Starting /dee2/code/volunteer_pipeline.sh SRR7169897 current disk space = 3050002178048 free memory = 1423936720 SRR7169897 SRAfilesize 5b4d2b6ef2efa18e2061f637e30faac4 SRR7169897.sra SRR7169897.sra file validated SRR7169897 is paired end SRR7169897 is conventional basespace SRR7169897 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169897_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.33775 18.0 18.0 18.0 18.0 30.0 2 27.06225 27.0 27.0 30.0 18.0 31.0 3 29.84325 31.0 29.0 33.0 27.0 33.0 4 31.59425 33.0 31.0 33.0 29.0 33.0 5 32.63825 33.0 33.0 33.0 31.0 34.0 6 37.163 38.0 37.0 38.0 36.0 38.0 7 37.5625 38.0 38.0 38.0 37.0 38.0 8 37.63425 38.0 38.0 38.0 38.0 38.0 9 37.6695 38.0 38.0 38.0 38.0 38.0 10-14 37.60835 38.0 38.0 38.0 37.8 38.0 15-19 37.6151 38.0 38.0 38.0 38.0 38.0 20-24 37.6144 38.0 38.0 38.0 37.8 38.0 25-29 37.5361 38.0 38.0 38.0 37.4 38.0 30-34 37.47725 38.0 38.0 38.0 37.2 38.0 35-39 37.5167 38.0 38.0 38.0 37.6 38.0 40-44 37.488 38.0 38.0 38.0 37.0 38.0 45-49 37.42895 38.0 38.0 38.0 37.0 38.0 50-54 37.226549999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.98725 38.0 38.0 38.0 35.6 38.0 60-64 36.842 38.0 38.0 38.0 35.0 38.0 65-69 36.29615 38.0 37.4 38.0 32.0 38.0 70-74 36.62415 38.0 37.8 38.0 34.2 38.0 75-79 36.607299999999995 38.0 38.0 38.0 34.2 38.0 80-84 36.4347 38.0 37.8 38.0 33.4 38.0 85-89 35.869400000000006 38.0 36.8 38.0 31.4 38.0 90-94 36.026700000000005 38.0 37.0 38.0 32.6 38.0 95-99 36.0241 38.0 37.0 38.0 33.0 38.0 100-104 35.58735 38.0 36.4 38.0 31.0 38.0 105-109 35.1277 38.0 35.6 38.0 27.6 38.0 110-114 35.05825 38.0 35.8 38.0 28.2 38.0 115-119 33.9587 37.6 33.6 38.0 23.8 38.0 120-124 33.753699999999995 38.0 33.6 38.0 22.4 38.0 125-129 31.66965 36.0 28.2 38.0 16.2 38.0 130-134 32.46635 36.6 31.0 38.0 17.4 38.0 135-139 32.189 37.0 31.0 38.0 14.0 38.0 140-144 30.96395 36.4 29.2 38.0 12.4 38.0 145-149 28.805650000000004 35.0 25.0 38.0 2.0 38.0 150-151 22.8805 28.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 2.0 11 1.0 12 1.0 13 2.0 14 1.0 15 0.0 16 2.0 17 3.0 18 2.0 19 6.0 20 2.0 21 6.0 22 8.0 23 14.0 24 16.0 25 18.0 26 14.0 27 30.0 28 39.0 29 45.0 30 71.0 31 97.0 32 158.0 33 224.0 34 407.0 35 693.0 36 1353.0 37 783.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.28722600151172 11.715797430083144 13.051146384479717 34.945830183925416 2 21.15 15.5 35.9 27.450000000000003 3 18.0 19.35 28.7 33.95 4 22.1 27.375 23.25 27.275 5 22.425 33.95 24.775 18.85 6 19.825 36.199999999999996 25.4 18.575 7 14.249999999999998 26.775 41.775 17.2 8 16.85 26.724999999999998 31.474999999999998 24.95 9 16.675 23.5 35.375 24.45 10-14 19.105 30.505 27.445000000000004 22.945 15-19 19.345000000000002 29.43 27.855 23.369999999999997 20-24 19.64 28.694999999999997 28.000000000000004 23.665 25-29 19.115 29.544999999999998 28.494999999999997 22.845 30-34 19.64 28.95 27.955000000000002 23.455000000000002 35-39 19.075 29.255 27.675 23.995 40-44 19.759999999999998 29.310000000000002 27.675 23.255 45-49 20.23 29.25 27.425 23.095 50-54 19.98 29.01 27.66 23.35 55-59 19.950000000000003 28.810000000000002 27.855 23.385 60-64 19.36 28.634999999999998 28.244999999999997 23.76 65-69 19.535 28.775000000000002 28.189999999999998 23.5 70-74 19.509999999999998 29.759999999999998 27.750000000000004 22.98 75-79 19.81 28.970000000000002 27.644999999999996 23.575 80-84 19.994999999999997 28.754999999999995 28.09 23.16 85-89 20.225 29.599999999999998 26.935 23.24 90-94 19.885 28.749999999999996 27.93 23.435 95-99 19.615 28.705000000000002 28.09 23.59 100-104 20.200000000000003 28.87 27.905 23.025000000000002 105-109 20.135 28.904999999999998 27.97 22.99 110-114 20.209251101321584 28.739487384861835 27.387865438526234 23.66339607529035 115-119 20.258426403565885 28.677317573997097 27.71573095607753 23.348525066359493 120-124 20.55775296650478 28.808892004205678 27.22174936163821 23.41160566765133 125-129 20.376395214975723 28.680114119825816 27.358726662996148 23.584764002202313 130-134 19.755 29.110000000000003 27.85 23.285 135-139 21.365000000000002 28.105000000000004 27.525 23.005 140-144 20.11 28.54 27.534999999999997 23.815 145-149 20.79 28.449999999999996 27.905 22.855 150-151 19.950000000000003 28.037499999999998 27.3875 24.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 2.0 24 2.5 25 7.5 26 7.5 27 4.5 28 10.0 29 15.5 30 20.5 31 28.0 32 37.0 33 48.5 34 70.0 35 88.0 36 107.0 37 127.0 38 149.0 39 163.5 40 189.0 41 222.0 42 247.5 43 275.5 44 296.5 45 283.5 46 266.5 47 260.5 48 225.5 49 191.0 50 157.5 51 129.0 52 101.5 53 80.0 54 61.0 55 37.5 56 21.0 57 13.5 58 11.5 59 8.0 60 7.0 61 6.0 62 4.5 63 2.5 64 2.5 65 2.0 66 0.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.12 115-119 0.165 120-124 0.135 125-129 0.105 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24433249370277 98.5 2 0.7556675062972292 1.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.3875000000000002 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.7000000000000002 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 1.9125 0.0 0.0 0.0 0.0 118-119 2.025 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.275 0.0 0.0 0.0 0.0 124-125 2.5125 0.0 0.0 0.0 0.0 126-127 2.7125 0.0 0.0 0.0 0.0 128-129 2.9749999999999996 0.0 0.0 0.0 0.0 130-131 3.1125 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.4125 0.0 0.0 0.0 0.0 136-137 3.675 0.0 0.0 0.0 0.0 138-139 4.050000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGTGT 10 0.0068519996 144.85 1 >>END_MODULE SRR7169897 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169897_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.428 34.0 33.0 34.0 33.0 34.0 2 33.48375 34.0 33.0 34.0 33.0 34.0 3 33.5055 34.0 33.0 34.0 33.0 34.0 4 33.50125 34.0 33.0 34.0 33.0 34.0 5 33.4255 34.0 33.0 34.0 33.0 34.0 6 37.62675 38.0 38.0 38.0 38.0 38.0 7 37.565 38.0 38.0 38.0 38.0 38.0 8 37.57725 38.0 38.0 38.0 38.0 38.0 9 37.563 38.0 38.0 38.0 38.0 38.0 10-14 37.1509 38.0 38.0 38.0 36.6 38.0 15-19 37.567750000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.438849999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.50574999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.54195 38.0 38.0 38.0 38.0 38.0 35-39 37.317150000000005 38.0 38.0 38.0 37.4 38.0 40-44 37.40865 38.0 38.0 38.0 37.6 38.0 45-49 37.4988 38.0 38.0 38.0 38.0 38.0 50-54 37.43805 38.0 38.0 38.0 38.0 38.0 55-59 37.4046 38.0 38.0 38.0 37.8 38.0 60-64 37.32425 38.0 38.0 38.0 37.2 38.0 65-69 36.9617 38.0 38.0 38.0 36.0 38.0 70-74 37.18685000000001 38.0 38.0 38.0 36.8 38.0 75-79 37.18185 38.0 38.0 38.0 37.0 38.0 80-84 37.05245 38.0 38.0 38.0 36.2 38.0 85-89 36.65885 38.0 37.8 38.0 34.8 38.0 90-94 36.7637 38.0 38.0 38.0 35.0 38.0 95-99 36.796200000000006 38.0 38.0 38.0 35.8 38.0 100-104 35.4853 38.0 36.4 38.0 29.0 38.0 105-109 36.07315 38.0 37.2 38.0 32.2 38.0 110-114 36.0039 38.0 37.6 38.0 32.6 38.0 115-119 34.651300000000006 38.0 35.0 38.0 25.2 38.0 120-124 35.1536 38.0 36.4 38.0 29.0 38.0 125-129 33.8223 38.0 33.8 38.0 22.4 38.0 130-134 33.006 37.8 32.0 38.0 19.0 38.0 135-139 33.405300000000004 38.0 33.0 38.0 20.6 38.0 140-144 32.8932 37.6 32.0 38.0 19.8 38.0 145-149 31.2442 36.8 30.4 38.0 10.4 38.0 150-151 25.3975 32.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 0.0 14 2.0 15 3.0 16 2.0 17 4.0 18 4.0 19 7.0 20 5.0 21 5.0 22 7.0 23 6.0 24 9.0 25 10.0 26 11.0 27 21.0 28 24.0 29 28.0 30 40.0 31 53.0 32 78.0 33 126.0 34 224.0 35 428.0 36 1072.0 37 1821.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.9 20.875 12.75 25.474999999999998 2 25.525 26.05 30.349999999999998 18.075 3 21.099999999999998 27.200000000000003 31.8 19.900000000000002 4 23.474999999999998 35.35 22.075 19.1 5 23.200000000000003 37.824999999999996 20.875 18.099999999999998 6 19.7 38.824999999999996 23.9 17.575 7 19.8 20.225 39.95 20.025000000000002 8 20.075000000000003 25.8 28.925 25.2 9 21.45 25.3 28.775000000000002 24.474999999999998 10-14 22.98 28.985 26.805 21.23 15-19 22.975 27.765 27.965 21.295 20-24 22.919999999999998 27.63 28.605000000000004 20.845 25-29 22.875 28.285 28.425 20.415 30-34 22.41 28.315 28.57 20.705000000000002 35-39 22.665 28.845 27.735 20.755000000000003 40-44 22.93 27.589999999999996 28.599999999999998 20.880000000000003 45-49 22.900000000000002 27.744999999999997 28.804999999999996 20.549999999999997 50-54 22.965 29.044999999999998 27.67 20.32 55-59 23.400000000000002 28.215 28.26 20.125 60-64 22.925 28.110000000000003 28.025 20.94 65-69 23.150000000000002 27.99 28.68 20.18 70-74 22.825 28.155 28.27 20.75 75-79 23.27 27.725 28.105000000000004 20.9 80-84 23.01 28.23 28.305000000000003 20.455000000000002 85-89 23.36 27.915 28.549999999999997 20.175 90-94 23.195 27.884999999999998 28.16 20.76 95-99 23.405 27.860000000000003 28.599999999999998 20.135 100-104 23.385 27.900000000000002 28.410000000000004 20.305 105-109 23.18 28.335 28.294999999999998 20.19 110-114 23.5 28.415000000000003 28.38 19.705000000000002 115-119 23.98 27.92 28.42 19.68 120-124 23.515 28.410000000000004 27.975 20.1 125-129 23.65973194638928 28.34066813362672 27.905581116223242 20.09401880376075 130-134 24.115000000000002 28.265 27.839999999999996 19.78 135-139 24.015 28.685 27.67 19.63 140-144 24.02 27.375 28.299999999999997 20.305 145-149 24.425 27.76 27.884999999999998 19.93 150-151 23.974999999999998 27.950000000000003 27.487499999999997 20.5875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 1.5 23 2.0 24 2.5 25 2.0 26 2.0 27 4.5 28 7.5 29 9.5 30 14.0 31 17.5 32 30.5 33 43.5 34 47.0 35 54.0 36 73.5 37 104.0 38 137.5 39 181.5 40 234.0 41 258.5 42 253.5 43 259.0 44 295.5 45 307.0 46 288.5 47 282.5 48 239.0 49 197.0 50 171.5 51 129.5 52 94.5 53 64.5 54 46.5 55 37.5 56 26.5 57 18.5 58 10.5 59 10.5 60 11.0 61 7.5 62 6.0 63 4.0 64 2.5 65 1.0 66 1.0 67 1.0 68 1.5 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.02 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1679273827534 98.32499999999999 2 0.8068582955118508 1.6 3 0.02521432173474534 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.6749999999999998 0.0 0.0 0.0 0.0 114-115 1.7625000000000002 0.0 0.0 0.0 0.0 116-117 1.8624999999999998 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.7375 0.0 0.0 0.0 0.0 128-129 3.05 0.0 0.0 0.0 0.0 130-131 3.1875 0.0 0.0 0.0 0.0 132-133 3.3 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 3.7 0.0 0.0 0.0 0.0 138-139 3.9625000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696745 spots for SRR7169897.sra Written 696745 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra Read 696744 spots for SRR7169897.sra Written 696744 spots for SRR7169897.sra SRR ids: ['SRR7169897.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w689kyfo SRR7169897.sra spots: 13934881 blocks: [[1, 696744], [696745, 1393488], [1393489, 2090232], [2090233, 2786976], [2786977, 3483720], [3483721, 4180464], [4180465, 4877208], [4877209, 5573952], [5573953, 6270696], [6270697, 6967440], [6967441, 7664184], [7664185, 8360928], [8360929, 9057672], [9057673, 9754416], [9754417, 10451160], [10451161, 11147904], [11147905, 11844648], [11844649, 12541392], [12541393, 13238136], [13238137, 13934881]] SRR7169897 file size 4700373 SRR7169897 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169897 SRR7169897_1.fastq SRR7169897_2.fastq Input file: SRR7169897_1.fastq Paired file: SRR7169897_2.fastq trimmed: SRR7169897-trimmed-pair1.fastq, SRR7169897-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:06:57 2025 >> started Wed Feb 12 02:07:13 2025 >> done (15.723s) 13934881 read pairs processed; of these: 10051 ( 0.07%) short read pairs filtered out after trimming by size control 14868 ( 0.11%) empty read pairs filtered out after trimming by size control 13909962 (99.82%) read pairs available; of these: 6960358 (50.04%) trimmed read pairs available after processing 6949604 (49.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 4 0.00% 23 0 0.00% 24 6 0.00% 25 3 0.00% 26 7 0.00% 27 1 0.00% 28 2 0.00% 29 3 0.00% 30 5 0.00% 31 4 0.00% 32 8 0.00% 33 3 0.00% 34 8 0.00% 35 3 0.00% 36 8 0.00% 37 10 0.00% 38 15 0.00% 39 11 0.00% 40 14 0.00% 41 28 0.00% 42 23 0.00% 43 34 0.00% 44 26 0.00% 45 25 0.00% 46 37 0.00% 47 45 0.00% 48 45 0.00% 49 49 0.00% 50 59 0.00% 51 84 0.00% 52 81 0.00% 53 104 0.00% 54 114 0.00% 55 102 0.00% 56 114 0.00% 57 130 0.00% 58 170 0.00% 59 218 0.00% 60 222 0.00% 61 267 0.00% 62 299 0.00% 63 324 0.00% 64 379 0.00% 65 441 0.00% 66 438 0.00% 67 500 0.00% 68 616 0.00% 69 629 0.00% 70 774 0.01% 71 885 0.01% 72 1132 0.01% 73 1203 0.01% 74 1319 0.01% 75 1446 0.01% 76 1701 0.01% 77 1786 0.01% 78 1980 0.01% 79 2098 0.02% 80 2366 0.02% 81 2721 0.02% 82 2941 0.02% 83 3487 0.03% 84 4192 0.03% 85 4825 0.03% 86 5037 0.04% 87 5220 0.04% 88 5353 0.04% 89 5744 0.04% 90 6110 0.04% 91 6588 0.05% 92 7044 0.05% 93 7475 0.05% 94 7936 0.06% 95 8301 0.06% 96 8589 0.06% 97 9180 0.07% 98 9123 0.07% 99 9248 0.07% 100 10071 0.07% 101 10418 0.07% 102 11242 0.08% 103 11648 0.08% 104 12141 0.09% 105 12829 0.09% 106 13300 0.10% 107 13454 0.10% 108 13756 0.10% 109 14069 0.10% 110 14671 0.11% 111 15328 0.11% 112 15818 0.11% 113 16483 0.12% 114 17286 0.12% 115 17913 0.13% 116 18020 0.13% 117 18698 0.13% 118 18802 0.14% 119 19255 0.14% 120 20042 0.14% 121 20638 0.15% 122 21760 0.16% 123 22502 0.16% 124 23566 0.17% 125 24657 0.18% 126 25596 0.18% 127 26735 0.19% 128 27524 0.20% 129 28374 0.20% 130 30178 0.22% 131 31282 0.22% 132 33124 0.24% 133 35171 0.25% 134 37933 0.27% 135 41059 0.30% 136 44282 0.32% 137 47776 0.34% 138 51832 0.37% 139 57023 0.41% 140 62096 0.45% 141 69619 0.50% 142 79515 0.57% 143 91370 0.66% 144 110701 0.80% 145 137117 0.99% 146 177984 1.28% 147 251170 1.81% 148 397604 2.86% 149 809844 5.82% 150 3685554 26.50% 151 6949604 49.96% 13909962 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=32 prefix-density=0.20 prefix-fanout=2.8 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.11 sequence-density-rank=20 fanout-score=249.29 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=28.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=41 prefix-density=0.38 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=272.68 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=28.3 sequence=AAGAAGAAGAAA SRR7169897 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:07:57 Started mapping on | Feb 12 02:07:57 Finished on | Feb 12 02:09:11 Mapping speed, Million of reads per hour | 676.70 Number of input reads | 13909962 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13302545 Uniquely mapped reads % | 95.63% Average mapped length | 294.67 Number of splices: Total | 12925796 Number of splices: Annotated (sjdb) | 12720418 Number of splices: GT/AG | 12736551 Number of splices: GC/AG | 151436 Number of splices: AT/AC | 10034 Number of splices: Non-canonical | 27775 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 224403 % of reads mapped to multiple loci | 1.61% Number of reads mapped to too many loci | 19121 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.59% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 394151 394151 394151 N_multimapping 224403 224403 224403 N_noFeature 338913 13173147 392555 N_ambiguous 131237 610 55045 UnstrandedReadsAssigned:12832395 PositiveStrandReadsAssigned:128788 NegativeStrandReadsAssigned:12854945 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169897 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169897-trimmed-pair1.fastq SRR7169897-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,909,962 reads, 12,736,468 reads pseudoaligned [quant] estimated average fragment length: 268.022 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,016 rounds 52401 SRR7169897.ke.tsv 34699 SRR7169897.se.tsv 87100 total ==> SRR7169897.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.98 197 9.05871 Potri.005G024800.1.v4.1 1035 767.978 47 4.92754 Potri.004G059700.1.v4.1 961 694.02 0 0 Potri.007G009000.2.v4.1 1416 1148.98 0 0 Potri.003G141000.2.v4.1 2943 2675.98 276.033 8.30537 Potri.016G087400.1.v4.1 270 76.0953 1259 1332.14 Potri.015G069301.1.v4.1 564 303.524 0 0 Potri.010G195200.1.v4.1 1773 1505.98 16 0.855426 Potri.012G127500.1.v4.1 977 710.008 4892 554.759 ==> SRR7169897.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 970 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 202 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169897 completed mapping pipeline successfully