Starting /dee2/code/volunteer_pipeline.sh SRR7169902 current disk space = 3050722246656 free memory = 1484798128 SRR7169902 SRAfilesize a80fe15c564ab881a2888ddeddca4106 SRR7169902.sra SRR7169902.sra file validated SRR7169902 is paired end SRR7169902 is conventional basespace SRR7169902 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169902_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.327 18.0 18.0 18.0 18.0 32.0 2 26.197 27.0 25.0 29.0 18.0 30.0 3 27.4655 27.0 25.0 31.0 18.0 33.0 4 30.397 31.0 29.0 33.0 27.0 33.0 5 31.7165 33.0 32.0 33.0 30.0 33.0 6 36.1575 37.0 36.0 38.0 33.0 38.0 7 35.416 38.0 36.0 38.0 29.0 38.0 8 36.595 38.0 37.0 38.0 34.0 38.0 9 37.179 38.0 38.0 38.0 36.0 38.0 10-14 37.43655 38.0 38.0 38.0 36.8 38.0 15-19 37.4941 38.0 38.0 38.0 37.0 38.0 20-24 37.5788 38.0 38.0 38.0 37.6 38.0 25-29 37.60575 38.0 38.0 38.0 38.0 38.0 30-34 37.54405 38.0 38.0 38.0 38.0 38.0 35-39 37.53054999999999 38.0 38.0 38.0 37.6 38.0 40-44 37.46625 38.0 38.0 38.0 37.2 38.0 45-49 37.4929 38.0 38.0 38.0 37.6 38.0 50-54 37.21195 38.0 38.0 38.0 36.4 38.0 55-59 36.9881 38.0 38.0 38.0 35.8 38.0 60-64 37.11875 38.0 38.0 38.0 36.0 38.0 65-69 36.6387 38.0 37.6 38.0 34.0 38.0 70-74 37.01989999999999 38.0 38.0 38.0 35.8 38.0 75-79 37.01755 38.0 38.0 38.0 36.0 38.0 80-84 36.9529 38.0 38.0 38.0 35.8 38.0 85-89 36.82305 38.0 38.0 38.0 35.0 38.0 90-94 35.32825 38.0 36.2 38.0 28.6 38.0 95-99 36.225350000000006 38.0 37.0 38.0 33.0 38.0 100-104 35.4568 38.0 36.0 38.0 29.4 38.0 105-109 35.73855 38.0 36.2 38.0 29.2 38.0 110-114 34.85080000000001 38.0 35.0 38.0 26.8 38.0 115-119 34.8321 38.0 35.0 38.0 26.0 38.0 120-124 34.15775 37.8 33.4 38.0 24.8 38.0 125-129 34.3676 38.0 34.6 38.0 23.2 38.0 130-134 34.83075 38.0 34.8 38.0 27.2 38.0 135-139 34.3353 38.0 34.4 38.0 24.4 38.0 140-144 33.59855 37.6 33.4 38.0 23.0 38.0 145-149 32.899800000000006 37.4 33.6 38.0 18.6 38.0 150-151 30.049999999999997 36.0 28.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 0.0 17 3.0 18 0.0 19 5.0 20 5.0 21 5.0 22 8.0 23 6.0 24 7.0 25 17.0 26 12.0 27 17.0 28 19.0 29 22.0 30 40.0 31 65.0 32 97.0 33 154.0 34 273.0 35 592.0 36 1423.0 37 1226.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.475 19.625 8.0 35.9 2 22.575 15.8 33.800000000000004 27.825 3 21.475 21.025 26.474999999999998 31.025000000000002 4 23.175 27.224999999999998 23.05 26.55 5 21.75 32.65 24.8 20.8 6 19.675 36.375 24.025 19.925 7 14.674999999999999 25.900000000000002 39.925 19.5 8 17.95 26.275 30.75 25.025 9 17.375 24.5 33.4 24.725 10-14 20.485 30.159999999999997 26.545 22.81 15-19 19.24 28.99 27.860000000000003 23.91 20-24 19.869999999999997 28.79 28.075 23.265 25-29 20.035 29.07 27.26 23.635 30-34 19.665 28.685 28.17 23.48 35-39 19.97 29.365000000000002 27.26 23.405 40-44 19.62 29.330000000000002 27.655 23.395 45-49 19.85 29.044999999999998 27.089999999999996 24.015 50-54 19.945 29.09 27.245 23.72 55-59 19.5 29.17 27.01 24.32 60-64 19.465 29.165000000000003 27.37 24.0 65-69 20.185 28.37 27.22 24.224999999999998 70-74 20.235 28.865000000000002 26.97 23.93 75-79 20.150000000000002 28.875 27.57 23.405 80-84 20.46 28.605000000000004 27.189999999999998 23.745 85-89 20.755000000000003 28.685 26.815 23.745 90-94 19.814999999999998 29.054999999999996 27.275 23.855 95-99 20.055 28.52 27.72 23.705000000000002 100-104 20.845 28.345 27.279999999999998 23.53 105-109 20.385 28.78 27.534999999999997 23.3 110-114 20.549999999999997 28.9 27.075 23.474999999999998 115-119 20.796593186372743 28.817635270541082 27.114228456913832 23.271543086172343 120-124 20.556584413634315 28.24465688973422 27.188547975374146 24.01021072125732 125-129 20.34 28.77 26.87 24.02 130-134 20.115 28.42 27.405 24.060000000000002 135-139 21.0 27.99 27.665 23.345 140-144 19.71591477443233 28.413524057217167 27.628288486545966 24.24227268180454 145-149 20.315 28.560000000000002 27.48 23.645 150-151 20.7875 28.249999999999996 27.9125 23.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 0.5 23 3.0 24 4.0 25 3.0 26 4.0 27 6.0 28 12.5 29 17.5 30 22.5 31 25.0 32 29.5 33 43.5 34 65.5 35 78.5 36 80.0 37 102.0 38 136.5 39 167.0 40 187.0 41 190.0 42 214.5 43 257.0 44 275.5 45 281.5 46 278.5 47 260.5 48 240.5 49 219.0 50 182.5 51 148.5 52 121.0 53 85.5 54 62.0 55 50.5 56 40.5 57 28.5 58 19.5 59 17.0 60 9.5 61 6.0 62 5.5 63 3.0 64 1.5 65 1.0 66 1.0 67 1.5 68 2.0 69 1.5 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.2 120-124 0.105 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.03 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7250000000000001 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.2374999999999998 0.0 0.0 0.0 0.0 112-113 1.3625 0.0 0.0 0.0 0.0 114-115 1.4249999999999998 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.6875 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 1.9375 0.0 0.0 0.0 0.0 124-125 2.1375 0.0 0.0 0.0 0.0 126-127 2.2750000000000004 0.0 0.0 0.0 0.0 128-129 2.525 0.0 0.0 0.0 0.0 130-131 2.7375 0.0 0.0 0.0 0.0 132-133 3.0375 0.0 0.0 0.0 0.0 134-135 3.2375 0.0 0.0 0.0 0.0 136-137 3.3625 0.0 0.0 0.0 0.0 138-139 3.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCTCC 10 0.006830828 145.0 3 >>END_MODULE SRR7169902 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169902_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16975 34.0 33.0 34.0 33.0 34.0 2 33.25375 34.0 33.0 34.0 33.0 34.0 3 33.3055 34.0 33.0 34.0 33.0 34.0 4 33.2775 34.0 33.0 34.0 33.0 34.0 5 33.2815 34.0 33.0 34.0 33.0 34.0 6 37.43575 38.0 38.0 38.0 38.0 38.0 7 37.3905 38.0 38.0 38.0 38.0 38.0 8 37.3955 38.0 38.0 38.0 38.0 38.0 9 37.40675 38.0 38.0 38.0 38.0 38.0 10-14 37.3525 38.0 38.0 38.0 37.4 38.0 15-19 37.3358 38.0 38.0 38.0 37.0 38.0 20-24 36.970150000000004 38.0 37.8 38.0 35.6 38.0 25-29 35.9006 38.0 37.2 38.0 30.6 38.0 30-34 37.14065000000001 38.0 38.0 38.0 36.2 38.0 35-39 37.2571 38.0 38.0 38.0 37.0 38.0 40-44 37.06170000000001 38.0 38.0 38.0 36.4 38.0 45-49 37.22195 38.0 38.0 38.0 36.8 38.0 50-54 36.9788 38.0 38.0 38.0 36.0 38.0 55-59 37.17215 38.0 38.0 38.0 36.8 38.0 60-64 36.977 38.0 38.0 38.0 36.2 38.0 65-69 36.97090000000001 38.0 38.0 38.0 36.0 38.0 70-74 37.031600000000005 38.0 38.0 38.0 36.2 38.0 75-79 37.05135 38.0 38.0 38.0 36.0 38.0 80-84 36.98570000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.602549999999994 38.0 38.0 38.0 34.6 38.0 90-94 36.86465 38.0 38.0 38.0 35.8 38.0 95-99 36.82405 38.0 38.0 38.0 35.4 38.0 100-104 36.540499999999994 38.0 38.0 38.0 34.6 38.0 105-109 36.48545 38.0 38.0 38.0 34.0 38.0 110-114 36.4668 38.0 38.0 38.0 34.0 38.0 115-119 36.2503 38.0 38.0 38.0 34.0 38.0 120-124 36.05915 38.0 37.8 38.0 33.2 38.0 125-129 35.9616 38.0 37.0 38.0 33.0 38.0 130-134 35.6935 38.0 36.4 38.0 32.2 38.0 135-139 34.71965 38.0 35.6 38.0 25.4 38.0 140-144 34.6622 38.0 35.2 38.0 27.0 38.0 145-149 33.847699999999996 38.0 35.0 38.0 21.6 38.0 150-151 30.477125 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 2.0 13 1.0 14 1.0 15 1.0 16 2.0 17 2.0 18 5.0 19 5.0 20 6.0 21 2.0 22 2.0 23 8.0 24 9.0 25 13.0 26 16.0 27 20.0 28 25.0 29 24.0 30 33.0 31 43.0 32 73.0 33 91.0 34 128.0 35 270.0 36 685.0 37 2526.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.324999999999996 21.725 13.075000000000001 25.874999999999996 2 26.75 25.874999999999996 29.675 17.7 3 21.275 29.625 31.175000000000004 17.925 4 24.775 33.625 21.825 19.775000000000002 5 24.25 35.175 22.75 17.825 6 20.5 37.824999999999996 22.975 18.7 7 20.474999999999998 22.275 37.9 19.35 8 22.325 26.424999999999997 26.974999999999998 24.275 9 21.725 25.4 29.25 23.625 10-14 23.505000000000003 28.32 26.665 21.51 15-19 23.3 27.644999999999996 27.32 21.735 20-24 22.884999999999998 28.22 27.38 21.515 25-29 22.939999999999998 28.395 27.284999999999997 21.38 30-34 22.91 27.845 28.34 20.905 35-39 23.005 28.744999999999997 27.435 20.815 40-44 23.400000000000002 27.71 28.044999999999998 20.845 45-49 23.830000000000002 27.88 27.665 20.625 50-54 23.119999999999997 27.845 28.335 20.7 55-59 23.445 27.825 28.415000000000003 20.315 60-64 23.7 27.779999999999998 28.065 20.455000000000002 65-69 23.895 28.005000000000003 28.22 19.88 70-74 23.43 28.134999999999998 27.57 20.865000000000002 75-79 24.08 28.18 27.705000000000002 20.035 80-84 23.765 27.900000000000002 27.884999999999998 20.45 85-89 24.145 27.93 27.334999999999997 20.59 90-94 23.630000000000003 27.944999999999997 27.800000000000004 20.625 95-99 23.425 27.495000000000005 28.294999999999998 20.785 100-104 23.43 28.499999999999996 27.705000000000002 20.365 105-109 23.825 27.839999999999996 27.58 20.755000000000003 110-114 24.065 28.360000000000003 27.439999999999998 20.135 115-119 23.995 28.005000000000003 27.515 20.485 120-124 24.25 27.595 27.400000000000002 20.755000000000003 125-129 24.16 27.834999999999997 27.634999999999998 20.369999999999997 130-134 24.33 27.589999999999996 27.88 20.200000000000003 135-139 24.409291149379257 27.277733279935923 27.75330396475771 20.559671605927115 140-144 23.965 27.700000000000003 27.715 20.62 145-149 24.385 26.58 28.32 20.715 150-151 23.9875 28.299999999999997 27.6125 20.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 0.5 23 0.0 24 1.0 25 1.5 26 1.5 27 4.5 28 7.0 29 6.0 30 11.5 31 18.0 32 21.5 33 25.5 34 46.0 35 64.5 36 72.5 37 100.0 38 137.0 39 169.5 40 197.0 41 234.5 42 270.5 43 287.0 44 277.5 45 269.0 46 278.5 47 270.0 48 240.0 49 207.5 50 164.5 51 131.0 52 118.0 53 85.0 54 54.5 55 48.5 56 39.0 57 30.5 58 25.0 59 19.0 60 14.0 61 9.5 62 10.0 63 9.0 64 5.5 65 3.5 66 2.0 67 2.0 68 2.0 69 2.0 70 1.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.12 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.6124999999999998 0.0 0.0 0.0 0.0 118-119 1.8125 0.0 0.0 0.0 0.0 120-121 1.9375 0.0 0.0 0.0 0.0 122-123 2.0875 0.0 0.0 0.0 0.0 124-125 2.2874999999999996 0.0 0.0 0.0 0.0 126-127 2.4000000000000004 0.0 0.0 0.0 0.0 128-129 2.675 0.0 0.0 0.0 0.0 130-131 2.8875 0.0 0.0 0.0 0.0 132-133 3.125 0.0 0.0 0.0 0.0 134-135 3.3125 0.0 0.0 0.0 0.0 136-137 3.4749999999999996 0.0 0.0 0.0 0.0 138-139 3.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAAGA 10 0.006830828 145.0 145 >>END_MODULE Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra Read 606543 spots for SRR7169902.sra Written 606543 spots for SRR7169902.sra Read 606542 spots for SRR7169902.sra Written 606542 spots for SRR7169902.sra SRR ids: ['SRR7169902.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x0ir6wgh SRR7169902.sra spots: 12130841 blocks: [[1, 606542], [606543, 1213084], [1213085, 1819626], [1819627, 2426168], [2426169, 3032710], [3032711, 3639252], [3639253, 4245794], [4245795, 4852336], [4852337, 5458878], [5458879, 6065420], [6065421, 6671962], [6671963, 7278504], [7278505, 7885046], [7885047, 8491588], [8491589, 9098130], [9098131, 9704672], [9704673, 10311214], [10311215, 10917756], [10917757, 11524298], [11524299, 12130841]] SRR7169902 file size 4089043 SRR7169902 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169902 SRR7169902_1.fastq SRR7169902_2.fastq Input file: SRR7169902_1.fastq Paired file: SRR7169902_2.fastq trimmed: SRR7169902-trimmed-pair1.fastq, SRR7169902-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:56:18 2025 >> started Wed Feb 12 01:56:31 2025 >> done (13.176s) 12130841 read pairs processed; of these: 8002 ( 0.07%) short read pairs filtered out after trimming by size control 7216 ( 0.06%) empty read pairs filtered out after trimming by size control 12115623 (99.87%) read pairs available; of these: 5201481 (42.93%) trimmed read pairs available after processing 6914142 (57.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 4 0.00% 24 2 0.00% 25 2 0.00% 26 1 0.00% 27 4 0.00% 28 1 0.00% 29 3 0.00% 30 3 0.00% 31 4 0.00% 32 8 0.00% 33 3 0.00% 34 7 0.00% 35 3 0.00% 36 5 0.00% 37 8 0.00% 38 6 0.00% 39 10 0.00% 40 7 0.00% 41 9 0.00% 42 21 0.00% 43 20 0.00% 44 17 0.00% 45 15 0.00% 46 19 0.00% 47 24 0.00% 48 34 0.00% 49 34 0.00% 50 42 0.00% 51 38 0.00% 52 47 0.00% 53 57 0.00% 54 65 0.00% 55 65 0.00% 56 68 0.00% 57 86 0.00% 58 109 0.00% 59 113 0.00% 60 117 0.00% 61 146 0.00% 62 170 0.00% 63 196 0.00% 64 196 0.00% 65 264 0.00% 66 306 0.00% 67 291 0.00% 68 348 0.00% 69 421 0.00% 70 463 0.00% 71 526 0.00% 72 620 0.01% 73 739 0.01% 74 828 0.01% 75 886 0.01% 76 973 0.01% 77 1099 0.01% 78 1190 0.01% 79 1340 0.01% 80 1519 0.01% 81 1757 0.01% 82 1974 0.02% 83 2228 0.02% 84 2727 0.02% 85 3192 0.03% 86 3286 0.03% 87 3659 0.03% 88 3882 0.03% 89 4233 0.03% 90 4309 0.04% 91 4743 0.04% 92 5168 0.04% 93 5573 0.05% 94 6017 0.05% 95 6279 0.05% 96 6436 0.05% 97 6838 0.06% 98 7035 0.06% 99 7207 0.06% 100 7652 0.06% 101 8052 0.07% 102 8797 0.07% 103 9001 0.07% 104 9643 0.08% 105 10117 0.08% 106 10508 0.09% 107 10550 0.09% 108 10916 0.09% 109 11284 0.09% 110 11556 0.10% 111 11706 0.10% 112 12439 0.10% 113 13144 0.11% 114 13857 0.11% 115 14715 0.12% 116 14910 0.12% 117 15391 0.13% 118 15456 0.13% 119 15650 0.13% 120 16151 0.13% 121 16244 0.13% 122 17104 0.14% 123 18284 0.15% 124 18926 0.16% 125 20026 0.17% 126 20693 0.17% 127 21662 0.18% 128 22164 0.18% 129 23079 0.19% 130 24118 0.20% 131 24845 0.21% 132 26622 0.22% 133 28021 0.23% 134 30267 0.25% 135 31677 0.26% 136 33543 0.28% 137 36281 0.30% 138 38411 0.32% 139 41771 0.34% 140 44972 0.37% 141 50221 0.41% 142 56049 0.46% 143 65553 0.54% 144 78196 0.65% 145 96954 0.80% 146 125739 1.04% 147 174936 1.44% 148 271842 2.24% 149 557195 4.60% 150 2834439 23.39% 151 6914142 57.07% 12115623 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=41 prefix-density=0.17 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCAC criterion=fanout-score sequence-density=0.11 sequence-density-rank=15 fanout-score=226.28 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=27.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=40 prefix-density=0.29 prefix-fanout=2.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=17 fanout-score=262.61 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=27.4 sequence=AAGAAGAAGAAG SRR7169902 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:57:14 Started mapping on | Feb 12 01:57:15 Finished on | Feb 12 01:58:28 Mapping speed, Million of reads per hour | 597.48 Number of input reads | 12115623 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11219419 Uniquely mapped reads % | 92.60% Average mapped length | 295.61 Number of splices: Total | 11088095 Number of splices: Annotated (sjdb) | 10912250 Number of splices: GT/AG | 10924945 Number of splices: GC/AG | 132885 Number of splices: AT/AC | 8783 Number of splices: Non-canonical | 21482 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 214483 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 229932 % of reads mapped to too many loci | 1.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.39% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 690500 690500 690500 N_multimapping 214483 214483 214483 N_noFeature 228249 11113818 271854 N_ambiguous 110436 893 47727 UnstrandedReadsAssigned:10880734 PositiveStrandReadsAssigned:104708 NegativeStrandReadsAssigned:10899838 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169902 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169902-trimmed-pair1.fastq SRR7169902-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,115,623 reads, 10,974,686 reads pseudoaligned [quant] estimated average fragment length: 280.89 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR7169902.ke.tsv 34699 SRR7169902.se.tsv 87100 total ==> SRR7169902.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.11 195 9.94769 Potri.005G024800.1.v4.1 1035 755.11 43 5.04921 Potri.004G059700.1.v4.1 961 681.144 1 0.130175 Potri.007G009000.2.v4.1 1416 1136.11 0 0 Potri.003G141000.2.v4.1 2943 2663.11 214.062 7.12716 Potri.016G087400.1.v4.1 270 73.5098 1066 1285.81 Potri.015G069301.1.v4.1 564 292.821 0 0 Potri.010G195200.1.v4.1 1773 1493.11 17 1.00954 Potri.012G127500.1.v4.1 977 697.127 5238 666.222 ==> SRR7169902.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 673 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 155 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169902 completed mapping pipeline successfully