Starting /dee2/code/volunteer_pipeline.sh SRR7169900 current disk space = 3050145009664 free memory = 1351582940 SRR7169900 SRAfilesize 311a77afeb88fb85d6846048b46a2d14 SRR7169900.sra SRR7169900.sra file validated SRR7169900 is paired end SRR7169900 is conventional basespace SRR7169900 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169900_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.3225 18.0 18.0 18.0 18.0 32.0 2 26.6755 27.0 25.0 29.0 18.0 31.0 3 27.813 29.0 27.0 31.0 25.0 33.0 4 31.07225 31.0 30.0 33.0 29.0 33.0 5 31.9875 33.0 32.0 33.0 31.0 33.0 6 36.29075 37.0 36.0 38.0 34.0 38.0 7 36.391 38.0 37.0 38.0 34.0 38.0 8 37.17775 38.0 38.0 38.0 36.0 38.0 9 37.43375 38.0 38.0 38.0 37.0 38.0 10-14 37.59905 38.0 38.0 38.0 37.6 38.0 15-19 37.6066 38.0 38.0 38.0 37.6 38.0 20-24 37.628 38.0 38.0 38.0 37.8 38.0 25-29 37.68325 38.0 38.0 38.0 38.0 38.0 30-34 37.6134 38.0 38.0 38.0 38.0 38.0 35-39 37.5986 38.0 38.0 38.0 38.0 38.0 40-44 37.41125 38.0 38.0 38.0 37.4 38.0 45-49 37.55075 38.0 38.0 38.0 38.0 38.0 50-54 37.4598 38.0 38.0 38.0 37.2 38.0 55-59 37.416250000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.36305 38.0 38.0 38.0 37.0 38.0 65-69 37.264649999999996 38.0 38.0 38.0 36.6 38.0 70-74 37.23085 38.0 38.0 38.0 36.4 38.0 75-79 36.98635 38.0 38.0 38.0 36.0 38.0 80-84 36.85185 38.0 38.0 38.0 35.8 38.0 85-89 36.270950000000006 38.0 37.6 38.0 33.6 38.0 90-94 36.44969999999999 38.0 37.8 38.0 34.4 38.0 95-99 36.178450000000005 38.0 37.6 38.0 33.0 38.0 100-104 35.623549999999994 38.0 36.8 38.0 30.4 38.0 105-109 36.19475 38.0 37.4 38.0 33.8 38.0 110-114 36.086400000000005 38.0 37.0 38.0 33.6 38.0 115-119 35.27205 38.0 35.8 38.0 29.6 38.0 120-124 34.674850000000006 38.0 35.0 38.0 25.6 38.0 125-129 35.293549999999996 38.0 36.0 38.0 30.6 38.0 130-134 33.71939999999999 37.8 33.6 38.0 21.0 38.0 135-139 34.72195 38.0 35.0 38.0 27.8 38.0 140-144 33.4983 37.6 34.0 38.0 20.6 38.0 145-149 32.856049999999996 37.2 33.0 38.0 18.8 38.0 150-151 28.918625 34.5 17.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 2.0 16 1.0 17 3.0 18 12.0 19 13.0 20 2.0 21 4.0 22 4.0 23 1.0 24 2.0 25 3.0 26 5.0 27 14.0 28 15.0 29 20.0 30 34.0 31 48.0 32 67.0 33 127.0 34 234.0 35 485.0 36 1361.0 37 1535.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.9 32.7 11.725 31.674999999999997 2 23.425 15.775 32.300000000000004 28.499999999999996 3 18.875 21.525 27.725 31.874999999999996 4 21.875 27.0 23.175 27.950000000000003 5 22.825 29.525000000000002 25.35 22.3 6 20.150000000000002 33.300000000000004 25.974999999999998 20.575 7 14.725 27.025 40.625 17.625 8 18.224999999999998 28.349999999999998 28.575 24.85 9 18.25 26.875 32.4 22.475 10-14 19.655 30.869999999999997 26.790000000000003 22.685 15-19 19.275000000000002 29.205 28.044999999999998 23.474999999999998 20-24 19.675 28.994999999999997 27.834999999999997 23.494999999999997 25-29 19.605 29.42 27.134999999999998 23.84 30-34 19.185 29.37 27.694999999999997 23.75 35-39 19.91 29.085 26.905 24.099999999999998 40-44 19.759999999999998 29.235 27.785 23.22 45-49 19.765 28.88 27.54 23.815 50-54 20.77 28.88 26.935 23.415 55-59 19.81 28.54 27.85 23.799999999999997 60-64 20.155 28.485 27.815 23.544999999999998 65-69 20.580000000000002 28.89 27.115000000000002 23.415 70-74 19.825 29.48 27.500000000000004 23.195 75-79 20.45 29.435 26.745 23.369999999999997 80-84 20.36 29.375 26.6 23.665 85-89 20.79 28.62 26.985 23.605 90-94 20.215 28.694999999999997 27.005000000000003 24.085 95-99 20.455000000000002 28.27 27.589999999999996 23.685000000000002 100-104 20.27 29.065 27.224999999999998 23.44 105-109 20.544999999999998 28.105000000000004 27.66 23.69 110-114 20.810000000000002 28.449999999999996 26.83 23.91 115-119 20.424999999999997 28.689999999999998 27.0 23.885 120-124 20.65 28.48 27.12 23.75 125-129 20.34 28.575 27.055 24.03 130-134 20.74 28.715000000000003 26.875 23.669999999999998 135-139 20.880000000000003 27.634999999999998 27.250000000000004 24.235 140-144 20.39 27.62 27.47 24.52 145-149 21.060000000000002 27.950000000000003 27.375 23.615 150-151 20.4875 28.3125 27.287499999999998 23.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 2.5 24 5.0 25 7.0 26 8.5 27 11.5 28 16.5 29 18.0 30 25.5 31 34.0 32 38.5 33 55.0 34 70.5 35 80.0 36 97.0 37 113.5 38 130.0 39 140.0 40 169.0 41 219.0 42 239.0 43 250.0 44 257.0 45 256.5 46 263.0 47 264.0 48 230.0 49 185.5 50 157.5 51 138.5 52 123.5 53 93.0 54 72.5 55 56.0 56 41.5 57 33.5 58 24.5 59 19.5 60 12.5 61 7.5 62 6.0 63 3.5 64 2.5 65 3.0 66 1.5 67 3.0 68 3.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.6469104665826 98.775 2 0.3026481715006305 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025220680958385876 0.22499999999999998 >10 0.025220680958385876 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 16 0.4 TruSeq Adapter, Index 7 (97% over 36bp) AATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 2 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.0750000000000002 0.0 0.0 0.0 0.0 108-109 1.175 0.0 0.0 0.0 0.0 110-111 1.3250000000000002 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.575 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 1.9875 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.375 0.0 0.0 0.0 0.0 124-125 2.6375 0.0 0.0 0.0 0.0 126-127 2.9000000000000004 0.0 0.0 0.0 0.0 128-129 3.0875000000000004 0.0 0.0 0.0 0.0 130-131 3.275 0.0 0.0 0.0 0.0 132-133 3.5 0.0 0.0 0.0 0.0 134-135 3.6 0.0 0.0 0.0 0.0 136-137 3.725 0.0 0.0 0.0 0.0 138-139 3.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTATTT 10 0.006830828 145.0 1 AATATTT 10 0.006830828 145.0 5 ATATTTC 10 0.006830828 145.0 6 CTATTTC 10 0.006830828 145.0 2 >>END_MODULE SRR7169900 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169900_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.174 34.0 33.0 34.0 33.0 34.0 2 33.219 34.0 33.0 34.0 33.0 34.0 3 33.26125 34.0 33.0 34.0 33.0 34.0 4 33.21275 34.0 33.0 34.0 33.0 34.0 5 33.1735 34.0 33.0 34.0 33.0 34.0 6 37.277 38.0 38.0 38.0 38.0 38.0 7 37.214 38.0 38.0 38.0 37.0 38.0 8 37.30175 38.0 38.0 38.0 38.0 38.0 9 37.28775 38.0 38.0 38.0 37.0 38.0 10-14 37.2876 38.0 38.0 38.0 37.6 38.0 15-19 37.26754999999999 38.0 38.0 38.0 37.6 38.0 20-24 37.01535 38.0 38.0 38.0 36.4 38.0 25-29 36.4961 38.0 38.0 38.0 33.8 38.0 30-34 36.42275 38.0 37.8 38.0 33.6 38.0 35-39 36.80565 38.0 38.0 38.0 35.6 38.0 40-44 36.80115 38.0 38.0 38.0 35.6 38.0 45-49 36.866099999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.988099999999996 38.0 38.0 38.0 36.4 38.0 55-59 37.0846 38.0 38.0 38.0 37.0 38.0 60-64 36.95425 38.0 38.0 38.0 36.4 38.0 65-69 37.0153 38.0 38.0 38.0 36.8 38.0 70-74 37.080200000000005 38.0 38.0 38.0 37.0 38.0 75-79 37.022800000000004 38.0 38.0 38.0 36.4 38.0 80-84 36.697649999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.62285 38.0 38.0 38.0 36.0 38.0 90-94 36.646300000000004 38.0 38.0 38.0 35.8 38.0 95-99 36.55115 38.0 38.0 38.0 35.6 38.0 100-104 36.3257 38.0 38.0 38.0 34.4 38.0 105-109 36.2763 38.0 38.0 38.0 34.0 38.0 110-114 36.2759 38.0 38.0 38.0 34.0 38.0 115-119 36.067600000000006 38.0 38.0 38.0 33.8 38.0 120-124 35.8014 38.0 37.6 38.0 33.0 38.0 125-129 35.7329 38.0 37.4 38.0 33.0 38.0 130-134 35.4375 38.0 36.4 38.0 31.4 38.0 135-139 35.06499999999999 38.0 36.0 38.0 30.6 38.0 140-144 34.863600000000005 38.0 36.0 38.0 29.2 38.0 145-149 34.33245 38.0 35.2 38.0 26.6 38.0 150-151 30.3975 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 3.0 5 0.0 6 0.0 7 1.0 8 1.0 9 6.0 10 1.0 11 2.0 12 1.0 13 0.0 14 1.0 15 0.0 16 2.0 17 8.0 18 6.0 19 5.0 20 19.0 21 4.0 22 8.0 23 7.0 24 9.0 25 7.0 26 18.0 27 15.0 28 13.0 29 23.0 30 30.0 31 33.0 32 51.0 33 90.0 34 136.0 35 221.0 36 600.0 37 2667.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.275 21.025 16.675 24.025 2 26.531632908227053 27.056764191047762 28.582145536384097 17.829457364341085 3 21.475 29.025000000000002 29.65 19.85 4 24.15603900975244 32.93323330832708 22.680670167541887 20.230057514378593 5 24.33108277069267 35.8589647411853 21.880470117529384 17.92948237059265 6 22.525000000000002 36.575 22.975 17.925 7 21.025 22.15 36.6 20.225 8 22.85 26.174999999999997 25.874999999999996 25.1 9 23.075000000000003 25.474999999999998 27.450000000000003 24.0 10-14 24.21 28.89 25.45 21.45 15-19 24.145 28.12 27.275 20.46 20-24 23.305 28.23 27.01 21.455 25-29 23.695 28.42 26.945000000000004 20.94 30-34 24.015 28.1 27.155 20.73 35-39 23.47 28.125 26.939999999999998 21.465 40-44 23.69 28.299999999999997 27.029999999999998 20.979999999999997 45-49 24.104999999999997 27.975 27.47 20.45 50-54 23.815 28.235 27.065 20.885 55-59 24.315 27.615000000000002 27.355 20.715 60-64 23.915 27.97 27.1 21.015 65-69 23.755000000000003 27.455000000000002 27.439999999999998 21.349999999999998 70-74 23.64 28.575 27.310000000000002 20.474999999999998 75-79 23.150000000000002 28.315 27.22 21.315 80-84 23.275000000000002 28.299999999999997 27.125 21.3 85-89 23.380000000000003 28.12 27.72 20.78 90-94 23.93 27.894999999999996 27.21 20.965 95-99 23.96 27.825 27.345000000000002 20.87 100-104 24.07 27.975 27.215 20.74 105-109 23.915 27.875 27.334999999999997 20.875 110-114 24.135 28.01 27.325 20.53 115-119 24.645 27.685 27.375 20.294999999999998 120-124 24.115000000000002 28.084999999999997 27.24 20.560000000000002 125-129 24.349999999999998 28.544999999999998 26.495 20.61 130-134 24.455 28.28 26.724999999999998 20.54 135-139 24.295 27.66 27.529999999999998 20.515 140-144 24.915000000000003 27.52 27.21 20.355 145-149 24.560000000000002 27.305 27.43 20.705000000000002 150-151 24.6 28.349999999999998 26.75 20.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 3.0 27 3.0 28 1.5 29 5.5 30 8.5 31 8.0 32 15.5 33 21.0 34 21.5 35 41.0 36 70.0 37 87.5 38 114.0 39 144.0 40 179.0 41 231.5 42 261.5 43 288.0 44 310.0 45 312.5 46 293.5 47 263.0 48 240.5 49 205.0 50 176.0 51 151.5 52 129.5 53 106.5 54 84.0 55 59.0 56 33.0 57 28.5 58 26.0 59 18.5 60 14.5 61 12.0 62 7.0 63 5.5 64 4.0 65 2.5 66 4.0 67 2.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3173198482933 98.2 2 0.6321112515802781 1.25 3 0.025284450063211124 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025284450063211124 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 19 0.475 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.3250000000000002 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.575 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 1.9875 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.6125 0.0 0.0 0.0 0.0 126-127 2.8375 0.0 0.0 0.0 0.0 128-129 3.025 0.0 0.0 0.0 0.0 130-131 3.275 0.0 0.0 0.0 0.0 132-133 3.5 0.0 0.0 0.0 0.0 134-135 3.6 0.0 0.0 0.0 0.0 136-137 3.75 0.0 0.0 0.0 0.0 138-139 3.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412426 spots for SRR7169900.sra Written 412426 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra Read 412421 spots for SRR7169900.sra Written 412421 spots for SRR7169900.sra SRR ids: ['SRR7169900.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ayfdnz03 SRR7169900.sra spots: 8248425 blocks: [[1, 412421], [412422, 824842], [824843, 1237263], [1237264, 1649684], [1649685, 2062105], [2062106, 2474526], [2474527, 2886947], [2886948, 3299368], [3299369, 3711789], [3711790, 4124210], [4124211, 4536631], [4536632, 4949052], [4949053, 5361473], [5361474, 5773894], [5773895, 6186315], [6186316, 6598736], [6598737, 7011157], [7011158, 7423578], [7423579, 7835999], [7836000, 8248425]] SRR7169900 file size 2776841 SRR7169900 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169900 SRR7169900_1.fastq SRR7169900_2.fastq Input file: SRR7169900_1.fastq Paired file: SRR7169900_2.fastq trimmed: SRR7169900-trimmed-pair1.fastq, SRR7169900-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:02:19 2025 >> started Wed Feb 12 02:02:28 2025 >> done (9.371s) 8248425 read pairs processed; of these: 13719 ( 0.17%) short read pairs filtered out after trimming by size control 78215 ( 0.95%) empty read pairs filtered out after trimming by size control 8156491 (98.89%) read pairs available; of these: 3597339 (44.10%) trimmed read pairs available after processing 4559152 (55.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 2 0.00% 20 5 0.00% 21 4 0.00% 22 5 0.00% 23 9 0.00% 24 10 0.00% 25 5 0.00% 26 4 0.00% 27 6 0.00% 28 6 0.00% 29 6 0.00% 30 10 0.00% 31 5 0.00% 32 8 0.00% 33 4 0.00% 34 12 0.00% 35 2 0.00% 36 10 0.00% 37 15 0.00% 38 8 0.00% 39 18 0.00% 40 17 0.00% 41 21 0.00% 42 25 0.00% 43 24 0.00% 44 21 0.00% 45 41 0.00% 46 38 0.00% 47 39 0.00% 48 34 0.00% 49 69 0.00% 50 56 0.00% 51 64 0.00% 52 81 0.00% 53 90 0.00% 54 89 0.00% 55 100 0.00% 56 118 0.00% 57 136 0.00% 58 136 0.00% 59 164 0.00% 60 186 0.00% 61 187 0.00% 62 213 0.00% 63 232 0.00% 64 287 0.00% 65 320 0.00% 66 336 0.00% 67 340 0.00% 68 374 0.00% 69 452 0.01% 70 579 0.01% 71 715 0.01% 72 832 0.01% 73 878 0.01% 74 863 0.01% 75 1250 0.02% 76 1828 0.02% 77 2190 0.03% 78 1446 0.02% 79 1478 0.02% 80 1461 0.02% 81 1735 0.02% 82 1862 0.02% 83 2112 0.03% 84 2836 0.03% 85 3221 0.04% 86 3381 0.04% 87 3698 0.05% 88 3920 0.05% 89 3969 0.05% 90 4120 0.05% 91 4201 0.05% 92 4493 0.06% 93 4743 0.06% 94 5016 0.06% 95 5210 0.06% 96 5347 0.07% 97 5331 0.07% 98 5489 0.07% 99 5577 0.07% 100 5811 0.07% 101 6171 0.08% 102 6483 0.08% 103 6734 0.08% 104 7028 0.09% 105 7227 0.09% 106 7400 0.09% 107 7650 0.09% 108 7916 0.10% 109 8010 0.10% 110 8207 0.10% 111 8521 0.10% 112 8990 0.11% 113 9205 0.11% 114 9787 0.12% 115 10308 0.13% 116 10524 0.13% 117 10634 0.13% 118 10826 0.13% 119 10965 0.13% 120 10789 0.13% 121 11218 0.14% 122 11637 0.14% 123 12007 0.15% 124 12752 0.16% 125 13179 0.16% 126 13838 0.17% 127 14412 0.18% 128 14915 0.18% 129 15428 0.19% 130 15785 0.19% 131 16528 0.20% 132 17191 0.21% 133 18293 0.22% 134 19304 0.24% 135 20806 0.26% 136 22313 0.27% 137 24013 0.29% 138 25956 0.32% 139 27956 0.34% 140 30606 0.38% 141 33766 0.41% 142 38241 0.47% 143 44182 0.54% 144 53298 0.65% 145 65839 0.81% 146 85205 1.04% 147 119828 1.47% 148 191240 2.34% 149 395875 4.85% 150 1938308 23.76% 151 4559152 55.90% 8156491 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=40 prefix-density=0.26 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=260.45 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=17.8 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=8.27 fanout-score-rank=20 prefix-density=0.42 prefix-fanout=4.1 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=159.75 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.8 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTTCTCGAGAAGATCAAGGAGA SRR7169900 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:03:14 Started mapping on | Feb 12 02:03:14 Finished on | Feb 12 02:04:25 Mapping speed, Million of reads per hour | 413.57 Number of input reads | 8156491 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 7458036 Uniquely mapped reads % | 91.44% Average mapped length | 295.14 Number of splices: Total | 6948664 Number of splices: Annotated (sjdb) | 6834647 Number of splices: GT/AG | 6849100 Number of splices: GC/AG | 80437 Number of splices: AT/AC | 5073 Number of splices: Non-canonical | 14054 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 142323 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 8895 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.67% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 566323 566323 566323 N_multimapping 142323 142323 142323 N_noFeature 143813 7372880 172116 N_ambiguous 87870 532 30641 UnstrandedReadsAssigned:7226353 PositiveStrandReadsAssigned:84624 NegativeStrandReadsAssigned:7255279 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169900 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169900-trimmed-pair1.fastq SRR7169900-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,156,491 reads, 7,198,480 reads pseudoaligned [quant] estimated average fragment length: 282 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR7169900.ke.tsv 34699 SRR7169900.se.tsv 87100 total ==> SRR7169900.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737 130 9.26131 Potri.005G024800.1.v4.1 1035 754 22 3.61061 Potri.004G059700.1.v4.1 961 680 1 0.181978 Potri.007G009000.2.v4.1 1416 1135 0 0 Potri.003G141000.2.v4.1 2943 2662 154 7.15882 Potri.016G087400.1.v4.1 270 73.571 768 1291.76 Potri.015G069301.1.v4.1 564 288.956 0 0 Potri.010G195200.1.v4.1 1773 1492 5 0.414696 Potri.012G127500.1.v4.1 977 696 2592 460.845 ==> SRR7169900.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 574 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 134 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169900 completed mapping pipeline successfully