Starting /dee2/code/volunteer_pipeline.sh SRR7169904 current disk space = 3050860683264 free memory = 923447732 SRR7169904 SRAfilesize 37e7ad0d50954904a95fd0e8402d28d4 SRR7169904.sra SRR7169904.sra file validated SRR7169904 is paired end SRR7169904 is conventional basespace SRR7169904 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169904_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.975 18.0 18.0 18.0 18.0 32.0 2 26.60575 27.0 25.0 29.0 18.0 31.0 3 27.498 29.0 25.0 31.0 18.0 33.0 4 30.6085 31.0 29.0 33.0 27.0 33.0 5 31.314 33.0 31.0 33.0 29.0 33.0 6 36.13075 37.0 36.0 38.0 33.0 38.0 7 36.99375 38.0 37.0 38.0 35.0 38.0 8 37.08325 38.0 38.0 38.0 35.0 38.0 9 36.025 38.0 37.0 38.0 31.0 38.0 10-14 37.3394 38.0 38.0 38.0 36.4 38.0 15-19 37.3467 38.0 38.0 38.0 36.8 38.0 20-24 37.3785 38.0 38.0 38.0 36.8 38.0 25-29 37.56165 38.0 38.0 38.0 38.0 38.0 30-34 37.48145 38.0 38.0 38.0 37.4 38.0 35-39 37.44375 38.0 38.0 38.0 37.0 38.0 40-44 37.25295 38.0 38.0 38.0 36.8 38.0 45-49 37.44475 38.0 38.0 38.0 37.0 38.0 50-54 37.32705 38.0 38.0 38.0 37.0 38.0 55-59 37.201800000000006 38.0 38.0 38.0 36.0 38.0 60-64 37.11515000000001 38.0 38.0 38.0 36.0 38.0 65-69 37.066649999999996 38.0 38.0 38.0 36.0 38.0 70-74 37.0061 38.0 38.0 38.0 35.8 38.0 75-79 36.805400000000006 38.0 38.0 38.0 35.2 38.0 80-84 36.350750000000005 38.0 37.6 38.0 33.8 38.0 85-89 35.78085 38.0 36.6 38.0 31.4 38.0 90-94 36.309000000000005 38.0 37.4 38.0 34.0 38.0 95-99 36.2201 38.0 37.0 38.0 34.0 38.0 100-104 36.0044 38.0 37.0 38.0 33.0 38.0 105-109 34.829750000000004 38.0 35.2 38.0 26.0 38.0 110-114 34.90935 38.0 35.2 38.0 26.4 38.0 115-119 35.07245 38.0 35.6 38.0 28.4 38.0 120-124 34.933350000000004 38.0 35.2 38.0 28.0 38.0 125-129 33.4317 37.4 32.2 38.0 22.2 38.0 130-134 33.50555 37.6 33.2 38.0 22.2 38.0 135-139 33.78845 38.0 33.4 38.0 23.0 38.0 140-144 32.90755 37.8 32.4 38.0 18.6 38.0 145-149 31.369100000000003 36.4 31.0 38.0 13.2 38.0 150-151 27.161125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 3.0 15 0.0 16 1.0 17 3.0 18 11.0 19 16.0 20 5.0 21 1.0 22 5.0 23 2.0 24 9.0 25 14.0 26 10.0 27 13.0 28 29.0 29 38.0 30 62.0 31 70.0 32 103.0 33 169.0 34 307.0 35 618.0 36 1394.0 37 1115.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.4 19.3 11.200000000000001 35.099999999999994 2 23.186593296648326 16.258129064532266 32.31615807903952 28.23911955977989 3 20.875 21.425 26.150000000000002 31.55 4 22.3 28.449999999999996 23.425 25.825 5 24.5 30.675 24.375 20.45 6 20.25 35.775 24.425 19.55 7 14.549999999999999 28.249999999999996 40.675 16.525000000000002 8 18.85 27.474999999999998 28.825 24.85 9 17.825 26.025 33.225 22.925 10-14 19.314999999999998 30.635 27.12 22.93 15-19 20.044999999999998 29.409999999999997 27.22 23.325000000000003 20-24 19.735 29.38 27.71 23.175 25-29 20.24 28.98 27.6 23.18 30-34 19.509999999999998 29.37 27.77 23.35 35-39 19.715 29.64 27.395000000000003 23.25 40-44 19.66 30.06 26.810000000000002 23.47 45-49 19.355 29.23 27.150000000000002 24.265 50-54 19.445 29.38 27.279999999999998 23.895 55-59 19.885 29.520000000000003 27.185 23.41 60-64 20.3 28.77 27.72 23.21 65-69 20.085 29.404999999999998 26.855 23.655 70-74 19.759999999999998 29.825000000000003 27.139999999999997 23.275000000000002 75-79 19.545 29.349999999999998 27.165 23.94 80-84 19.715 29.13 26.745 24.41 85-89 19.825 29.255 27.005000000000003 23.915 90-94 19.895 29.13 27.21 23.765 95-99 19.735 28.92 27.455000000000002 23.89 100-104 20.265 28.785 27.145000000000003 23.805 105-109 20.57 28.585 26.884999999999998 23.96 110-114 20.18 29.485 26.700000000000003 23.635 115-119 20.415 29.255 27.07 23.26 120-124 20.145 29.04 27.089999999999996 23.724999999999998 125-129 20.275000000000002 28.325 27.495000000000005 23.905 130-134 20.064999999999998 28.665000000000003 26.790000000000003 24.48 135-139 19.975 28.46 27.500000000000004 24.065 140-144 20.169999999999998 28.470000000000002 27.68 23.68 145-149 20.275000000000002 28.665000000000003 26.96 24.099999999999998 150-151 18.725 28.9375 27.825 24.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 3.5 25 3.5 26 3.5 27 7.0 28 14.5 29 20.0 30 22.0 31 28.0 32 41.0 33 56.0 34 59.5 35 75.5 36 100.0 37 116.0 38 139.5 39 176.0 40 211.0 41 230.0 42 242.0 43 249.5 44 260.0 45 263.0 46 258.5 47 234.0 48 222.5 49 205.5 50 163.0 51 138.5 52 116.5 53 95.0 54 68.0 55 43.5 56 32.0 57 30.5 58 24.0 59 13.0 60 7.0 61 5.0 62 5.5 63 4.5 64 2.5 65 2.0 66 1.0 67 1.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74811083123426 99.0 2 0.20151133501259444 0.4 3 0.0 0.0 4 0.0 0.0 5 0.025188916876574305 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025188916876574305 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 19 0.475 TruSeq Adapter, Index 3 (97% over 36bp) AATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 5 0.125 TruSeq Adapter, Index 10 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.3624999999999998 0.0 0.0 0.0 0.0 116-117 1.4875 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 1.875 0.0 0.0 0.0 0.0 122-123 1.9249999999999998 0.0 0.0 0.0 0.0 124-125 2.0875 0.0 0.0 0.0 0.0 126-127 2.2375 0.0 0.0 0.0 0.0 128-129 2.475 0.0 0.0 0.0 0.0 130-131 2.5875000000000004 0.0 0.0 0.0 0.0 132-133 2.7375 0.0 0.0 0.0 0.0 134-135 2.9000000000000004 0.0 0.0 0.0 0.0 136-137 3.0625 0.0 0.0 0.0 0.0 138-139 3.2249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169904 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169904_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1675 34.0 33.0 34.0 33.0 34.0 2 33.19 34.0 33.0 34.0 33.0 34.0 3 33.27625 34.0 33.0 34.0 33.0 34.0 4 33.22675 34.0 33.0 34.0 33.0 34.0 5 33.18975 34.0 33.0 34.0 33.0 34.0 6 37.38875 38.0 38.0 38.0 38.0 38.0 7 37.36375 38.0 38.0 38.0 37.0 38.0 8 37.2275 38.0 38.0 38.0 37.0 38.0 9 37.32225 38.0 38.0 38.0 37.0 38.0 10-14 37.20035 38.0 38.0 38.0 37.0 38.0 15-19 37.216300000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.2331 38.0 38.0 38.0 37.0 38.0 25-29 36.91645 38.0 38.0 38.0 36.0 38.0 30-34 37.136649999999996 38.0 38.0 38.0 36.8 38.0 35-39 36.93975 38.0 38.0 38.0 36.0 38.0 40-44 37.134100000000004 38.0 38.0 38.0 36.8 38.0 45-49 36.75565 38.0 38.0 38.0 35.0 38.0 50-54 36.98205 38.0 38.0 38.0 36.2 38.0 55-59 37.042899999999996 38.0 38.0 38.0 36.2 38.0 60-64 36.9148 38.0 38.0 38.0 36.0 38.0 65-69 36.9876 38.0 38.0 38.0 36.0 38.0 70-74 36.963 38.0 38.0 38.0 36.0 38.0 75-79 36.92355 38.0 38.0 38.0 36.0 38.0 80-84 36.562650000000005 38.0 38.0 38.0 34.8 38.0 85-89 36.39640000000001 38.0 38.0 38.0 34.4 38.0 90-94 36.386399999999995 38.0 38.0 38.0 34.4 38.0 95-99 36.2919 38.0 38.0 38.0 34.0 38.0 100-104 36.164249999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.0594 38.0 38.0 38.0 33.8 38.0 110-114 35.921949999999995 38.0 37.4 38.0 33.2 38.0 115-119 35.79575 38.0 37.4 38.0 32.4 38.0 120-124 35.4794 38.0 36.8 38.0 31.0 38.0 125-129 34.94805 38.0 35.8 38.0 27.8 38.0 130-134 35.07615 38.0 36.0 38.0 30.0 38.0 135-139 33.5396 38.0 33.8 38.0 19.6 38.0 140-144 33.143150000000006 38.0 33.0 38.0 20.2 38.0 145-149 32.53955 38.0 32.6 38.0 14.6 38.0 150-151 28.646375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 2.0 5 2.0 6 2.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 1.0 14 2.0 15 5.0 16 3.0 17 5.0 18 4.0 19 7.0 20 20.0 21 9.0 22 4.0 23 7.0 24 9.0 25 17.0 26 11.0 27 17.0 28 20.0 29 41.0 30 34.0 31 65.0 32 69.0 33 107.0 34 164.0 35 276.0 36 778.0 37 2308.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.275 21.825 16.5 25.4 2 27.35683920980245 26.331582895723933 28.507126781695426 17.804451112778192 3 21.05 28.275 31.624999999999996 19.05 4 22.95573893473368 34.583645911477866 22.605651412853213 19.854963740935233 5 25.63140785196299 35.08377094273568 21.880470117529384 17.404351087771943 6 22.125 35.975 22.85 19.05 7 20.05 22.0 38.475 19.475 8 23.425 25.174999999999997 25.374999999999996 26.025 9 21.7 26.625 29.4 22.275 10-14 23.5 28.73 26.205000000000002 21.565 15-19 23.51 27.534999999999997 28.115000000000002 20.84 20-24 23.810000000000002 28.325 27.439999999999998 20.424999999999997 25-29 23.44 28.82 27.43 20.31 30-34 22.775000000000002 28.110000000000003 27.785 21.33 35-39 23.275000000000002 28.015 27.515 21.195 40-44 23.849999999999998 27.875 27.93 20.345 45-49 23.24 27.96 27.16 21.64 50-54 23.915 27.68 28.1 20.305 55-59 23.59 28.349999999999998 27.11 20.95 60-64 23.595 28.005000000000003 27.839999999999996 20.560000000000002 65-69 23.425 27.85 28.225 20.5 70-74 23.745 28.58 26.97 20.705000000000002 75-79 23.59 28.349999999999998 27.71 20.349999999999998 80-84 23.235 28.485 27.99 20.29 85-89 23.735 28.465 28.025 19.775000000000002 90-94 24.265 28.175 27.51 20.05 95-99 24.395 28.125 27.229999999999997 20.25 100-104 24.645 28.155 27.189999999999998 20.01 105-109 24.055 27.765 28.139999999999997 20.04 110-114 24.175 27.51 28.165000000000003 20.150000000000002 115-119 23.995 27.755000000000003 27.92 20.330000000000002 120-124 24.104999999999997 27.975 27.694999999999997 20.225 125-129 23.86 28.025 27.38 20.735 130-134 24.884999999999998 28.335 26.325 20.455000000000002 135-139 24.04 28.075 27.41 20.474999999999998 140-144 23.94 28.105000000000004 27.26 20.695 145-149 24.84 27.435 27.91 19.814999999999998 150-151 24.6875 27.8875 27.175 20.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 1.0 25 1.5 26 1.5 27 2.0 28 4.5 29 5.0 30 11.0 31 13.0 32 15.0 33 30.0 34 42.0 35 56.0 36 86.5 37 106.0 38 118.5 39 149.5 40 199.5 41 238.0 42 266.0 43 300.0 44 300.5 45 277.5 46 266.0 47 264.5 48 243.5 49 212.0 50 186.5 51 145.5 52 110.5 53 92.5 54 67.0 55 50.0 56 42.0 57 30.0 58 20.0 59 13.0 60 8.5 61 5.5 62 4.5 63 3.5 64 2.0 65 2.0 66 1.5 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87421383647799 99.25 2 0.10062893081761005 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025157232704402514 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 22 0.5499999999999999 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.1375 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.525 0.0 0.0 0.0 0.0 118-119 1.825 0.0 0.0 0.0 0.0 120-121 1.975 0.0 0.0 0.0 0.0 122-123 2.025 0.0 0.0 0.0 0.0 124-125 2.1875 0.0 0.0 0.0 0.0 126-127 2.4000000000000004 0.0 0.0 0.0 0.0 128-129 2.65 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 2.9124999999999996 0.0 0.0 0.0 0.0 134-135 3.0875 0.0 0.0 0.0 0.0 136-137 3.2625 0.0 0.0 0.0 0.0 138-139 3.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAAGT 10 0.006830828 145.0 1 >>END_MODULE Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557370 spots for SRR7169904.sra Written 557370 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra Read 557365 spots for SRR7169904.sra Written 557365 spots for SRR7169904.sra SRR ids: ['SRR7169904.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9vg7jp6u SRR7169904.sra spots: 11147305 blocks: [[1, 557365], [557366, 1114730], [1114731, 1672095], [1672096, 2229460], [2229461, 2786825], [2786826, 3344190], [3344191, 3901555], [3901556, 4458920], [4458921, 5016285], [5016286, 5573650], [5573651, 6131015], [6131016, 6688380], [6688381, 7245745], [7245746, 7803110], [7803111, 8360475], [8360476, 8917840], [8917841, 9475205], [9475206, 10032570], [10032571, 10589935], [10589936, 11147305]] SRR7169904 file size 3755755 SRR7169904 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169904 SRR7169904_1.fastq SRR7169904_2.fastq Input file: SRR7169904_1.fastq Paired file: SRR7169904_2.fastq trimmed: SRR7169904-trimmed-pair1.fastq, SRR7169904-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 01:49:30 2025 >> started Wed Feb 12 01:49:42 2025 >> done (11.777s) 11147305 read pairs processed; of these: 12223 ( 0.11%) short read pairs filtered out after trimming by size control 89719 ( 0.80%) empty read pairs filtered out after trimming by size control 11045363 (99.09%) read pairs available; of these: 5214548 (47.21%) trimmed read pairs available after processing 5830815 (52.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 3 0.00% 24 1 0.00% 25 3 0.00% 26 3 0.00% 27 5 0.00% 28 5 0.00% 29 3 0.00% 30 2 0.00% 31 7 0.00% 32 3 0.00% 33 5 0.00% 34 3 0.00% 35 3 0.00% 36 7 0.00% 37 16 0.00% 38 24 0.00% 39 19 0.00% 40 34 0.00% 41 16 0.00% 42 11 0.00% 43 16 0.00% 44 18 0.00% 45 31 0.00% 46 34 0.00% 47 47 0.00% 48 40 0.00% 49 50 0.00% 50 46 0.00% 51 69 0.00% 52 81 0.00% 53 83 0.00% 54 75 0.00% 55 81 0.00% 56 112 0.00% 57 107 0.00% 58 125 0.00% 59 177 0.00% 60 197 0.00% 61 222 0.00% 62 232 0.00% 63 255 0.00% 64 284 0.00% 65 294 0.00% 66 357 0.00% 67 349 0.00% 68 408 0.00% 69 526 0.00% 70 507 0.00% 71 632 0.01% 72 758 0.01% 73 899 0.01% 74 930 0.01% 75 1089 0.01% 76 1511 0.01% 77 2017 0.02% 78 1629 0.01% 79 1561 0.01% 80 1667 0.02% 81 1927 0.02% 82 2191 0.02% 83 2332 0.02% 84 3016 0.03% 85 3538 0.03% 86 3872 0.04% 87 4007 0.04% 88 4262 0.04% 89 4288 0.04% 90 4621 0.04% 91 4890 0.04% 92 5184 0.05% 93 5479 0.05% 94 5834 0.05% 95 6098 0.06% 96 6348 0.06% 97 6580 0.06% 98 6692 0.06% 99 6851 0.06% 100 7467 0.07% 101 7627 0.07% 102 8005 0.07% 103 8632 0.08% 104 8852 0.08% 105 9281 0.08% 106 9630 0.09% 107 9885 0.09% 108 10120 0.09% 109 10347 0.09% 110 10593 0.10% 111 11167 0.10% 112 11545 0.10% 113 12100 0.11% 114 12412 0.11% 115 13479 0.12% 116 13479 0.12% 117 13690 0.12% 118 13997 0.13% 119 14107 0.13% 120 14651 0.13% 121 15288 0.14% 122 15552 0.14% 123 16313 0.15% 124 17283 0.16% 125 18244 0.17% 126 18385 0.17% 127 19597 0.18% 128 19900 0.18% 129 20894 0.19% 130 22039 0.20% 131 23002 0.21% 132 24701 0.22% 133 26191 0.24% 134 27968 0.25% 135 30092 0.27% 136 32609 0.30% 137 35323 0.32% 138 38345 0.35% 139 41944 0.38% 140 46208 0.42% 141 51916 0.47% 142 58969 0.53% 143 68868 0.62% 144 82971 0.75% 145 105875 0.96% 146 137737 1.25% 147 195202 1.77% 148 310109 2.81% 149 615686 5.57% 150 2740558 24.81% 151 5830815 52.79% 11045363 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.97 fanout-score-rank=29 prefix-density=0.16 prefix-fanout=3.3 sequence=CCCTCACGGAAGACTGAGAGAAGCTTTTCATCGGAGCGAGAGTTCTCGAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=325.26 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=20.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=33 prefix-density=0.26 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=36 fanout-score=52.64 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=13.5 sequence=TTCTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTC SRR7169904 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 01:50:36 Started mapping on | Feb 12 01:50:36 Finished on | Feb 12 01:51:32 Mapping speed, Million of reads per hour | 710.06 Number of input reads | 11045363 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10349313 Uniquely mapped reads % | 93.70% Average mapped length | 295.21 Number of splices: Total | 9554104 Number of splices: Annotated (sjdb) | 9388858 Number of splices: GT/AG | 9407956 Number of splices: GC/AG | 117110 Number of splices: AT/AC | 7003 Number of splices: Non-canonical | 22035 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 192677 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 14717 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.39% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 516116 516116 516116 N_multimapping 192677 192677 192677 N_noFeature 244724 10233986 287804 N_ambiguous 120655 1047 47715 UnstrandedReadsAssigned:9983934 PositiveStrandReadsAssigned:114280 NegativeStrandReadsAssigned:10013794 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169904 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169904-trimmed-pair1.fastq SRR7169904-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,045,363 reads, 9,947,443 reads pseudoaligned [quant] estimated average fragment length: 299.094 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,262 rounds 52401 SRR7169904.ke.tsv 34699 SRR7169904.se.tsv 87100 total ==> SRR7169904.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1719.91 219 12.7346 Potri.005G024800.1.v4.1 1035 736.906 42 5.70012 Potri.004G059700.1.v4.1 961 662.952 5 0.754284 Potri.007G009000.2.v4.1 1416 1117.91 0 0 Potri.003G141000.2.v4.1 2943 2644.91 202.035 7.63949 Potri.016G087400.1.v4.1 270 75.4946 883.559 1170.49 Potri.015G069301.1.v4.1 564 276.115 0 0 Potri.010G195200.1.v4.1 1773 1474.91 76 5.15343 Potri.012G127500.1.v4.1 977 678.93 5726 843.478 ==> SRR7169904.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1513 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 262 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169904 completed mapping pipeline successfully