Starting /dee2/code/volunteer_pipeline.sh SRR7169903 current disk space = 3049191518208 free memory = 1579612520 SRR7169903 SRAfilesize b2ec8f859183cba51f33d7bf0b2d0e8b SRR7169903.sra SRR7169903.sra file validated SRR7169903 is paired end SRR7169903 is conventional basespace SRR7169903 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169903_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.77575 18.0 18.0 18.0 18.0 32.0 2 25.64175 27.0 25.0 27.0 18.0 30.0 3 26.5645 27.0 25.0 29.0 18.0 31.0 4 30.5885 31.0 29.0 33.0 27.0 33.0 5 31.50325 33.0 31.0 33.0 29.0 33.0 6 36.03175 37.0 36.0 38.0 33.0 38.0 7 36.969 38.0 37.0 38.0 35.0 38.0 8 37.161 38.0 38.0 38.0 36.0 38.0 9 37.32225 38.0 38.0 38.0 36.0 38.0 10-14 37.49105 38.0 38.0 38.0 37.0 38.0 15-19 37.473400000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.60185 38.0 38.0 38.0 37.6 38.0 25-29 37.6316 38.0 38.0 38.0 38.0 38.0 30-34 37.5275 38.0 38.0 38.0 37.6 38.0 35-39 37.58255 38.0 38.0 38.0 37.8 38.0 40-44 37.5818 38.0 38.0 38.0 37.8 38.0 45-49 37.522149999999996 38.0 38.0 38.0 37.2 38.0 50-54 37.3505 38.0 38.0 38.0 36.8 38.0 55-59 37.177350000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.994 38.0 38.0 38.0 35.6 38.0 65-69 36.58225 38.0 37.6 38.0 33.8 38.0 70-74 36.889599999999994 38.0 38.0 38.0 35.0 38.0 75-79 36.77305 38.0 38.0 38.0 34.8 38.0 80-84 36.501250000000006 38.0 37.8 38.0 33.4 38.0 85-89 36.12305 38.0 36.8 38.0 32.8 38.0 90-94 36.251599999999996 38.0 37.0 38.0 33.8 38.0 95-99 36.22455 38.0 37.0 38.0 33.4 38.0 100-104 35.78845 38.0 36.6 38.0 31.2 38.0 105-109 35.3004 38.0 35.8 38.0 28.6 38.0 110-114 35.1132 38.0 35.6 38.0 28.6 38.0 115-119 34.261100000000006 37.8 34.2 38.0 24.4 38.0 120-124 33.7606 38.0 33.6 38.0 21.4 38.0 125-129 32.303000000000004 36.8 29.6 38.0 16.2 38.0 130-134 32.81695 37.2 32.2 38.0 18.6 38.0 135-139 32.46265 37.4 31.6 38.0 14.4 38.0 140-144 31.47305 36.6 29.6 38.0 13.2 38.0 145-149 29.295300000000005 36.0 27.0 38.0 4.0 38.0 150-151 22.748874999999998 28.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 3.0 16 1.0 17 0.0 18 2.0 19 4.0 20 2.0 21 4.0 22 14.0 23 8.0 24 15.0 25 14.0 26 13.0 27 20.0 28 23.0 29 41.0 30 70.0 31 110.0 32 146.0 33 238.0 34 398.0 35 787.0 36 1375.0 37 711.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 16.8471417778897 42.28154117350793 7.227398640141022 33.643918408461346 2 23.1 15.075 35.75 26.075 3 19.625 20.150000000000002 26.724999999999998 33.5 4 22.725 28.025 23.175 26.075 5 22.525000000000002 33.7 22.6 21.175 6 16.925 38.0 25.124999999999996 19.950000000000003 7 14.2 25.95 41.725 18.125 8 16.950000000000003 25.374999999999996 31.624999999999996 26.05 9 16.975 25.924999999999997 33.550000000000004 23.549999999999997 10-14 19.900000000000002 30.305 26.855 22.939999999999998 15-19 19.735 28.915000000000003 27.765 23.585 20-24 19.189999999999998 29.360000000000003 27.925 23.525 25-29 19.7 29.17 27.685 23.445 30-34 20.03 29.82 27.0 23.150000000000002 35-39 20.1 29.365000000000002 27.095000000000002 23.44 40-44 19.689999999999998 29.315 27.495000000000005 23.5 45-49 20.005 29.025000000000002 27.395000000000003 23.575 50-54 19.485 29.330000000000002 27.76 23.425 55-59 20.39 28.910000000000004 27.1 23.599999999999998 60-64 19.49 29.26 27.595 23.655 65-69 20.175 28.275 27.92 23.630000000000003 70-74 20.185 29.020000000000003 27.529999999999998 23.265 75-79 20.244999999999997 29.015 27.18 23.56 80-84 19.975 28.84 27.725 23.46 85-89 20.1 28.994999999999997 27.055 23.849999999999998 90-94 20.135 29.255 27.200000000000003 23.41 95-99 20.150000000000002 28.625 27.639999999999997 23.585 100-104 20.49 28.48 27.43 23.599999999999998 105-109 20.28 29.220000000000002 27.345000000000002 23.155 110-114 20.770116669170296 29.07716188473286 27.17941014470983 22.97331130138701 115-119 19.86977210117706 29.23616328575006 27.563235662409213 23.330828950663662 120-124 20.672908426375606 29.124317829069245 27.346918339758673 22.855855404796475 125-129 20.1361429500976 28.93037689574053 27.659041994093798 23.274438160068073 130-134 20.015 28.335 27.689999999999998 23.96 135-139 19.994999999999997 28.294999999999998 27.845 23.865 140-144 19.825 28.315 27.98 23.880000000000003 145-149 19.73 28.865000000000002 27.91 23.494999999999997 150-151 20.1875 28.6125 27.037499999999998 24.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 2.5 25 3.0 26 4.5 27 9.5 28 13.5 29 15.0 30 19.5 31 22.5 32 36.0 33 55.0 34 58.5 35 68.0 36 92.5 37 123.0 38 144.0 39 178.0 40 206.5 41 231.5 42 276.0 43 288.5 44 265.0 45 264.5 46 265.5 47 266.5 48 240.0 49 179.0 50 150.0 51 127.0 52 111.0 53 82.0 54 64.0 55 50.0 56 25.5 57 16.0 58 11.0 59 9.0 60 5.0 61 3.0 62 3.5 63 2.5 64 1.5 65 3.0 66 2.0 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.145 115-119 0.17500000000000002 120-124 0.135 125-129 0.105 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24433249370277 98.5 2 0.7556675062972292 1.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.1749999999999998 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.3875 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 2.0375 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.4125 0.0 0.0 0.0 0.0 124-125 2.575 0.0 0.0 0.0 0.0 126-127 2.75 0.0 0.0 0.0 0.0 128-129 2.9 0.0 0.0 0.0 0.0 130-131 3.05 0.0 0.0 0.0 0.0 132-133 3.2750000000000004 0.0 0.0 0.0 0.0 134-135 3.4124999999999996 0.0 0.0 0.0 0.0 136-137 3.6 0.0 0.0 0.0 0.0 138-139 3.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.0076550315 18.125 40-44 >>END_MODULE SRR7169903 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169903_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.356 34.0 33.0 34.0 33.0 34.0 2 33.4375 34.0 33.0 34.0 33.0 34.0 3 33.482 34.0 33.0 34.0 33.0 34.0 4 33.4685 34.0 33.0 34.0 33.0 34.0 5 33.4545 34.0 33.0 34.0 33.0 34.0 6 37.62425 38.0 38.0 38.0 38.0 38.0 7 37.606 38.0 38.0 38.0 38.0 38.0 8 37.6105 38.0 38.0 38.0 38.0 38.0 9 37.5575 38.0 38.0 38.0 38.0 38.0 10-14 37.1404 38.0 38.0 38.0 36.4 38.0 15-19 37.547399999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.39805 38.0 38.0 38.0 37.4 38.0 25-29 37.4673 38.0 38.0 38.0 37.8 38.0 30-34 37.50655 38.0 38.0 38.0 38.0 38.0 35-39 37.2764 38.0 38.0 38.0 37.2 38.0 40-44 37.364850000000004 38.0 38.0 38.0 37.2 38.0 45-49 37.441 38.0 38.0 38.0 37.6 38.0 50-54 37.38435 38.0 38.0 38.0 37.4 38.0 55-59 37.33 38.0 38.0 38.0 37.0 38.0 60-64 37.24375 38.0 38.0 38.0 37.0 38.0 65-69 36.96745 38.0 38.0 38.0 36.0 38.0 70-74 37.108050000000006 38.0 38.0 38.0 36.6 38.0 75-79 37.13265 38.0 38.0 38.0 36.6 38.0 80-84 36.9511 38.0 38.0 38.0 36.0 38.0 85-89 36.628400000000006 38.0 37.8 38.0 35.0 38.0 90-94 36.6755 38.0 38.0 38.0 34.8 38.0 95-99 36.6332 38.0 38.0 38.0 34.8 38.0 100-104 35.2042 38.0 36.2 38.0 28.0 38.0 105-109 35.89959999999999 38.0 37.0 38.0 32.0 38.0 110-114 35.8078 38.0 36.8 38.0 32.2 38.0 115-119 34.6973 38.0 35.0 38.0 25.0 38.0 120-124 34.900099999999995 38.0 35.4 38.0 27.8 38.0 125-129 33.86880000000001 38.0 34.0 38.0 22.6 38.0 130-134 33.0852 37.8 32.0 38.0 19.2 38.0 135-139 33.14699999999999 38.0 33.0 38.0 19.6 38.0 140-144 32.6065 37.6 32.0 38.0 18.2 38.0 145-149 30.752999999999997 36.8 29.6 38.0 8.2 38.0 150-151 25.311125 32.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 3.0 11 1.0 12 1.0 13 3.0 14 4.0 15 3.0 16 1.0 17 0.0 18 4.0 19 2.0 20 6.0 21 9.0 22 5.0 23 11.0 24 16.0 25 13.0 26 15.0 27 22.0 28 23.0 29 32.0 30 45.0 31 53.0 32 83.0 33 130.0 34 247.0 35 439.0 36 1099.0 37 1726.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.525 21.675 13.175 26.625 2 27.700000000000003 27.775 29.049999999999997 15.475 3 19.0 29.549999999999997 30.8 20.65 4 22.575 35.875 24.05 17.5 5 24.65 36.65 21.55 17.150000000000002 6 20.925 39.275 22.55 17.25 7 19.625 22.05 38.1 20.225 8 22.375 25.75 27.675 24.2 9 21.475 24.2 31.025000000000002 23.3 10-14 22.830000000000002 29.065 26.61 21.495 15-19 22.74 28.189999999999998 28.18 20.89 20-24 22.814999999999998 28.365000000000002 27.889999999999997 20.93 25-29 22.525000000000002 28.494999999999997 27.935 21.044999999999998 30-34 22.725 28.634999999999998 27.66 20.979999999999997 35-39 23.35 28.465 27.474999999999998 20.71 40-44 22.535 29.154999999999998 27.815 20.495 45-49 22.865 28.405 27.994999999999997 20.735 50-54 23.01 28.310000000000002 28.02 20.66 55-59 22.689999999999998 28.345 28.499999999999996 20.465 60-64 22.88 28.33 28.16 20.630000000000003 65-69 23.36 27.634999999999998 28.720000000000002 20.285 70-74 23.1 28.310000000000002 27.860000000000003 20.73 75-79 23.265 28.544999999999998 27.98 20.21 80-84 23.275000000000002 28.255000000000003 28.275 20.195 85-89 22.62 28.435 28.12 20.825 90-94 23.62 28.389999999999997 27.88 20.11 95-99 23.415 28.060000000000002 28.105000000000004 20.419999999999998 100-104 23.94 28.065 28.02 19.975 105-109 23.294999999999998 28.575 28.24 19.89 110-114 23.599999999999998 28.4 28.025 19.975 115-119 23.9 28.110000000000003 27.839999999999996 20.150000000000002 120-124 23.13 27.750000000000004 28.62 20.5 125-129 24.159663865546218 28.55642256902761 27.465986394557824 19.817927170868348 130-134 23.52 27.815 28.415000000000003 20.25 135-139 23.97 27.6 28.134999999999998 20.294999999999998 140-144 23.435 28.285 28.075 20.205000000000002 145-149 24.205 27.915 27.200000000000003 20.68 150-151 24.125 27.787499999999998 28.249999999999996 19.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.5 22 3.0 23 2.0 24 0.5 25 0.5 26 5.0 27 6.0 28 6.0 29 12.0 30 17.0 31 25.5 32 29.0 33 32.5 34 45.0 35 65.0 36 87.5 37 111.5 38 146.0 39 181.5 40 203.5 41 223.5 42 252.5 43 297.0 44 325.0 45 305.5 46 272.5 47 261.0 48 233.5 49 184.5 50 155.0 51 125.5 52 105.5 53 84.5 54 61.0 55 40.5 56 23.5 57 19.0 58 13.0 59 9.5 60 7.0 61 2.5 62 2.0 63 3.0 64 2.0 65 2.0 66 2.0 67 2.5 68 1.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.04 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29453262786596 98.52499999999999 2 0.655076845553036 1.3 3 0.02519526329050139 0.075 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.9625 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.2999999999999998 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.6625 0.0 0.0 0.0 0.0 118-119 1.925 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.2875 0.0 0.0 0.0 0.0 124-125 2.5 0.0 0.0 0.0 0.0 126-127 2.7125 0.0 0.0 0.0 0.0 128-129 2.8375000000000004 0.0 0.0 0.0 0.0 130-131 2.9749999999999996 0.0 0.0 0.0 0.0 132-133 3.2 0.0 0.0 0.0 0.0 134-135 3.3625 0.0 0.0 0.0 0.0 136-137 3.525 0.0 0.0 0.0 0.0 138-139 3.8499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGATA 10 0.006830828 145.0 7 GGAATAT 10 0.006830828 145.0 2 >>END_MODULE Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra Read 619625 spots for SRR7169903.sra Written 619625 spots for SRR7169903.sra Read 619616 spots for SRR7169903.sra Written 619616 spots for SRR7169903.sra SRR ids: ['SRR7169903.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wtdfv7zw SRR7169903.sra spots: 12392329 blocks: [[1, 619616], [619617, 1239232], [1239233, 1858848], [1858849, 2478464], [2478465, 3098080], [3098081, 3717696], [3717697, 4337312], [4337313, 4956928], [4956929, 5576544], [5576545, 6196160], [6196161, 6815776], [6815777, 7435392], [7435393, 8055008], [8055009, 8674624], [8674625, 9294240], [9294241, 9913856], [9913857, 10533472], [10533473, 11153088], [11153089, 11772704], [11772705, 12392329]] SRR7169903 file size 4177653 SRR7169903 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169903 SRR7169903_1.fastq SRR7169903_2.fastq Input file: SRR7169903_1.fastq Paired file: SRR7169903_2.fastq trimmed: SRR7169903-trimmed-pair1.fastq, SRR7169903-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:41:17 2025 >> started Wed Feb 12 02:41:30 2025 >> done (13.239s) 12392329 read pairs processed; of these: 4295 ( 0.03%) short read pairs filtered out after trimming by size control 3760 ( 0.03%) empty read pairs filtered out after trimming by size control 12384274 (99.94%) read pairs available; of these: 6212841 (50.17%) trimmed read pairs available after processing 6171433 (49.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 4 0.00% 21 2 0.00% 22 1 0.00% 23 3 0.00% 24 3 0.00% 25 1 0.00% 26 2 0.00% 27 0 0.00% 28 2 0.00% 29 3 0.00% 30 2 0.00% 31 10 0.00% 32 6 0.00% 33 2 0.00% 34 9 0.00% 35 5 0.00% 36 7 0.00% 37 7 0.00% 38 6 0.00% 39 7 0.00% 40 12 0.00% 41 8 0.00% 42 10 0.00% 43 10 0.00% 44 17 0.00% 45 19 0.00% 46 20 0.00% 47 23 0.00% 48 28 0.00% 49 43 0.00% 50 41 0.00% 51 44 0.00% 52 41 0.00% 53 60 0.00% 54 64 0.00% 55 84 0.00% 56 98 0.00% 57 95 0.00% 58 114 0.00% 59 122 0.00% 60 151 0.00% 61 150 0.00% 62 177 0.00% 63 207 0.00% 64 222 0.00% 65 249 0.00% 66 276 0.00% 67 321 0.00% 68 349 0.00% 69 404 0.00% 70 479 0.00% 71 617 0.00% 72 650 0.01% 73 736 0.01% 74 880 0.01% 75 951 0.01% 76 1049 0.01% 77 1198 0.01% 78 1324 0.01% 79 1420 0.01% 80 1621 0.01% 81 1772 0.01% 82 2125 0.02% 83 2370 0.02% 84 2847 0.02% 85 3223 0.03% 86 3385 0.03% 87 3610 0.03% 88 3822 0.03% 89 4003 0.03% 90 4399 0.04% 91 4539 0.04% 92 5053 0.04% 93 5703 0.05% 94 5977 0.05% 95 6304 0.05% 96 6586 0.05% 97 6842 0.06% 98 7117 0.06% 99 7446 0.06% 100 7905 0.06% 101 8346 0.07% 102 8847 0.07% 103 9228 0.07% 104 9554 0.08% 105 10203 0.08% 106 10378 0.08% 107 10907 0.09% 108 11227 0.09% 109 11594 0.09% 110 11827 0.10% 111 12323 0.10% 112 12861 0.10% 113 13390 0.11% 114 14157 0.11% 115 14793 0.12% 116 15108 0.12% 117 15322 0.12% 118 15815 0.13% 119 16253 0.13% 120 16600 0.13% 121 17288 0.14% 122 17953 0.14% 123 18542 0.15% 124 19667 0.16% 125 20450 0.17% 126 21867 0.18% 127 22908 0.18% 128 23905 0.19% 129 24881 0.20% 130 25595 0.21% 131 27291 0.22% 132 28906 0.23% 133 31146 0.25% 134 33080 0.27% 135 36332 0.29% 136 39194 0.32% 137 42234 0.34% 138 46407 0.37% 139 50911 0.41% 140 56172 0.45% 141 62723 0.51% 142 71651 0.58% 143 83682 0.68% 144 101210 0.82% 145 126173 1.02% 146 165629 1.34% 147 233455 1.89% 148 369885 2.99% 149 748711 6.05% 150 3286765 26.54% 151 6171433 49.83% 12384274 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.44 fanout-score-rank=30 prefix-density=0.19 prefix-fanout=2.9 sequence=AAAGAAGTCAAC criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=257.55 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=28.8 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=38 prefix-density=0.43 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=277.95 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=29.2 sequence=AAGAAGAAGAAA SRR7169903 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:42:14 Started mapping on | Feb 12 02:42:14 Finished on | Feb 12 02:43:17 Mapping speed, Million of reads per hour | 707.67 Number of input reads | 12384274 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11817779 Uniquely mapped reads % | 95.43% Average mapped length | 295.10 Number of splices: Total | 11925596 Number of splices: Annotated (sjdb) | 11742623 Number of splices: GT/AG | 11749772 Number of splices: GC/AG | 143391 Number of splices: AT/AC | 9053 Number of splices: Non-canonical | 23380 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 204507 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 9109 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 368065 368065 368065 N_multimapping 204507 204507 204507 N_noFeature 257284 11710549 308757 N_ambiguous 105597 615 49387 UnstrandedReadsAssigned:11454898 PositiveStrandReadsAssigned:106615 NegativeStrandReadsAssigned:11459635 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169903 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169903-trimmed-pair1.fastq SRR7169903-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,384,274 reads, 11,323,789 reads pseudoaligned [quant] estimated average fragment length: 277.365 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR7169903.ke.tsv 34699 SRR7169903.se.tsv 87100 total ==> SRR7169903.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1741.63 213 11.5184 Potri.005G024800.1.v4.1 1035 758.635 26 3.22783 Potri.004G059700.1.v4.1 961 684.664 1 0.13756 Potri.007G009000.2.v4.1 1416 1139.63 0 0 Potri.003G141000.2.v4.1 2943 2666.63 269.067 9.50314 Potri.016G087400.1.v4.1 270 74.6587 1002 1264.03 Potri.015G069301.1.v4.1 564 295.549 0 0 Potri.010G195200.1.v4.1 1773 1496.63 5 0.314648 Potri.012G127500.1.v4.1 977 700.652 4768 640.92 ==> SRR7169903.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 688 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 190 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169903 completed mapping pipeline successfully