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664941 spots for SRR7169895.sra Written 664941 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra Read 664928 spots for SRR7169895.sra Written 664928 spots for SRR7169895.sra SRR ids: ['SRR7169895.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t5tq8k9k SRR7169895.sra spots: 13298573 blocks: [[1, 664928], [664929, 1329856], [1329857, 1994784], [1994785, 2659712], [2659713, 3324640], [3324641, 3989568], [3989569, 4654496], [4654497, 5319424], [5319425, 5984352], [5984353, 6649280], [6649281, 7314208], [7314209, 7979136], [7979137, 8644064], [8644065, 9308992], [9308993, 9973920], [9973921, 10638848], [10638849, 11303776], [11303777, 11968704], [11968705, 12633632], [12633633, 13298573]] SRR7169895 file size 4484749 SRR7169895 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169895 SRR7169895_1.fastq SRR7169895_2.fastq Input file: SRR7169895_1.fastq Paired file: SRR7169895_2.fastq trimmed: SRR7169895-trimmed-pair1.fastq, SRR7169895-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:04:15 2025 >> started Wed Feb 12 02:04:31 2025 >> done (15.470s) 13298573 read pairs processed; of these: 9257 ( 0.07%) short read pairs filtered out after trimming by size control 11688 ( 0.09%) empty read pairs filtered out after trimming by size control 13277628 (99.84%) read pairs available; of these: 6958823 (52.41%) trimmed read pairs available after processing 6318805 (47.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 2 0.00% 22 2 0.00% 23 0 0.00% 24 5 0.00% 25 3 0.00% 26 3 0.00% 27 4 0.00% 28 5 0.00% 29 2 0.00% 30 5 0.00% 31 3 0.00% 32 5 0.00% 33 4 0.00% 34 5 0.00% 35 8 0.00% 36 9 0.00% 37 13 0.00% 38 11 0.00% 39 15 0.00% 40 17 0.00% 41 21 0.00% 42 17 0.00% 43 19 0.00% 44 19 0.00% 45 33 0.00% 46 36 0.00% 47 31 0.00% 48 57 0.00% 49 59 0.00% 50 68 0.00% 51 90 0.00% 52 78 0.00% 53 104 0.00% 54 157 0.00% 55 136 0.00% 56 150 0.00% 57 184 0.00% 58 192 0.00% 59 267 0.00% 60 328 0.00% 61 369 0.00% 62 434 0.00% 63 510 0.00% 64 618 0.00% 65 638 0.00% 66 739 0.01% 67 836 0.01% 68 1011 0.01% 69 1159 0.01% 70 1303 0.01% 71 1505 0.01% 72 1829 0.01% 73 2083 0.02% 74 2478 0.02% 75 2621 0.02% 76 2967 0.02% 77 3216 0.02% 78 3593 0.03% 79 4183 0.03% 80 4476 0.03% 81 5269 0.04% 82 6094 0.05% 83 6909 0.05% 84 7962 0.06% 85 8797 0.07% 86 9652 0.07% 87 10098 0.08% 88 11112 0.08% 89 12096 0.09% 90 12906 0.10% 91 14214 0.11% 92 15467 0.12% 93 16724 0.13% 94 18350 0.14% 95 19415 0.15% 96 20534 0.15% 97 21518 0.16% 98 22238 0.17% 99 23497 0.18% 100 24819 0.19% 101 25720 0.19% 102 27765 0.21% 103 29216 0.22% 104 30632 0.23% 105 32209 0.24% 106 33412 0.25% 107 34475 0.26% 108 35572 0.27% 109 36127 0.27% 110 37044 0.28% 111 38022 0.29% 112 40334 0.30% 113 41936 0.32% 114 43076 0.32% 115 45220 0.34% 116 45867 0.35% 117 47075 0.35% 118 47335 0.36% 119 47662 0.36% 120 48437 0.36% 121 50150 0.38% 122 51030 0.38% 123 52419 0.39% 124 54418 0.41% 125 55858 0.42% 126 57481 0.43% 127 58398 0.44% 128 59110 0.45% 129 59953 0.45% 130 60298 0.45% 131 61592 0.46% 132 62867 0.47% 133 65259 0.49% 134 66622 0.50% 135 69107 0.52% 136 71508 0.54% 137 73731 0.56% 138 75921 0.57% 139 77972 0.59% 140 81286 0.61% 141 85718 0.65% 142 91699 0.69% 143 103828 0.78% 144 111394 0.84% 145 132313 1.00% 146 152260 1.15% 147 198994 1.50% 148 304863 2.30% 149 594886 4.48% 150 2824345 21.27% 151 6318805 47.59% 13277628 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=11.75 fanout-score-rank=12 prefix-density=0.31 prefix-fanout=6.5 sequence=CAACCTCAACAGTGGCCATTGGAACTAGAAGGAAAATAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=267.49 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=29.1 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=34 prefix-density=0.33 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=229.62 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=25.9 sequence=GAAGAAGAAGAAA SRR7169895 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:05:14 Started mapping on | Feb 12 02:05:14 Finished on | Feb 12 02:06:30 Mapping speed, Million of reads per hour | 628.94 Number of input reads | 13277628 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 12760554 Uniquely mapped reads % | 96.11% Average mapped length | 288.50 Number of splices: Total | 11807668 Number of splices: Annotated (sjdb) | 11608374 Number of splices: GT/AG | 11632573 Number of splices: GC/AG | 138675 Number of splices: AT/AC | 9769 Number of splices: Non-canonical | 26651 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 231964 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 20439 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.95% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 292202 292202 292202 N_multimapping 231964 231964 231964 N_noFeature 353272 12622602 420029 N_ambiguous 121036 572 49484 UnstrandedReadsAssigned:12286246 PositiveStrandReadsAssigned:137380 NegativeStrandReadsAssigned:12291041 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7169895 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169895-trimmed-pair1.fastq SRR7169895-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,277,628 reads, 12,207,990 reads pseudoaligned [quant] estimated average fragment length: 207.709 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR7169895.ke.tsv 34699 SRR7169895.se.tsv 87100 total ==> SRR7169895.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1811.29 215 10.9641 Potri.005G024800.1.v4.1 1035 828.291 24 2.67639 Potri.004G059700.1.v4.1 961 754.291 2 0.244913 Potri.007G009000.2.v4.1 1416 1209.29 0 0 Potri.003G141000.2.v4.1 2943 2736.29 235.065 7.93501 Potri.016G087400.1.v4.1 270 97.3389 1085 1029.59 Potri.015G069301.1.v4.1 564 360.126 0 0 Potri.010G195200.1.v4.1 1773 1566.29 13 0.766642 Potri.012G127500.1.v4.1 977 770.291 4286 513.948 ==> SRR7169895.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 981 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 240 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169895 completed mapping pipeline successfully