Starting /dee2/code/volunteer_pipeline.sh SRR7169898 current disk space = 3050952265728 free memory = 992378096 SRR7169898 SRAfilesize 546f3f329a6856bcf362122cb312a0dc SRR7169898.sra SRR7169898.sra file validated SRR7169898 is paired end SRR7169898 is conventional basespace SRR7169898 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169898_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.15475 28.0 18.0 31.0 18.0 32.0 2 31.58675 33.0 31.0 33.0 29.0 33.0 3 32.55325 33.0 33.0 33.0 31.0 33.0 4 32.88525 33.0 33.0 34.0 33.0 34.0 5 33.32325 34.0 33.0 34.0 33.0 34.0 6 37.16325 38.0 37.0 38.0 36.0 38.0 7 37.42825 38.0 38.0 38.0 37.0 38.0 8 37.59075 38.0 38.0 38.0 37.0 38.0 9 36.76 38.0 38.0 38.0 35.0 38.0 10-14 37.5889 38.0 38.0 38.0 37.6 38.0 15-19 37.430099999999996 38.0 38.0 38.0 37.6 38.0 20-24 37.39345 38.0 38.0 38.0 36.8 38.0 25-29 37.61535 38.0 38.0 38.0 38.0 38.0 30-34 37.5721 38.0 38.0 38.0 38.0 38.0 35-39 37.57065 38.0 38.0 38.0 38.0 38.0 40-44 37.39785 38.0 38.0 38.0 37.2 38.0 45-49 37.53565 38.0 38.0 38.0 37.6 38.0 50-54 37.4227 38.0 38.0 38.0 37.0 38.0 55-59 37.34895 38.0 38.0 38.0 37.0 38.0 60-64 37.2436 38.0 38.0 38.0 36.2 38.0 65-69 37.179249999999996 38.0 38.0 38.0 36.0 38.0 70-74 37.082 38.0 38.0 38.0 36.0 38.0 75-79 36.97085 38.0 38.0 38.0 36.0 38.0 80-84 36.6476 38.0 37.6 38.0 34.6 38.0 85-89 36.24365 38.0 37.0 38.0 33.4 38.0 90-94 36.574 38.0 38.0 38.0 34.0 38.0 95-99 36.458800000000004 38.0 37.8 38.0 34.0 38.0 100-104 36.23864999999999 38.0 37.0 38.0 33.6 38.0 105-109 35.2165 38.0 35.6 38.0 28.2 38.0 110-114 35.25345 38.0 35.4 38.0 28.6 38.0 115-119 35.45485 38.0 35.8 38.0 30.0 38.0 120-124 35.3177 38.0 35.8 38.0 29.0 38.0 125-129 33.5182 37.2 31.8 38.0 22.6 38.0 130-134 33.78189999999999 37.6 33.2 38.0 23.6 38.0 135-139 34.1212 38.0 33.6 38.0 24.8 38.0 140-144 32.9841 38.0 32.0 38.0 19.8 38.0 145-149 31.811 36.4 31.4 38.0 14.4 38.0 150-151 27.273125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 0.0 16 2.0 17 4.0 18 5.0 19 2.0 20 1.0 21 3.0 22 2.0 23 9.0 24 8.0 25 10.0 26 13.0 27 17.0 28 20.0 29 28.0 30 48.0 31 60.0 32 79.0 33 127.0 34 249.0 35 568.0 36 1291.0 37 1452.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.55 10.45 10.2 36.8 2 22.54190642982237 13.510132599449587 35.226419814861146 28.7215411558669 3 19.725 18.55 26.8 34.925 4 22.725 26.825 23.1 27.35 5 23.25 32.574999999999996 23.3 20.875 6 18.975 35.9 25.474999999999998 19.650000000000002 7 13.05 26.6 42.55 17.8 8 18.65 26.075 31.825 23.45 9 17.25 23.7 35.025 24.025 10-14 19.34 30.214999999999996 27.650000000000002 22.795 15-19 19.365 28.95 28.310000000000002 23.375 20-24 19.564999999999998 29.445 27.24 23.75 25-29 20.150000000000002 29.13 27.815 22.905 30-34 19.535 28.825 28.189999999999998 23.45 35-39 19.63 28.999999999999996 27.375 23.995 40-44 20.09 29.095 28.17 22.645 45-49 20.54 29.14 27.35 22.97 50-54 19.259999999999998 29.525000000000002 28.03 23.185 55-59 19.855 28.939999999999998 27.655 23.549999999999997 60-64 20.105 29.035 27.505000000000003 23.355 65-69 19.715 29.220000000000002 27.51 23.555 70-74 20.064999999999998 28.975 27.389999999999997 23.57 75-79 19.925 28.645 27.825 23.605 80-84 20.055 28.749999999999996 27.565 23.630000000000003 85-89 20.445 28.645 27.384999999999998 23.525 90-94 20.165 29.085 27.66 23.09 95-99 20.095 28.88 27.644999999999996 23.380000000000003 100-104 20.09 28.849999999999998 27.67 23.39 105-109 19.835 28.655 27.655 23.855 110-114 19.55 28.555000000000003 28.395 23.5 115-119 20.43 28.544999999999998 27.785 23.24 120-124 20.47 28.415000000000003 27.43 23.685000000000002 125-129 20.78 28.689999999999998 27.779999999999998 22.75 130-134 20.495 28.88 27.66 22.965 135-139 20.355 28.634999999999998 27.235 23.775 140-144 20.419999999999998 28.09 27.82 23.669999999999998 145-149 20.775 28.744999999999997 27.185 23.294999999999998 150-151 18.8875 28.549999999999997 28.262500000000003 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 2.0 25 4.5 26 7.5 27 13.0 28 17.5 29 21.5 30 21.0 31 25.0 32 36.0 33 48.0 34 54.0 35 62.5 36 89.0 37 116.5 38 129.5 39 155.5 40 207.5 41 233.0 42 239.0 43 266.5 44 274.5 45 269.5 46 266.0 47 254.5 48 240.0 49 211.0 50 170.0 51 137.5 52 116.0 53 90.5 54 66.0 55 51.0 56 34.5 57 18.0 58 14.0 59 9.5 60 5.0 61 4.5 62 3.0 63 1.0 64 2.0 65 2.0 66 1.0 67 1.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.9125 0.0 0.0 0.0 0.0 120-121 1.0499999999999998 0.0 0.0 0.0 0.0 122-123 1.1 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.2000000000000002 0.0 0.0 0.0 0.0 128-129 1.4 0.0 0.0 0.0 0.0 130-131 1.4874999999999998 0.0 0.0 0.0 0.0 132-133 1.7125 0.0 0.0 0.0 0.0 134-135 1.8875000000000002 0.0 0.0 0.0 0.0 136-137 2.0375 0.0 0.0 0.0 0.0 138-139 2.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGATC 10 0.006830828 145.0 145 TCTCAAT 10 0.006830828 145.0 6 AAAAAAA 20 0.00593511 29.0 45-49 >>END_MODULE SRR7169898 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169898_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3395 34.0 33.0 34.0 33.0 34.0 2 33.3855 34.0 33.0 34.0 33.0 34.0 3 33.38125 34.0 33.0 34.0 33.0 34.0 4 33.3745 34.0 33.0 34.0 33.0 34.0 5 33.392 34.0 33.0 34.0 33.0 34.0 6 37.53675 38.0 38.0 38.0 38.0 38.0 7 37.50725 38.0 38.0 38.0 38.0 38.0 8 37.47975 38.0 38.0 38.0 38.0 38.0 9 37.49325 38.0 38.0 38.0 38.0 38.0 10-14 37.458349999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.4976 38.0 38.0 38.0 38.0 38.0 20-24 37.48945 38.0 38.0 38.0 38.0 38.0 25-29 37.174400000000006 38.0 38.0 38.0 36.8 38.0 30-34 37.45595 38.0 38.0 38.0 38.0 38.0 35-39 37.2045 38.0 38.0 38.0 37.0 38.0 40-44 37.4482 38.0 38.0 38.0 38.0 38.0 45-49 37.06365 38.0 38.0 38.0 36.0 38.0 50-54 37.29425 38.0 38.0 38.0 37.4 38.0 55-59 37.3291 38.0 38.0 38.0 37.4 38.0 60-64 37.25315 38.0 38.0 38.0 37.0 38.0 65-69 37.2372 38.0 38.0 38.0 37.0 38.0 70-74 37.2548 38.0 38.0 38.0 37.0 38.0 75-79 37.25775 38.0 38.0 38.0 37.0 38.0 80-84 37.10235 38.0 38.0 38.0 36.6 38.0 85-89 36.973800000000004 38.0 38.0 38.0 36.0 38.0 90-94 37.0039 38.0 38.0 38.0 36.0 38.0 95-99 36.94045 38.0 38.0 38.0 36.0 38.0 100-104 36.73715 38.0 38.0 38.0 35.4 38.0 105-109 36.720549999999996 38.0 38.0 38.0 35.4 38.0 110-114 36.646699999999996 38.0 38.0 38.0 35.0 38.0 115-119 36.523649999999996 38.0 38.0 38.0 34.6 38.0 120-124 36.277049999999996 38.0 38.0 38.0 34.0 38.0 125-129 35.60485 38.0 36.8 38.0 30.8 38.0 130-134 35.8833 38.0 37.6 38.0 32.8 38.0 135-139 34.7115 38.0 35.2 38.0 26.2 38.0 140-144 34.3308 38.0 34.6 38.0 25.4 38.0 145-149 33.729099999999995 38.0 33.4 38.0 23.0 38.0 150-151 30.222749999999998 35.5 27.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 0.0 5 2.0 6 1.0 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 1.0 14 1.0 15 5.0 16 2.0 17 1.0 18 4.0 19 7.0 20 6.0 21 7.0 22 2.0 23 7.0 24 9.0 25 7.0 26 3.0 27 14.0 28 19.0 29 14.0 30 16.0 31 37.0 32 45.0 33 72.0 34 113.0 35 243.0 36 627.0 37 2726.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.05 21.05 14.2 26.700000000000003 2 26.338169084542272 26.488244122061033 29.914957478739368 17.258629314657327 3 19.325 29.325000000000003 32.025 19.325 4 22.98649324662331 34.092046023011505 24.362181090545274 18.55927963981991 5 24.349999999999998 35.125 22.7 17.825 6 20.25 39.275 23.825 16.650000000000002 7 19.775000000000002 22.175 38.550000000000004 19.5 8 22.725 25.05 27.85 24.375 9 21.25 25.7 29.575000000000003 23.474999999999998 10-14 22.425 29.115000000000002 26.865 21.595 15-19 23.34 28.215 27.860000000000003 20.585 20-24 22.915 28.095 28.194999999999997 20.794999999999998 25-29 22.57 28.634999999999998 28.205000000000002 20.59 30-34 23.005 28.475 27.955000000000002 20.565 35-39 22.405 28.244999999999997 27.750000000000004 21.6 40-44 23.064999999999998 28.884999999999998 27.705000000000002 20.345 45-49 23.005 28.455000000000002 27.785 20.755000000000003 50-54 22.86 28.24 27.634999999999998 21.265 55-59 23.525 27.47 28.585 20.419999999999998 60-64 23.275000000000002 28.08 27.634999999999998 21.01 65-69 22.97 28.65 28.01 20.369999999999997 70-74 23.380000000000003 27.345000000000002 28.139999999999997 21.135 75-79 23.375 27.894999999999996 28.48 20.25 80-84 23.669999999999998 28.215 27.715 20.4 85-89 23.150000000000002 28.134999999999998 28.025 20.69 90-94 22.715 28.13 28.565 20.59 95-99 23.974999999999998 27.975 27.875 20.175 100-104 23.505000000000003 27.985 28.53 19.98 105-109 23.535 28.494999999999997 27.715 20.255000000000003 110-114 23.91 28.645 27.57 19.875 115-119 23.53 27.900000000000002 27.71 20.86 120-124 23.674999999999997 27.865000000000002 27.994999999999997 20.465 125-129 23.24 28.225 28.265 20.27 130-134 23.78 27.529999999999998 27.815 20.875 135-139 22.99 28.305000000000003 27.785 20.919999999999998 140-144 23.84 28.494999999999997 27.150000000000002 20.515 145-149 23.585 28.435 27.67 20.31 150-151 24.5375 26.937499999999996 29.2375 19.287499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 2.5 26 3.0 27 6.0 28 7.0 29 5.0 30 15.0 31 19.0 32 23.5 33 35.5 34 45.5 35 65.5 36 89.5 37 117.0 38 133.5 39 169.0 40 214.0 41 238.0 42 270.5 43 291.5 44 294.0 45 273.5 46 267.5 47 276.5 48 248.0 49 199.0 50 161.5 51 133.5 52 105.5 53 80.5 54 61.0 55 44.0 56 30.5 57 21.0 58 12.5 59 11.0 60 7.0 61 6.0 62 4.0 63 1.0 64 2.0 65 2.0 66 2.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.1 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.25 0.0 0.0 0.0 0.0 126-127 1.2999999999999998 0.0 0.0 0.0 0.0 128-129 1.5 0.0 0.0 0.0 0.0 130-131 1.6124999999999998 0.0 0.0 0.0 0.0 132-133 1.8375 0.0 0.0 0.0 0.0 134-135 2.0125 0.0 0.0 0.0 0.0 136-137 2.2 0.0 0.0 0.0 0.0 138-139 2.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTATTT 10 0.006830828 145.0 145 >>END_MODULE Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657206 spots for SRR7169898.sra Written 657206 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra Read 657204 spots for SRR7169898.sra Written 657204 spots for SRR7169898.sra SRR ids: ['SRR7169898.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uu0_ww5e SRR7169898.sra spots: 13144082 blocks: [[1, 657204], [657205, 1314408], [1314409, 1971612], [1971613, 2628816], [2628817, 3286020], [3286021, 3943224], [3943225, 4600428], [4600429, 5257632], [5257633, 5914836], [5914837, 6572040], [6572041, 7229244], [7229245, 7886448], [7886449, 8543652], [8543653, 9200856], [9200857, 9858060], [9858061, 10515264], [10515265, 11172468], [11172469, 11829672], [11829673, 12486876], [12486877, 13144082]] SRR7169898 file size 4432397 SRR7169898 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169898 SRR7169898_1.fastq SRR7169898_2.fastq Input file: SRR7169898_1.fastq Paired file: SRR7169898_2.fastq trimmed: SRR7169898-trimmed-pair1.fastq, SRR7169898-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:30:04 2025 >> started Wed Feb 12 01:30:18 2025 >> done (13.824s) 13144082 read pairs processed; of these: 8250 ( 0.06%) short read pairs filtered out after trimming by size control 8010 ( 0.06%) empty read pairs filtered out after trimming by size control 13127822 (99.88%) read pairs available; of these: 6181008 (47.08%) trimmed read pairs available after processing 6946814 (52.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 3 0.00% 22 3 0.00% 23 1 0.00% 24 0 0.00% 25 5 0.00% 26 5 0.00% 27 3 0.00% 28 3 0.00% 29 3 0.00% 30 3 0.00% 31 4 0.00% 32 4 0.00% 33 4 0.00% 34 4 0.00% 35 5 0.00% 36 5 0.00% 37 3 0.00% 38 1 0.00% 39 4 0.00% 40 10 0.00% 41 10 0.00% 42 8 0.00% 43 13 0.00% 44 9 0.00% 45 13 0.00% 46 6 0.00% 47 21 0.00% 48 17 0.00% 49 22 0.00% 50 21 0.00% 51 32 0.00% 52 27 0.00% 53 30 0.00% 54 42 0.00% 55 33 0.00% 56 47 0.00% 57 47 0.00% 58 61 0.00% 59 81 0.00% 60 95 0.00% 61 92 0.00% 62 116 0.00% 63 129 0.00% 64 138 0.00% 65 143 0.00% 66 170 0.00% 67 168 0.00% 68 185 0.00% 69 226 0.00% 70 301 0.00% 71 323 0.00% 72 332 0.00% 73 430 0.00% 74 410 0.00% 75 536 0.00% 76 606 0.00% 77 671 0.01% 78 723 0.01% 79 767 0.01% 80 834 0.01% 81 1041 0.01% 82 1108 0.01% 83 1344 0.01% 84 1736 0.01% 85 2020 0.02% 86 2200 0.02% 87 2512 0.02% 88 2650 0.02% 89 2612 0.02% 90 2948 0.02% 91 2932 0.02% 92 3282 0.03% 93 3440 0.03% 94 3780 0.03% 95 4029 0.03% 96 4222 0.03% 97 4436 0.03% 98 4518 0.03% 99 4855 0.04% 100 5129 0.04% 101 5408 0.04% 102 5952 0.05% 103 6055 0.05% 104 6382 0.05% 105 6827 0.05% 106 7242 0.06% 107 7260 0.06% 108 7680 0.06% 109 7827 0.06% 110 8511 0.06% 111 8776 0.07% 112 9349 0.07% 113 9544 0.07% 114 10355 0.08% 115 10747 0.08% 116 11155 0.08% 117 11698 0.09% 118 12156 0.09% 119 12413 0.09% 120 12863 0.10% 121 13403 0.10% 122 14016 0.11% 123 14935 0.11% 124 15799 0.12% 125 16529 0.13% 126 17402 0.13% 127 18406 0.14% 128 18996 0.14% 129 20357 0.16% 130 21395 0.16% 131 22692 0.17% 132 24343 0.19% 133 25970 0.20% 134 28104 0.21% 135 30382 0.23% 136 33030 0.25% 137 36076 0.27% 138 39355 0.30% 139 43597 0.33% 140 49093 0.37% 141 56199 0.43% 142 65073 0.50% 143 77152 0.59% 144 95249 0.73% 145 122068 0.93% 146 162769 1.24% 147 235970 1.80% 148 381583 2.91% 149 771734 5.88% 150 3462323 26.37% 151 6946814 52.92% 13127822 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=36 prefix-density=0.21 prefix-fanout=2.5 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=243.15 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=27.9 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=34 prefix-density=0.37 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=196.30 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=23.4 sequence=GAAGAAGAAGAAA SRR7169898 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:31:01 Started mapping on | Feb 12 01:31:02 Finished on | Feb 12 01:32:07 Mapping speed, Million of reads per hour | 727.08 Number of input reads | 13127822 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12612418 Uniquely mapped reads % | 96.07% Average mapped length | 296.66 Number of splices: Total | 12212708 Number of splices: Annotated (sjdb) | 12016736 Number of splices: GT/AG | 12033520 Number of splices: GC/AG | 144457 Number of splices: AT/AC | 10187 Number of splices: Non-canonical | 24544 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 213889 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 12529 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.18% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 310709 310709 310709 N_multimapping 213889 213889 213889 N_noFeature 294066 12491342 341492 N_ambiguous 128292 894 53978 UnstrandedReadsAssigned:12190060 PositiveStrandReadsAssigned:120182 NegativeStrandReadsAssigned:12216948 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169898 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169898-trimmed-pair1.fastq SRR7169898-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,127,822 reads, 12,102,297 reads pseudoaligned [quant] estimated average fragment length: 278.661 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 988 rounds 52401 SRR7169898.ke.tsv 34699 SRR7169898.se.tsv 87100 total ==> SRR7169898.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.34 278 13.6943 Potri.005G024800.1.v4.1 1035 757.339 36 4.07514 Potri.004G059700.1.v4.1 961 683.368 0 0 Potri.007G009000.2.v4.1 1416 1138.34 0 0 Potri.003G141000.2.v4.1 2943 2665.34 259.036 8.33179 Potri.016G087400.1.v4.1 270 66.9165 1117.83 1432.1 Potri.015G069301.1.v4.1 564 293.006 0 0 Potri.010G195200.1.v4.1 1773 1495.34 32 1.8346 Potri.012G127500.1.v4.1 977 699.351 4755 582.889 ==> SRR7169898.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1392 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 218 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169898 completed mapping pipeline successfully