Starting /dee2/code/volunteer_pipeline.sh SRR7169896 current disk space = 3051162640384 free memory = 1413396720 SRR7169896 SRAfilesize d84001a3f82ced09bde99a42014ea6ea SRR7169896.sra SRR7169896.sra file validated SRR7169896 is paired end SRR7169896 is conventional basespace SRR7169896 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169896_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.70675 18.0 18.0 18.0 18.0 32.0 2 25.63 27.0 25.0 27.0 18.0 29.0 3 26.81675 27.0 25.0 29.0 18.0 31.0 4 30.7035 31.0 29.0 33.0 27.0 33.0 5 31.52975 33.0 31.0 33.0 29.0 33.0 6 36.08425 37.0 36.0 38.0 33.0 38.0 7 37.0805 38.0 37.0 38.0 35.0 38.0 8 37.35475 38.0 38.0 38.0 36.0 38.0 9 37.4285 38.0 38.0 38.0 37.0 38.0 10-14 37.544799999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.548199999999994 38.0 38.0 38.0 37.2 38.0 20-24 37.65830000000001 38.0 38.0 38.0 37.8 38.0 25-29 37.628550000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.615249999999996 38.0 38.0 38.0 37.8 38.0 35-39 37.6256 38.0 38.0 38.0 38.0 38.0 40-44 37.6182 38.0 38.0 38.0 38.0 38.0 45-49 37.571299999999994 38.0 38.0 38.0 37.8 38.0 50-54 37.3798 38.0 38.0 38.0 37.0 38.0 55-59 37.2822 38.0 38.0 38.0 36.4 38.0 60-64 37.05499999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.638400000000004 38.0 37.6 38.0 34.2 38.0 70-74 36.960950000000004 38.0 38.0 38.0 35.6 38.0 75-79 36.96939999999999 38.0 38.0 38.0 35.8 38.0 80-84 36.737899999999996 38.0 37.8 38.0 34.6 38.0 85-89 36.2906 38.0 37.4 38.0 33.0 38.0 90-94 36.42115 38.0 37.4 38.0 34.0 38.0 95-99 36.362100000000005 38.0 37.0 38.0 34.0 38.0 100-104 35.9707 38.0 36.8 38.0 32.2 38.0 105-109 35.47765 38.0 36.0 38.0 29.6 38.0 110-114 35.38015 38.0 36.0 38.0 30.0 38.0 115-119 34.4647 38.0 34.4 38.0 24.8 38.0 120-124 34.1707 38.0 34.0 38.0 22.6 38.0 125-129 32.784800000000004 37.4 31.6 38.0 16.6 38.0 130-134 33.31155 37.6 32.2 38.0 21.8 38.0 135-139 32.99855 37.8 32.6 38.0 20.0 38.0 140-144 32.064 37.0 30.8 38.0 14.4 38.0 145-149 30.420049999999996 36.0 28.4 38.0 8.0 38.0 150-151 24.118375 31.5 13.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 2.0 13 1.0 14 1.0 15 2.0 16 1.0 17 4.0 18 2.0 19 3.0 20 3.0 21 6.0 22 8.0 23 3.0 24 11.0 25 13.0 26 14.0 27 20.0 28 23.0 29 29.0 30 63.0 31 74.0 32 108.0 33 200.0 34 356.0 35 737.0 36 1419.0 37 896.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.280140951422098 38.358922728416815 9.187012333249434 33.17392398691165 2 24.3 15.775 32.300000000000004 27.625 3 21.55 17.925 26.150000000000002 34.375 4 24.275 24.6 22.675 28.449999999999996 5 23.400000000000002 31.35 23.775 21.475 6 20.474999999999998 33.900000000000006 23.925 21.7 7 14.399999999999999 28.475 40.6 16.525000000000002 8 17.775 27.675 31.724999999999998 22.825 9 17.150000000000002 25.05 35.075 22.725 10-14 19.605 30.270000000000003 27.92 22.205 15-19 19.52 29.065 28.21 23.205000000000002 20-24 19.77 29.385 27.700000000000003 23.145 25-29 19.025 29.53 27.939999999999998 23.505000000000003 30-34 19.634999999999998 29.494999999999997 27.66 23.21 35-39 19.675 29.53 27.6 23.195 40-44 19.46 29.799999999999997 27.74 23.0 45-49 19.89 28.28 27.939999999999998 23.89 50-54 19.425 29.62 27.800000000000004 23.155 55-59 20.27 28.854999999999997 27.675 23.200000000000003 60-64 19.7 28.994999999999997 27.915 23.39 65-69 19.869999999999997 29.110000000000003 27.76 23.26 70-74 19.88 28.89 27.52 23.71 75-79 19.814999999999998 28.98 27.450000000000003 23.755000000000003 80-84 20.01 28.95 27.605 23.435 85-89 19.57 29.099999999999998 27.74 23.59 90-94 20.43 28.499999999999996 27.55 23.52 95-99 19.915 28.875 27.450000000000003 23.76 100-104 19.825 29.160000000000004 27.589999999999996 23.425 105-109 20.330000000000002 29.470000000000002 27.24 22.96 110-114 20.20237439262636 29.31423132795672 27.12017231878976 23.363221960627158 115-119 20.110192837465565 29.346356123215628 27.56824442774856 22.975206611570247 120-124 20.637861112501877 29.089270515195516 27.33189806238422 22.94097030991839 125-129 20.21526908635795 28.650813516896118 27.349186483103882 23.78473091364205 130-134 20.485 27.950000000000003 28.005000000000003 23.56 135-139 20.369999999999997 28.84 27.384999999999998 23.405 140-144 20.235 28.444999999999997 27.685 23.635 145-149 20.32 28.92 27.47 23.29 150-151 20.4 28.287499999999998 27.500000000000004 23.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.5 24 3.0 25 3.0 26 4.5 27 6.0 28 10.5 29 18.5 30 18.5 31 20.0 32 32.0 33 48.0 34 62.5 35 88.0 36 103.5 37 122.5 38 155.5 39 176.5 40 211.0 41 257.5 42 262.5 43 252.0 44 277.0 45 283.0 46 268.5 47 260.0 48 236.0 49 198.0 50 151.5 51 132.5 52 104.0 53 64.0 54 51.0 55 36.0 56 25.5 57 16.0 58 7.5 59 6.5 60 7.0 61 4.5 62 2.5 63 2.5 64 3.0 65 1.0 66 0.5 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.185 115-119 0.17500000000000002 120-124 0.135 125-129 0.125 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06636386575826 98.15 2 0.9336361342417362 1.8499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.075 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.2375 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.8625 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.1125 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.6625 0.0 0.0 0.0 0.0 126-127 2.8625 0.0 0.0 0.0 0.0 128-129 3.0125 0.0 0.0 0.0 0.0 130-131 3.2125 0.0 0.0 0.0 0.0 132-133 3.425 0.0 0.0 0.0 0.0 134-135 3.55 0.0 0.0 0.0 0.0 136-137 3.9125 0.0 0.0 0.0 0.0 138-139 4.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTGAC 10 0.006830828 145.0 5 TTTTTTT 40 0.0076550315 18.125 25-29 >>END_MODULE SRR7169896 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169896_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3095 34.0 33.0 34.0 33.0 34.0 2 33.3985 34.0 33.0 34.0 33.0 34.0 3 33.44725 34.0 33.0 34.0 33.0 34.0 4 33.403 34.0 33.0 34.0 33.0 34.0 5 33.39575 34.0 33.0 34.0 33.0 34.0 6 37.5185 38.0 38.0 38.0 38.0 38.0 7 37.48 38.0 38.0 38.0 38.0 38.0 8 37.48825 38.0 38.0 38.0 38.0 38.0 9 37.5005 38.0 38.0 38.0 38.0 38.0 10-14 37.09155 38.0 38.0 38.0 36.6 38.0 15-19 37.461400000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.302800000000005 38.0 38.0 38.0 37.2 38.0 25-29 37.406400000000005 38.0 38.0 38.0 37.8 38.0 30-34 37.4568 38.0 38.0 38.0 38.0 38.0 35-39 37.24249999999999 38.0 38.0 38.0 37.2 38.0 40-44 37.3375 38.0 38.0 38.0 37.2 38.0 45-49 37.3896 38.0 38.0 38.0 37.6 38.0 50-54 37.325450000000004 38.0 38.0 38.0 37.2 38.0 55-59 37.297700000000006 38.0 38.0 38.0 37.2 38.0 60-64 37.17165 38.0 38.0 38.0 37.0 38.0 65-69 36.8506 38.0 38.0 38.0 35.6 38.0 70-74 37.08284999999999 38.0 38.0 38.0 36.4 38.0 75-79 37.1085 38.0 38.0 38.0 36.4 38.0 80-84 36.9076 38.0 38.0 38.0 36.0 38.0 85-89 36.54815000000001 38.0 37.8 38.0 34.4 38.0 90-94 36.6742 38.0 38.0 38.0 34.8 38.0 95-99 36.6833 38.0 38.0 38.0 35.0 38.0 100-104 35.262100000000004 38.0 36.0 38.0 28.0 38.0 105-109 35.9982 38.0 37.0 38.0 32.2 38.0 110-114 35.8601 38.0 37.4 38.0 32.0 38.0 115-119 34.703649999999996 38.0 35.0 38.0 25.4 38.0 120-124 34.8878 38.0 35.6 38.0 27.4 38.0 125-129 33.8183 38.0 33.6 38.0 21.4 38.0 130-134 33.0538 38.0 32.0 38.0 19.2 38.0 135-139 33.04995 38.0 33.0 38.0 18.8 38.0 140-144 32.6382 37.6 32.0 38.0 18.0 38.0 145-149 30.8298 36.8 29.6 38.0 7.8 38.0 150-151 25.352 32.5 16.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 0.0 6 2.0 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 5.0 17 3.0 18 5.0 19 5.0 20 10.0 21 5.0 22 7.0 23 8.0 24 12.0 25 13.0 26 15.0 27 38.0 28 22.0 29 32.0 30 44.0 31 58.0 32 77.0 33 121.0 34 261.0 35 400.0 36 1055.0 37 1791.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.625 21.425 14.85 26.1 2 28.4 24.675 29.599999999999998 17.325 3 20.424999999999997 27.325 32.375 19.875 4 23.400000000000002 32.7 25.124999999999996 18.775 5 24.95 35.325 23.175 16.55 6 20.45 37.75 22.85 18.95 7 19.3 22.85 39.074999999999996 18.775 8 22.325 25.624999999999996 28.025 24.025 9 20.925 26.450000000000003 29.275000000000002 23.35 10-14 23.385 29.325000000000003 26.47 20.82 15-19 23.225 28.63 27.35 20.794999999999998 20-24 22.985 28.68 27.38 20.955 25-29 23.315 28.315 27.655 20.715 30-34 22.994999999999997 28.075 27.655 21.275 35-39 22.35 28.49 28.645 20.515 40-44 23.150000000000002 28.244999999999997 28.16 20.445 45-49 22.805 28.139999999999997 28.060000000000002 20.995 50-54 22.830000000000002 27.455000000000002 28.194999999999997 21.52 55-59 22.91 27.639999999999997 28.87 20.580000000000002 60-64 22.2 28.660000000000004 28.4 20.74 65-69 23.555 28.21 28.310000000000002 19.925 70-74 23.375 28.205000000000002 28.455000000000002 19.965 75-79 23.615 27.54 28.035 20.810000000000002 80-84 23.36 27.955000000000002 28.189999999999998 20.495 85-89 23.52 27.905 28.075 20.5 90-94 23.815 27.894999999999996 28.04 20.25 95-99 23.76 27.939999999999998 28.139999999999997 20.16 100-104 24.205 28.199999999999996 27.505000000000003 20.09 105-109 22.99 28.325 28.310000000000002 20.375 110-114 22.99 28.335 28.235 20.44 115-119 24.075 27.675 28.51 19.74 120-124 23.36 28.21 28.16 20.27 125-129 24.399759903961584 27.606042416966787 27.77611044417767 20.218087234893957 130-134 24.12 27.99 27.894999999999996 19.994999999999997 135-139 24.235 27.500000000000004 28.685 19.580000000000002 140-144 23.73 27.675 28.51 20.085 145-149 24.02 27.750000000000004 28.225 20.005 150-151 24.825 26.337500000000002 28.8375 20.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 1.5 28 3.0 29 4.5 30 9.0 31 14.5 32 19.0 33 33.0 34 49.5 35 58.5 36 79.0 37 103.0 38 140.5 39 183.5 40 214.5 41 256.5 42 272.5 43 291.5 44 305.0 45 300.0 46 293.5 47 264.0 48 241.0 49 210.0 50 171.0 51 127.5 52 99.5 53 81.5 54 51.5 55 36.0 56 26.5 57 16.5 58 13.0 59 8.0 60 4.0 61 4.5 62 3.5 63 1.5 64 0.5 65 0.5 66 1.5 67 1.5 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.04 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75949367088607 97.52499999999999 2 1.2151898734177216 2.4 3 0.025316455696202535 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.075 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.0625 0.0 0.0 0.0 0.0 120-121 2.2249999999999996 0.0 0.0 0.0 0.0 122-123 2.325 0.0 0.0 0.0 0.0 124-125 2.6125 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.1625 0.0 0.0 0.0 0.0 132-133 3.375 0.0 0.0 0.0 0.0 134-135 3.5 0.0 0.0 0.0 0.0 136-137 3.85 0.0 0.0 0.0 0.0 138-139 4.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra Read 613574 spots for SRR7169896.sra Written 613574 spots for SRR7169896.sra Read 613568 spots for SRR7169896.sra Written 613568 spots for SRR7169896.sra SRR ids: ['SRR7169896.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oqszhl3k SRR7169896.sra spots: 12271366 blocks: [[1, 613568], [613569, 1227136], [1227137, 1840704], [1840705, 2454272], [2454273, 3067840], [3067841, 3681408], [3681409, 4294976], [4294977, 4908544], [4908545, 5522112], [5522113, 6135680], [6135681, 6749248], [6749249, 7362816], [7362817, 7976384], [7976385, 8589952], [8589953, 9203520], [9203521, 9817088], [9817089, 10430656], [10430657, 11044224], [11044225, 11657792], [11657793, 12271366]] SRR7169896 file size 4136662 SRR7169896 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169896 SRR7169896_1.fastq SRR7169896_2.fastq Input file: SRR7169896_1.fastq Paired file: SRR7169896_2.fastq trimmed: SRR7169896-trimmed-pair1.fastq, SRR7169896-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:18:01 2025 >> started Wed Feb 12 01:18:23 2025 >> done (21.647s) 12271366 read pairs processed; of these: 6345 ( 0.05%) short read pairs filtered out after trimming by size control 10525 ( 0.09%) empty read pairs filtered out after trimming by size control 12254496 (99.86%) read pairs available; of these: 6012719 (49.07%) trimmed read pairs available after processing 6241777 (50.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 0 0.00% 21 3 0.00% 22 4 0.00% 23 4 0.00% 24 2 0.00% 25 1 0.00% 26 1 0.00% 27 2 0.00% 28 2 0.00% 29 5 0.00% 30 2 0.00% 31 1 0.00% 32 0 0.00% 33 6 0.00% 34 5 0.00% 35 4 0.00% 36 7 0.00% 37 7 0.00% 38 5 0.00% 39 13 0.00% 40 5 0.00% 41 14 0.00% 42 14 0.00% 43 10 0.00% 44 16 0.00% 45 19 0.00% 46 20 0.00% 47 28 0.00% 48 38 0.00% 49 33 0.00% 50 45 0.00% 51 64 0.00% 52 59 0.00% 53 52 0.00% 54 64 0.00% 55 88 0.00% 56 71 0.00% 57 105 0.00% 58 124 0.00% 59 142 0.00% 60 170 0.00% 61 188 0.00% 62 227 0.00% 63 219 0.00% 64 274 0.00% 65 310 0.00% 66 354 0.00% 67 417 0.00% 68 444 0.00% 69 538 0.00% 70 614 0.01% 71 686 0.01% 72 746 0.01% 73 929 0.01% 74 1091 0.01% 75 1217 0.01% 76 1288 0.01% 77 1434 0.01% 78 1524 0.01% 79 1610 0.01% 80 1850 0.02% 81 2040 0.02% 82 2323 0.02% 83 2628 0.02% 84 3287 0.03% 85 3694 0.03% 86 3822 0.03% 87 4001 0.03% 88 4428 0.04% 89 4572 0.04% 90 4878 0.04% 91 5082 0.04% 92 5485 0.04% 93 5824 0.05% 94 6184 0.05% 95 6617 0.05% 96 6938 0.06% 97 7249 0.06% 98 7501 0.06% 99 7616 0.06% 100 8074 0.07% 101 8258 0.07% 102 8953 0.07% 103 9404 0.08% 104 9851 0.08% 105 9974 0.08% 106 10748 0.09% 107 10957 0.09% 108 11355 0.09% 109 11669 0.10% 110 11576 0.09% 111 12011 0.10% 112 12488 0.10% 113 13142 0.11% 114 13638 0.11% 115 13987 0.11% 116 14461 0.12% 117 14883 0.12% 118 15456 0.13% 119 15522 0.13% 120 16112 0.13% 121 16598 0.14% 122 17299 0.14% 123 18002 0.15% 124 19044 0.16% 125 19695 0.16% 126 20791 0.17% 127 21750 0.18% 128 22242 0.18% 129 23226 0.19% 130 24610 0.20% 131 25789 0.21% 132 27398 0.22% 133 29120 0.24% 134 31578 0.26% 135 33797 0.28% 136 36772 0.30% 137 40056 0.33% 138 43660 0.36% 139 47702 0.39% 140 52302 0.43% 141 58959 0.48% 142 66863 0.55% 143 78028 0.64% 144 93829 0.77% 145 117217 0.96% 146 152355 1.24% 147 216200 1.76% 148 345859 2.82% 149 709050 5.79% 150 3239023 26.43% 151 6241777 50.93% 12254496 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=31 prefix-density=0.24 prefix-fanout=2.7 sequence=AAAGAAGTCAAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=184.81 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=17.3 sequence=TGCTTTCTTTTCCGTTACATAAGTCTTTACTGTTTGAAGCATAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=41 prefix-density=0.21 prefix-fanout=2.2 sequence=ATTGAATGGCCAGTTCAGATGGATTTCTTCTCAGATGAACCGCGTGAGGAATGGAGAGCTCTACCGTTACATTTGTGATACCAAGGGAGCTTTCGTGCAGCCTGCTTTGTATGAGGCTTTTGGATTGACTGTTGTTGAGGCCATGACATGTGGTTTGCCAACCTTTGCTACTTGCAATGGTGGTCCTGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=44 fanout-score=75.00 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=8.5 sequence=ATGTTGCTGCTGAAATT SRR7169896 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:19:17 Started mapping on | Feb 12 01:19:17 Finished on | Feb 12 01:20:38 Mapping speed, Million of reads per hour | 544.64 Number of input reads | 12254496 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11712667 Uniquely mapped reads % | 95.58% Average mapped length | 295.19 Number of splices: Total | 11132191 Number of splices: Annotated (sjdb) | 10957114 Number of splices: GT/AG | 10975914 Number of splices: GC/AG | 125310 Number of splices: AT/AC | 8212 Number of splices: Non-canonical | 22755 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 186293 % of reads mapped to multiple loci | 1.52% Number of reads mapped to too many loci | 11539 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.79% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 363276 363276 363276 N_multimapping 186293 186293 186293 N_noFeature 255187 11574495 303920 N_ambiguous 136909 665 46990 UnstrandedReadsAssigned:11320571 PositiveStrandReadsAssigned:137507 NegativeStrandReadsAssigned:11361757 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169896 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169896-trimmed-pair1.fastq SRR7169896-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,254,496 reads, 11,245,473 reads pseudoaligned [quant] estimated average fragment length: 280.687 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR7169896.ke.tsv 34699 SRR7169896.se.tsv 87100 total ==> SRR7169896.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.31 261 14.1877 Potri.005G024800.1.v4.1 1035 755.313 12 1.50125 Potri.004G059700.1.v4.1 961 681.34 6 0.832121 Potri.007G009000.2.v4.1 1416 1136.31 0 0 Potri.003G141000.2.v4.1 2943 2663.31 251.039 8.90671 Potri.016G087400.1.v4.1 270 75.2 986 1238.96 Potri.015G069301.1.v4.1 564 291.694 0 0 Potri.010G195200.1.v4.1 1773 1493.31 15 0.949161 Potri.012G127500.1.v4.1 977 697.327 2252 305.163 ==> SRR7169896.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1874 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 232 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 28 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169896 completed mapping pipeline successfully