Starting /dee2/code/volunteer_pipeline.sh SRR7169901 current disk space = 3049006919680 free memory = 1582268204 SRR7169901 SRAfilesize 30199b650db1051966cc74cf85406354 SRR7169901.sra SRR7169901.sra file validated SRR7169901 is paired end SRR7169901 is conventional basespace SRR7169901 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169901_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.709 18.0 18.0 18.0 18.0 32.0 2 26.9305 27.0 25.0 29.0 18.0 31.0 3 27.82625 29.0 27.0 31.0 25.0 33.0 4 30.739 31.0 29.0 33.0 28.0 33.0 5 31.532 33.0 31.0 33.0 29.0 33.0 6 36.314 37.0 36.0 38.0 34.0 38.0 7 37.2145 38.0 37.0 38.0 36.0 38.0 8 37.3535 38.0 38.0 38.0 36.0 38.0 9 36.75625 38.0 38.0 38.0 35.0 38.0 10-14 37.51455 38.0 38.0 38.0 37.0 38.0 15-19 37.4006 38.0 38.0 38.0 37.2 38.0 20-24 37.45585 38.0 38.0 38.0 37.0 38.0 25-29 37.63065 38.0 38.0 38.0 38.0 38.0 30-34 37.59705 38.0 38.0 38.0 38.0 38.0 35-39 37.59195 38.0 38.0 38.0 38.0 38.0 40-44 37.439099999999996 38.0 38.0 38.0 37.2 38.0 45-49 37.57055 38.0 38.0 38.0 38.0 38.0 50-54 37.524950000000004 38.0 38.0 38.0 37.2 38.0 55-59 37.43275 38.0 38.0 38.0 37.0 38.0 60-64 37.31085 38.0 38.0 38.0 36.8 38.0 65-69 37.3027 38.0 38.0 38.0 36.8 38.0 70-74 37.229200000000006 38.0 38.0 38.0 36.2 38.0 75-79 37.1291 38.0 38.0 38.0 36.0 38.0 80-84 36.905899999999995 38.0 38.0 38.0 35.4 38.0 85-89 36.44690000000001 38.0 37.8 38.0 33.8 38.0 90-94 36.79995 38.0 38.0 38.0 34.8 38.0 95-99 36.7153 38.0 38.0 38.0 34.8 38.0 100-104 36.501250000000006 38.0 37.8 38.0 33.8 38.0 105-109 35.442750000000004 38.0 36.0 38.0 29.2 38.0 110-114 35.7061 38.0 36.6 38.0 31.0 38.0 115-119 35.8284 38.0 36.6 38.0 32.2 38.0 120-124 35.7312 38.0 36.4 38.0 32.2 38.0 125-129 33.9493 37.4 33.0 38.0 24.0 38.0 130-134 34.2684 37.8 34.0 38.0 25.2 38.0 135-139 34.5906 38.0 34.0 38.0 27.8 38.0 140-144 33.509299999999996 38.0 33.0 38.0 21.4 38.0 145-149 32.76695 38.0 32.8 38.0 16.6 38.0 150-151 28.300375000000003 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 1.0 15 2.0 16 0.0 17 2.0 18 3.0 19 4.0 20 1.0 21 4.0 22 3.0 23 3.0 24 7.0 25 13.0 26 9.0 27 6.0 28 10.0 29 32.0 30 28.0 31 64.0 32 77.0 33 134.0 34 219.0 35 530.0 36 1405.0 37 1441.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.65 16.75 7.6 36.0 2 22.680670167541887 14.928732183045762 34.958739684921234 27.431857964491122 3 18.65 20.95 26.950000000000003 33.45 4 23.425 27.224999999999998 22.475 26.875 5 22.275 32.5 24.45 20.775 6 20.375 35.325 24.625 19.675 7 13.8 28.1 41.825 16.275000000000002 8 18.4 26.0 30.475 25.124999999999996 9 17.875 24.725 33.625 23.775 10-14 19.919999999999998 30.599999999999998 26.36 23.119999999999997 15-19 20.22 29.26 27.815 22.705000000000002 20-24 19.99 29.325000000000003 26.96 23.724999999999998 25-29 19.78 29.720000000000002 26.924999999999997 23.575 30-34 19.495 29.054999999999996 27.87 23.580000000000002 35-39 19.86 29.125 27.245 23.77 40-44 20.349999999999998 28.955 27.439999999999998 23.255 45-49 19.86 29.015 27.500000000000004 23.625 50-54 19.93 29.075 27.195000000000004 23.799999999999997 55-59 20.294999999999998 29.385 26.86 23.46 60-64 20.275000000000002 29.270000000000003 27.05 23.405 65-69 20.24 28.815 27.215 23.73 70-74 20.505000000000003 28.925 27.27 23.3 75-79 20.26 29.14 26.995 23.605 80-84 19.775000000000002 28.665000000000003 27.800000000000004 23.76 85-89 20.36 28.73 26.965 23.945 90-94 20.085 29.4 27.005000000000003 23.51 95-99 20.369999999999997 28.560000000000002 27.339999999999996 23.73 100-104 20.49 28.720000000000002 27.229999999999997 23.56 105-109 20.955 28.365000000000002 27.515 23.165 110-114 20.8 28.415000000000003 27.310000000000002 23.474999999999998 115-119 20.830000000000002 29.005 26.935 23.23 120-124 20.09 28.285 27.500000000000004 24.125 125-129 20.505000000000003 28.485 26.86 24.15 130-134 21.04 28.74 26.565 23.655 135-139 21.135 28.51 26.595000000000002 23.76 140-144 20.424999999999997 28.4 26.619999999999997 24.555 145-149 20.990000000000002 28.03 26.625 24.355 150-151 20.7375 29.175 26.3125 23.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.5 22 1.5 23 0.5 24 3.0 25 3.5 26 3.5 27 7.0 28 8.5 29 10.5 30 15.0 31 23.5 32 30.5 33 41.0 34 56.0 35 75.0 36 100.5 37 121.0 38 133.0 39 155.0 40 183.0 41 212.0 42 241.5 43 264.5 44 297.0 45 290.5 46 266.0 47 253.5 48 222.0 49 196.5 50 179.5 51 145.0 52 107.5 53 92.5 54 73.0 55 46.5 56 38.5 57 30.0 58 19.0 59 13.5 60 9.0 61 7.0 62 5.0 63 3.5 64 2.5 65 3.0 66 1.5 67 0.5 68 1.5 69 1.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.48750000000000004 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.225 0.0 0.0 0.0 0.0 98-99 1.3624999999999998 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.8 0.0 0.0 0.0 0.0 106-107 2.0875 0.0 0.0 0.0 0.0 108-109 2.3125 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.8125 0.0 0.0 0.0 0.0 114-115 3.0374999999999996 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.575 0.0 0.0 0.0 0.0 120-121 3.9125 0.0 0.0 0.0 0.0 122-123 4.3875 0.0 0.0 0.0 0.0 124-125 4.637499999999999 0.0 0.0 0.0 0.0 126-127 4.875 0.0 0.0 0.0 0.0 128-129 5.4 0.0 0.0 0.0 0.0 130-131 5.675000000000001 0.0 0.0 0.0 0.0 132-133 6.0375 0.0 0.0 0.0 0.0 134-135 6.4125 0.0 0.0 0.0 0.0 136-137 6.9625 0.0 0.0 0.0 0.0 138-139 7.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169901 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169901_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.238 34.0 33.0 34.0 33.0 34.0 2 33.224 34.0 33.0 34.0 33.0 34.0 3 33.3445 34.0 33.0 34.0 33.0 34.0 4 33.3175 34.0 33.0 34.0 33.0 34.0 5 33.33075 34.0 33.0 34.0 33.0 34.0 6 37.5085 38.0 38.0 38.0 38.0 38.0 7 37.48825 38.0 38.0 38.0 38.0 38.0 8 37.25725 38.0 38.0 38.0 37.0 38.0 9 37.415 38.0 38.0 38.0 38.0 38.0 10-14 37.340050000000005 38.0 38.0 38.0 37.2 38.0 15-19 37.388749999999995 38.0 38.0 38.0 37.4 38.0 20-24 37.3754 38.0 38.0 38.0 37.4 38.0 25-29 36.98075 38.0 38.0 38.0 35.6 38.0 30-34 37.366 38.0 38.0 38.0 37.4 38.0 35-39 37.04415 38.0 38.0 38.0 35.6 38.0 40-44 37.335300000000004 38.0 38.0 38.0 37.2 38.0 45-49 36.801399999999994 38.0 37.8 38.0 35.0 38.0 50-54 37.14705 38.0 38.0 38.0 36.6 38.0 55-59 37.23154999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.07965 38.0 38.0 38.0 36.6 38.0 65-69 37.1163 38.0 38.0 38.0 36.4 38.0 70-74 37.18835 38.0 38.0 38.0 37.0 38.0 75-79 37.1596 38.0 38.0 38.0 37.0 38.0 80-84 36.9324 38.0 38.0 38.0 36.0 38.0 85-89 36.796299999999995 38.0 38.0 38.0 35.4 38.0 90-94 36.85025 38.0 38.0 38.0 35.8 38.0 95-99 36.7134 38.0 38.0 38.0 35.0 38.0 100-104 36.5291 38.0 38.0 38.0 34.6 38.0 105-109 36.476000000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.4483 38.0 38.0 38.0 34.2 38.0 115-119 36.23479999999999 38.0 38.0 38.0 34.0 38.0 120-124 35.938900000000004 38.0 37.2 38.0 33.0 38.0 125-129 35.06155 38.0 35.6 38.0 27.0 38.0 130-134 35.4929 38.0 36.2 38.0 31.4 38.0 135-139 34.0478 38.0 34.4 38.0 22.6 38.0 140-144 33.60825 38.0 33.0 38.0 22.4 38.0 145-149 32.956599999999995 38.0 32.6 38.0 18.8 38.0 150-151 29.335625 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 2.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 2.0 11 0.0 12 1.0 13 1.0 14 0.0 15 2.0 16 2.0 17 0.0 18 2.0 19 5.0 20 6.0 21 7.0 22 5.0 23 7.0 24 7.0 25 11.0 26 15.0 27 14.0 28 25.0 29 31.0 30 28.0 31 48.0 32 70.0 33 91.0 34 162.0 35 283.0 36 742.0 37 2425.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.6 21.875 11.275 26.25 2 25.78144536134033 27.33183295823956 30.15753938484621 16.729182295573892 3 20.150000000000002 28.599999999999998 31.4 19.85 4 24.981245311327832 32.45811452863216 23.655913978494624 18.904726181545385 5 24.075 36.075 22.025 17.825 6 21.425 36.65 23.275000000000002 18.65 7 19.625 22.175 38.2 20.0 8 20.549999999999997 25.5 28.599999999999998 25.35 9 22.85 23.3 31.125000000000004 22.725 10-14 23.405 28.515 27.155 20.925 15-19 23.150000000000002 27.634999999999998 27.860000000000003 21.355 20-24 22.8 27.810000000000002 28.189999999999998 21.2 25-29 23.115 27.88 27.905 21.099999999999998 30-34 23.535 28.15 27.825 20.49 35-39 22.945 27.400000000000002 28.43 21.224999999999998 40-44 23.45 28.345 27.994999999999997 20.21 45-49 23.375 28.055000000000003 28.01 20.560000000000002 50-54 23.89 28.134999999999998 27.55 20.424999999999997 55-59 23.41 28.035 27.755000000000003 20.8 60-64 23.575 27.185 28.43 20.810000000000002 65-69 23.325000000000003 27.735 28.49 20.45 70-74 23.169999999999998 27.6 28.565 20.665 75-79 23.405 27.85 28.21 20.535 80-84 23.52 27.295 28.715000000000003 20.47 85-89 24.060000000000002 27.01 28.87 20.06 90-94 24.4 27.284999999999997 27.779999999999998 20.535 95-99 24.015 27.33 27.965 20.69 100-104 24.025 28.310000000000002 27.544999999999998 20.119999999999997 105-109 24.445 26.99 28.449999999999996 20.115 110-114 24.3 28.060000000000002 27.755000000000003 19.885 115-119 24.875 27.439999999999998 27.705000000000002 19.98 120-124 24.535 27.52 27.994999999999997 19.950000000000003 125-129 24.169999999999998 28.07 28.005000000000003 19.755 130-134 25.324999999999996 27.49 27.189999999999998 19.994999999999997 135-139 24.965 27.21 28.125 19.7 140-144 24.725 27.445000000000004 27.584999999999997 20.244999999999997 145-149 25.52 27.61 27.11 19.759999999999998 150-151 25.387500000000003 27.450000000000003 27.0125 20.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 1.5 24 0.5 25 1.5 26 4.0 27 4.5 28 5.0 29 7.5 30 10.0 31 14.5 32 19.0 33 24.5 34 45.0 35 64.5 36 79.5 37 109.0 38 134.0 39 158.0 40 192.5 41 228.0 42 264.0 43 288.5 44 293.0 45 285.0 46 268.5 47 270.0 48 251.0 49 199.5 50 172.5 51 145.5 52 116.0 53 88.5 54 64.0 55 46.5 56 32.5 57 27.5 58 21.5 59 15.5 60 10.5 61 8.5 62 7.0 63 5.0 64 3.0 65 2.0 66 1.5 67 1.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.275 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.5499999999999998 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 1.8875000000000002 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.4625 0.0 0.0 0.0 0.0 110-111 2.675 0.0 0.0 0.0 0.0 112-113 2.9875 0.0 0.0 0.0 0.0 114-115 3.1875 0.0 0.0 0.0 0.0 116-117 3.3625 0.0 0.0 0.0 0.0 118-119 3.7 0.0 0.0 0.0 0.0 120-121 4.0375 0.0 0.0 0.0 0.0 122-123 4.55 0.0 0.0 0.0 0.0 124-125 4.8375 0.0 0.0 0.0 0.0 126-127 5.1125 0.0 0.0 0.0 0.0 128-129 5.7125 0.0 0.0 0.0 0.0 130-131 6.0 0.0 0.0 0.0 0.0 132-133 6.3375 0.0 0.0 0.0 0.0 134-135 6.6625 0.0 0.0 0.0 0.0 136-137 7.15 0.0 0.0 0.0 0.0 138-139 7.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTCCC 10 0.006830828 145.0 6 GGGGGGG 20 0.00593511 29.0 90-94 >>END_MODULE Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765521 spots for SRR7169901.sra Written 765521 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra Read 765508 spots for SRR7169901.sra Written 765508 spots for SRR7169901.sra SRR ids: ['SRR7169901.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ce9bn6qb SRR7169901.sra spots: 15310173 blocks: [[1, 765508], [765509, 1531016], [1531017, 2296524], [2296525, 3062032], [3062033, 3827540], [3827541, 4593048], [4593049, 5358556], [5358557, 6124064], [6124065, 6889572], [6889573, 7655080], [7655081, 8420588], [8420589, 9186096], [9186097, 9951604], [9951605, 10717112], [10717113, 11482620], [11482621, 12248128], [12248129, 13013636], [13013637, 13779144], [13779145, 14544652], [14544653, 15310173]] SRR7169901 file size 5166414 SRR7169901 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169901 SRR7169901_1.fastq SRR7169901_2.fastq Input file: SRR7169901_1.fastq Paired file: SRR7169901_2.fastq trimmed: SRR7169901-trimmed-pair1.fastq, SRR7169901-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:32:15 2025 >> started Wed Feb 12 02:32:30 2025 >> done (15.625s) 15310173 read pairs processed; of these: 8321 ( 0.05%) short read pairs filtered out after trimming by size control 8520 ( 0.06%) empty read pairs filtered out after trimming by size control 15293332 (99.89%) read pairs available; of these: 7146629 (46.73%) trimmed read pairs available after processing 8146703 (53.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 4 0.00% 21 4 0.00% 22 4 0.00% 23 6 0.00% 24 2 0.00% 25 4 0.00% 26 4 0.00% 27 5 0.00% 28 5 0.00% 29 1 0.00% 30 14 0.00% 31 6 0.00% 32 7 0.00% 33 5 0.00% 34 6 0.00% 35 18 0.00% 36 10 0.00% 37 6 0.00% 38 11 0.00% 39 15 0.00% 40 21 0.00% 41 24 0.00% 42 30 0.00% 43 37 0.00% 44 42 0.00% 45 40 0.00% 46 53 0.00% 47 61 0.00% 48 61 0.00% 49 64 0.00% 50 88 0.00% 51 97 0.00% 52 108 0.00% 53 118 0.00% 54 142 0.00% 55 168 0.00% 56 169 0.00% 57 228 0.00% 58 218 0.00% 59 272 0.00% 60 318 0.00% 61 381 0.00% 62 442 0.00% 63 527 0.00% 64 607 0.00% 65 618 0.00% 66 687 0.00% 67 783 0.01% 68 941 0.01% 69 1017 0.01% 70 1234 0.01% 71 1349 0.01% 72 1550 0.01% 73 1862 0.01% 74 2127 0.01% 75 2088 0.01% 76 2585 0.02% 77 2624 0.02% 78 3044 0.02% 79 3252 0.02% 80 3611 0.02% 81 4169 0.03% 82 4578 0.03% 83 5196 0.03% 84 6015 0.04% 85 6846 0.04% 86 7151 0.05% 87 7586 0.05% 88 8334 0.05% 89 8497 0.06% 90 9226 0.06% 91 9992 0.07% 92 10701 0.07% 93 11528 0.08% 94 12353 0.08% 95 12718 0.08% 96 13437 0.09% 97 13854 0.09% 98 14467 0.09% 99 14895 0.10% 100 15498 0.10% 101 16362 0.11% 102 17547 0.11% 103 18161 0.12% 104 18717 0.12% 105 19785 0.13% 106 20582 0.13% 107 20921 0.14% 108 21297 0.14% 109 21724 0.14% 110 22111 0.14% 111 23116 0.15% 112 24066 0.16% 113 25093 0.16% 114 25822 0.17% 115 26862 0.18% 116 27717 0.18% 117 28166 0.18% 118 28287 0.18% 119 28369 0.19% 120 29649 0.19% 121 29892 0.20% 122 31348 0.20% 123 31952 0.21% 124 33809 0.22% 125 34689 0.23% 126 36105 0.24% 127 37327 0.24% 128 37761 0.25% 129 38995 0.25% 130 40207 0.26% 131 41293 0.27% 132 43208 0.28% 133 45080 0.29% 134 47264 0.31% 135 50513 0.33% 136 53237 0.35% 137 56222 0.37% 138 60082 0.39% 139 63739 0.42% 140 67999 0.44% 141 73837 0.48% 142 81504 0.53% 143 92131 0.60% 144 108908 0.71% 145 133155 0.87% 146 168214 1.10% 147 232078 1.52% 148 362714 2.37% 149 722657 4.73% 150 3595487 23.51% 151 8146703 53.27% 15293332 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=43 prefix-density=0.15 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.12 sequence-density-rank=9 fanout-score=111.29 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=21.5 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=35 prefix-density=0.33 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.13 sequence-density-rank=17 fanout-score=27.90 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=8.9 sequence=TGCTGAGATCATTG SRR7169901 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:33:13 Started mapping on | Feb 12 02:33:13 Finished on | Feb 12 02:34:27 Mapping speed, Million of reads per hour | 744.00 Number of input reads | 15293332 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14550417 Uniquely mapped reads % | 95.14% Average mapped length | 293.32 Number of splices: Total | 14271283 Number of splices: Annotated (sjdb) | 14048761 Number of splices: GT/AG | 14061114 Number of splices: GC/AG | 169673 Number of splices: AT/AC | 10946 Number of splices: Non-canonical | 29550 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 261842 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 86969 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.49% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 490383 490383 490383 N_multimapping 261842 261842 261842 N_noFeature 320680 14404619 388379 N_ambiguous 136662 746 58050 UnstrandedReadsAssigned:14093075 PositiveStrandReadsAssigned:145052 NegativeStrandReadsAssigned:14103988 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169901 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169901-trimmed-pair1.fastq SRR7169901-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,293,332 reads, 14,004,568 reads pseudoaligned [quant] estimated average fragment length: 243.96 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 SRR7169901.ke.tsv 34699 SRR7169901.se.tsv 87100 total ==> SRR7169901.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.04 321 13.7687 Potri.005G024800.1.v4.1 1035 792.04 29 2.78771 Potri.004G059700.1.v4.1 961 718.056 0 0 Potri.007G009000.2.v4.1 1416 1173.04 0 0 Potri.003G141000.2.v4.1 2943 2700.04 166.019 4.68149 Potri.016G087400.1.v4.1 270 81.5582 928 866.316 Potri.015G069301.1.v4.1 564 325.798 0 0 Potri.010G195200.1.v4.1 1773 1530.04 19 0.945468 Potri.012G127500.1.v4.1 977 734.045 4146 430.033 ==> SRR7169901.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 710 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 291 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169901 completed mapping pipeline successfully