Starting /dee2/code/volunteer_pipeline.sh SRR7169899 current disk space = 3050849689600 free memory = 1489304832 SRR7169899 SRAfilesize b3cab9a9bf603c7655a480fd8baef843 SRR7169899.sra SRR7169899.sra file validated SRR7169899 is paired end SRR7169899 is conventional basespace SRR7169899 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169899_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.00425 18.0 18.0 18.0 18.0 32.0 2 26.011 27.0 25.0 27.0 18.0 30.0 3 27.412 29.0 25.0 31.0 18.0 33.0 4 30.80575 31.0 30.0 33.0 28.0 33.0 5 31.88325 33.0 32.0 33.0 31.0 33.0 6 35.99 37.0 36.0 38.0 33.0 38.0 7 35.971 38.0 37.0 38.0 31.0 38.0 8 36.80225 38.0 37.0 38.0 34.0 38.0 9 37.18325 38.0 38.0 38.0 36.0 38.0 10-14 37.42195 38.0 38.0 38.0 36.8 38.0 15-19 37.47315 38.0 38.0 38.0 37.0 38.0 20-24 37.560500000000005 38.0 38.0 38.0 37.6 38.0 25-29 37.63235 38.0 38.0 38.0 38.0 38.0 30-34 37.58795 38.0 38.0 38.0 38.0 38.0 35-39 37.57475 38.0 38.0 38.0 37.8 38.0 40-44 37.4784 38.0 38.0 38.0 37.0 38.0 45-49 37.54665 38.0 38.0 38.0 37.2 38.0 50-54 37.408350000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.357 38.0 38.0 38.0 37.0 38.0 60-64 37.2486 38.0 38.0 38.0 36.0 38.0 65-69 37.171949999999995 38.0 38.0 38.0 36.0 38.0 70-74 37.12480000000001 38.0 38.0 38.0 36.0 38.0 75-79 37.01065 38.0 38.0 38.0 35.8 38.0 80-84 36.90475 38.0 38.0 38.0 35.2 38.0 85-89 36.584799999999994 38.0 37.8 38.0 34.2 38.0 90-94 36.361450000000005 38.0 37.4 38.0 33.0 38.0 95-99 36.32065 38.0 37.0 38.0 33.4 38.0 100-104 35.36155 38.0 36.0 38.0 29.0 38.0 105-109 36.03875 38.0 36.8 38.0 32.6 38.0 110-114 36.0468 38.0 37.0 38.0 32.6 38.0 115-119 35.62155 38.0 36.2 38.0 30.6 38.0 120-124 34.80555 38.0 35.0 38.0 26.0 38.0 125-129 35.3178 38.0 35.8 38.0 30.0 38.0 130-134 34.00545 37.8 33.8 38.0 23.2 38.0 135-139 34.6246 38.0 34.8 38.0 27.0 38.0 140-144 33.7715 37.8 34.0 38.0 22.0 38.0 145-149 32.31075 36.4 31.2 38.0 18.2 38.0 150-151 28.893 35.5 24.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 0.0 17 2.0 18 4.0 19 0.0 20 1.0 21 1.0 22 2.0 23 2.0 24 5.0 25 8.0 26 19.0 27 11.0 28 15.0 29 25.0 30 42.0 31 55.0 32 83.0 33 151.0 34 238.0 35 599.0 36 1443.0 37 1290.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.625 37.574999999999996 9.85 31.95 2 23.075000000000003 15.55 32.725 28.65 3 20.674999999999997 22.1 26.05 31.175000000000004 4 21.8 30.3 22.425 25.474999999999998 5 23.075000000000003 33.575 23.125 20.225 6 20.05 35.925000000000004 24.075 19.950000000000003 7 14.549999999999999 26.474999999999998 41.8 17.175 8 19.0 26.424999999999997 29.575000000000003 25.0 9 17.5 25.05 33.025 24.425 10-14 19.495 30.39 26.97 23.145 15-19 19.689999999999998 29.609999999999996 27.68 23.02 20-24 19.84 28.9 27.595 23.665 25-29 20.11 29.13 27.16 23.599999999999998 30-34 20.465 29.549999999999997 26.965 23.02 35-39 19.994999999999997 28.83 27.625 23.549999999999997 40-44 19.575 29.86 26.91 23.655 45-49 20.630000000000003 29.115000000000002 26.705000000000002 23.549999999999997 50-54 20.31 28.849999999999998 26.945000000000004 23.895 55-59 20.335 29.28 27.189999999999998 23.195 60-64 20.26 29.43 26.69 23.62 65-69 20.235 28.93 27.63 23.205000000000002 70-74 20.09 28.849999999999998 26.985 24.075 75-79 20.580000000000002 28.835 26.784999999999997 23.799999999999997 80-84 20.369999999999997 28.475 27.794999999999998 23.36 85-89 20.89 28.59 26.87 23.65 90-94 20.75 28.585 27.029999999999998 23.635 95-99 20.724999999999998 28.065 27.279999999999998 23.93 100-104 20.794999999999998 28.720000000000002 26.87 23.615 105-109 20.435 28.57 27.325 23.669999999999998 110-114 20.845 28.754999999999995 26.965 23.435 115-119 20.145 28.98 27.250000000000004 23.625 120-124 20.919999999999998 28.095 27.165 23.82 125-129 20.45 28.134999999999998 27.655 23.76 130-134 20.585 28.285 27.175 23.955000000000002 135-139 20.695 27.915 27.425 23.965 140-144 20.94 28.144999999999996 27.029999999999998 23.885 145-149 21.240000000000002 28.125 27.13 23.505000000000003 150-151 20.549999999999997 28.975 27.025 23.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.5 22 2.5 23 1.0 24 1.0 25 3.0 26 6.0 27 9.5 28 10.0 29 14.0 30 22.0 31 27.5 32 32.0 33 43.5 34 50.5 35 69.0 36 86.5 37 107.0 38 142.5 39 166.0 40 195.0 41 225.5 42 243.5 43 259.5 44 271.0 45 275.0 46 269.0 47 244.0 48 232.5 49 201.0 50 164.5 51 146.5 52 125.0 53 101.0 54 70.0 55 45.5 56 34.5 57 29.0 58 19.5 59 13.5 60 8.0 61 6.0 62 4.0 63 4.0 64 4.5 65 2.0 66 1.5 67 2.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.5249999999999999 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.1749999999999998 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.2999999999999998 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.4 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.3375 0.0 0.0 0.0 0.0 124-125 2.5125 0.0 0.0 0.0 0.0 126-127 2.8499999999999996 0.0 0.0 0.0 0.0 128-129 3.1625 0.0 0.0 0.0 0.0 130-131 3.3625 0.0 0.0 0.0 0.0 132-133 3.55 0.0 0.0 0.0 0.0 134-135 3.7625 0.0 0.0 0.0 0.0 136-137 3.9 0.0 0.0 0.0 0.0 138-139 4.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATAGG 10 0.006830828 145.0 6 AGTTCTA 10 0.006830828 145.0 9 >>END_MODULE SRR7169899 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169899_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.22625 34.0 33.0 34.0 33.0 34.0 2 33.33275 34.0 33.0 34.0 33.0 34.0 3 33.40825 34.0 33.0 34.0 33.0 34.0 4 33.38475 34.0 33.0 34.0 33.0 34.0 5 33.33625 34.0 33.0 34.0 33.0 34.0 6 37.47175 38.0 38.0 38.0 38.0 38.0 7 37.4915 38.0 38.0 38.0 38.0 38.0 8 37.4985 38.0 38.0 38.0 38.0 38.0 9 37.50625 38.0 38.0 38.0 38.0 38.0 10-14 37.4662 38.0 38.0 38.0 38.0 38.0 15-19 37.48125 38.0 38.0 38.0 38.0 38.0 20-24 37.28645 38.0 38.0 38.0 37.2 38.0 25-29 36.776050000000005 38.0 37.8 38.0 35.0 38.0 30-34 36.49705 38.0 37.8 38.0 34.0 38.0 35-39 37.1628 38.0 38.0 38.0 36.6 38.0 40-44 37.033849999999994 38.0 38.0 38.0 36.2 38.0 45-49 37.063900000000004 38.0 38.0 38.0 36.4 38.0 50-54 37.307249999999996 38.0 38.0 38.0 36.8 38.0 55-59 37.3643 38.0 38.0 38.0 37.0 38.0 60-64 37.233250000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.22735 38.0 38.0 38.0 37.0 38.0 70-74 37.2174 38.0 38.0 38.0 37.0 38.0 75-79 37.24294999999999 38.0 38.0 38.0 37.0 38.0 80-84 37.087599999999995 38.0 38.0 38.0 36.2 38.0 85-89 36.993900000000004 38.0 38.0 38.0 36.0 38.0 90-94 37.0586 38.0 38.0 38.0 36.0 38.0 95-99 36.971450000000004 38.0 38.0 38.0 36.0 38.0 100-104 36.76415 38.0 38.0 38.0 35.4 38.0 105-109 36.805899999999994 38.0 38.0 38.0 35.0 38.0 110-114 36.7708 38.0 38.0 38.0 35.2 38.0 115-119 36.503 38.0 38.0 38.0 34.2 38.0 120-124 36.3526 38.0 38.0 38.0 34.0 38.0 125-129 36.29275 38.0 38.0 38.0 34.0 38.0 130-134 36.0314 38.0 37.0 38.0 33.2 38.0 135-139 35.6364 38.0 36.0 38.0 31.8 38.0 140-144 35.48745 38.0 36.0 38.0 32.2 38.0 145-149 34.754400000000004 38.0 35.6 38.0 29.2 38.0 150-151 30.6925 35.5 29.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 1.0 5 0.0 6 1.0 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 0.0 17 3.0 18 1.0 19 1.0 20 1.0 21 5.0 22 3.0 23 8.0 24 6.0 25 10.0 26 8.0 27 17.0 28 12.0 29 9.0 30 18.0 31 36.0 32 66.0 33 84.0 34 97.0 35 242.0 36 594.0 37 2765.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.6 20.9 13.675 26.825 2 26.900000000000002 24.8 31.724999999999998 16.575 3 20.674999999999997 28.525 30.55 20.25 4 24.55 33.275 24.0 18.175 5 24.175 35.699999999999996 22.375 17.75 6 22.025 35.825 24.0 18.15 7 20.474999999999998 21.875 37.45 20.200000000000003 8 22.525000000000002 25.974999999999998 26.0 25.5 9 22.075 24.425 30.475 23.025000000000002 10-14 23.14 28.005000000000003 27.57 21.285 15-19 23.01 27.99 28.025 20.974999999999998 20-24 22.945 28.165000000000003 27.765 21.125 25-29 22.805 28.51 27.625 21.060000000000002 30-34 22.575 28.075 28.37 20.979999999999997 35-39 22.689999999999998 27.87 28.275 21.165 40-44 22.905 27.72 28.084999999999997 21.29 45-49 23.175 27.725 28.18 20.919999999999998 50-54 22.24 28.494999999999997 27.935 21.33 55-59 23.48 28.084999999999997 27.560000000000002 20.875 60-64 23.31 27.750000000000004 28.050000000000004 20.89 65-69 23.115 27.98 27.700000000000003 21.205 70-74 23.265 27.365000000000002 28.26 21.11 75-79 23.345 27.485 28.634999999999998 20.535 80-84 23.11 27.224999999999998 28.115000000000002 21.55 85-89 23.785 27.705000000000002 27.705000000000002 20.805 90-94 23.845 27.644999999999996 27.915 20.595 95-99 23.25 27.295 28.225 21.23 100-104 23.825 27.3 27.815 21.060000000000002 105-109 23.919999999999998 27.560000000000002 27.77 20.75 110-114 23.53 27.889999999999997 27.85 20.73 115-119 24.58 27.560000000000002 27.27 20.59 120-124 23.685000000000002 28.110000000000003 27.845 20.36 125-129 24.11 28.095 27.534999999999997 20.26 130-134 24.195 27.779999999999998 27.205000000000002 20.82 135-139 24.16 27.615000000000002 27.595 20.630000000000003 140-144 24.169999999999998 27.534999999999997 27.589999999999996 20.705000000000002 145-149 24.16 27.884999999999998 27.51 20.445 150-151 25.025 27.474999999999998 27.1375 20.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 1.0 25 1.5 26 3.5 27 4.5 28 4.0 29 5.0 30 9.5 31 14.5 32 19.5 33 29.0 34 42.5 35 59.0 36 75.0 37 98.5 38 132.0 39 166.5 40 199.0 41 222.0 42 253.0 43 283.5 44 292.5 45 298.0 46 298.5 47 276.5 48 253.0 49 205.5 50 152.0 51 137.5 52 117.5 53 93.0 54 76.0 55 53.5 56 31.5 57 22.5 58 18.0 59 13.0 60 11.0 61 7.5 62 5.5 63 4.5 64 2.0 65 1.0 66 2.5 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.5249999999999999 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.2000000000000002 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.3875 0.0 0.0 0.0 0.0 114-115 1.4500000000000002 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.9125 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.4125 0.0 0.0 0.0 0.0 124-125 2.5875 0.0 0.0 0.0 0.0 126-127 2.925 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.45 0.0 0.0 0.0 0.0 132-133 3.6500000000000004 0.0 0.0 0.0 0.0 134-135 3.8625 0.0 0.0 0.0 0.0 136-137 4.0 0.0 0.0 0.0 0.0 138-139 4.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635695 spots for SRR7169899.sra Written 635695 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra Read 635692 spots for SRR7169899.sra Written 635692 spots for SRR7169899.sra SRR ids: ['SRR7169899.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gbwoovn2 SRR7169899.sra spots: 12713843 blocks: [[1, 635692], [635693, 1271384], [1271385, 1907076], [1907077, 2542768], [2542769, 3178460], [3178461, 3814152], [3814153, 4449844], [4449845, 5085536], [5085537, 5721228], [5721229, 6356920], [6356921, 6992612], [6992613, 7628304], [7628305, 8263996], [8263997, 8899688], [8899689, 9535380], [9535381, 10171072], [10171073, 10806764], [10806765, 11442456], [11442457, 12078148], [12078149, 12713843]] SRR7169899 file size 4286603 SRR7169899 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169899 SRR7169899_1.fastq SRR7169899_2.fastq Input file: SRR7169899_1.fastq Paired file: SRR7169899_2.fastq trimmed: SRR7169899-trimmed-pair1.fastq, SRR7169899-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:52:41 2025 >> started Wed Feb 12 01:52:54 2025 >> done (13.463s) 12713843 read pairs processed; of these: 9414 ( 0.07%) short read pairs filtered out after trimming by size control 8622 ( 0.07%) empty read pairs filtered out after trimming by size control 12695807 (99.86%) read pairs available; of these: 5551700 (43.73%) trimmed read pairs available after processing 7144107 (56.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 3 0.00% 21 2 0.00% 22 4 0.00% 23 2 0.00% 24 1 0.00% 25 3 0.00% 26 4 0.00% 27 2 0.00% 28 5 0.00% 29 3 0.00% 30 7 0.00% 31 0 0.00% 32 6 0.00% 33 3 0.00% 34 8 0.00% 35 7 0.00% 36 8 0.00% 37 7 0.00% 38 9 0.00% 39 15 0.00% 40 20 0.00% 41 14 0.00% 42 17 0.00% 43 12 0.00% 44 11 0.00% 45 21 0.00% 46 29 0.00% 47 32 0.00% 48 33 0.00% 49 47 0.00% 50 42 0.00% 51 58 0.00% 52 70 0.00% 53 80 0.00% 54 88 0.00% 55 86 0.00% 56 98 0.00% 57 119 0.00% 58 129 0.00% 59 160 0.00% 60 181 0.00% 61 206 0.00% 62 255 0.00% 63 277 0.00% 64 355 0.00% 65 355 0.00% 66 374 0.00% 67 437 0.00% 68 481 0.00% 69 504 0.00% 70 625 0.00% 71 738 0.01% 72 888 0.01% 73 1056 0.01% 74 1089 0.01% 75 1234 0.01% 76 1351 0.01% 77 1432 0.01% 78 1545 0.01% 79 1736 0.01% 80 1973 0.02% 81 2272 0.02% 82 2515 0.02% 83 2965 0.02% 84 3490 0.03% 85 3918 0.03% 86 4193 0.03% 87 4503 0.04% 88 4804 0.04% 89 4979 0.04% 90 5365 0.04% 91 5810 0.05% 92 6259 0.05% 93 6632 0.05% 94 7042 0.06% 95 7476 0.06% 96 7809 0.06% 97 7917 0.06% 98 8150 0.06% 99 8501 0.07% 100 9042 0.07% 101 9497 0.07% 102 10068 0.08% 103 10488 0.08% 104 11098 0.09% 105 11581 0.09% 106 12053 0.09% 107 12156 0.10% 108 12457 0.10% 109 12730 0.10% 110 12966 0.10% 111 13585 0.11% 112 14275 0.11% 113 14921 0.12% 114 15777 0.12% 115 16322 0.13% 116 16714 0.13% 117 17031 0.13% 118 17253 0.14% 119 17109 0.13% 120 17745 0.14% 121 18240 0.14% 122 18933 0.15% 123 19215 0.15% 124 20510 0.16% 125 21721 0.17% 126 22346 0.18% 127 22829 0.18% 128 23745 0.19% 129 24396 0.19% 130 25608 0.20% 131 26098 0.21% 132 27997 0.22% 133 29466 0.23% 134 31165 0.25% 135 33110 0.26% 136 35593 0.28% 137 37736 0.30% 138 40395 0.32% 139 43759 0.34% 140 47666 0.38% 141 52169 0.41% 142 59160 0.47% 143 67912 0.53% 144 81805 0.64% 145 101529 0.80% 146 131202 1.03% 147 184162 1.45% 148 292728 2.31% 149 609670 4.80% 150 2993008 23.57% 151 7144107 56.27% 12695807 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=40 prefix-density=0.23 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=247.25 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=16.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.77 fanout-score-rank=22 prefix-density=0.39 prefix-fanout=3.4 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=42 fanout-score=134.19 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=14.5 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169899 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:53:39 Started mapping on | Feb 12 01:53:39 Finished on | Feb 12 01:54:37 Mapping speed, Million of reads per hour | 788.02 Number of input reads | 12695807 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12061464 Uniquely mapped reads % | 95.00% Average mapped length | 295.15 Number of splices: Total | 11259648 Number of splices: Annotated (sjdb) | 11078904 Number of splices: GT/AG | 11103160 Number of splices: GC/AG | 125723 Number of splices: AT/AC | 8271 Number of splices: Non-canonical | 22494 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 211602 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 20401 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 432039 432039 432039 N_multimapping 211602 211602 211602 N_noFeature 272203 11924412 320882 N_ambiguous 137200 618 48406 UnstrandedReadsAssigned:11652061 PositiveStrandReadsAssigned:136434 NegativeStrandReadsAssigned:11692176 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169899 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169899-trimmed-pair1.fastq SRR7169899-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,695,807 reads, 11,623,464 reads pseudoaligned [quant] estimated average fragment length: 273.134 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52401 SRR7169899.ke.tsv 34699 SRR7169899.se.tsv 87100 total ==> SRR7169899.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.87 217 10.5912 Potri.005G024800.1.v4.1 1035 762.866 25 2.79246 Potri.004G059700.1.v4.1 961 688.906 4 0.49476 Potri.007G009000.2.v4.1 1416 1143.87 0 0 Potri.003G141000.2.v4.1 2943 2670.87 201 6.41267 Potri.016G087400.1.v4.1 270 75.8616 1086.09 1219.94 Potri.015G069301.1.v4.1 564 298.532 0 0 Potri.010G195200.1.v4.1 1773 1500.87 11 0.624519 Potri.012G127500.1.v4.1 977 704.889 4040 488.377 ==> SRR7169899.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 971 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 183 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 19 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169899 completed mapping pipeline successfully